Nabble - Bio.net - Staden

Error codes

2009-07-16T23:39:30Z

Hello !!!

Please I would like to know about the meaning of some pregap4's error
codes. In file pregap.log the information about the failed files
(here just two) is:

home/... /10f.exp (EXP) ERROR: screen_vector:
11r.exp (???) ERROR: gap4_assemble: failed with code 1

basically I use the same setup with many files and just few has error
... why no all sequences?, and I don't know what is the "code 1".

I understand that the error is the ".exp" files, but I don't know how to solve.

Thanks very much.

Macarena.

_______________________________________________
Staden mailing list
Staden@...
http://www.bio.net/biomail/listinfo/staden

How to install Staden 1.7.0 on Mac OS 10.5?

2009-06-17T10:36:30Z

Hi, I have a stupid question. I'm trying to install Staden 1.7.0 on
Mac OS 10.5. After I unzip the file that I downloaded from Softpedia
(http://mac.softpedia.com/progDownload/Staden-Package-
Download-27956.html), I can't figure out how to install it. Can anyone
tell me tell me how to do it? Thanks!

_______________________________________________
Staden mailing list
Staden@...
http://www.bio.net/biomail/listinfo/staden

Re: gap4 running problem load_alignment_matrix error

2009-02-01T15:20:54Z

Thank you, that fixed it & now I can run Gap4 so I'm very happy.

This was the error I got after running 'export STADEN_DEBUG=1'

load libcopy_reads.so => couldn't load file "libcopy_reads.so": /usr/lib/libstdc++.so.5: version `CXXABI_1.2' not found (required by /usr/local/staden-linux-x86_64-1-7-1b/linux-x86_64-bin/../lib/linux-x86_64-binaries/libmutlib.so)

I had linked it to a newer version. So I unlinked & reinstalled libstdc++5 & that seemed to fix my problem.

Thanks again alig

Paul Donohue-4 wrote:

I don't see anything in particular in your strace output after a quick look.

Try running 'export STADEN_DEBUG=1' before running staden, and see what that says.
You can ignore the 'libiwidgets.so' error, but any other errors need to be fixed.

Note that you can use the 'Search the contents of packages' form at http://packages.ubuntu.com/ to figure out the appropriate package to install for any missing libraries.

Hope that helps.
-Paul

On Thu, Jan 29, 2009 at 06:27:19PM -0800, alig wrote:
>
> Hi,
>
> I am trying to install Staden Gap4 on a 64 bit machine with Ubuntu
> installed.
>
> It appears that trev & pregap will start. But when I type gap4& I get this
> message -
>
> invalid command name "load_alignment_matrix"
> while executing
> "load_alignment_matrix [keylget gap_defs ALIGNMENT.MATRIX_FILE]"
> (file
> "/usr/local/staden-linux-x86_64-1-7-1b/linux-x86_64-bin/../lib/gap/gap.tcl"
> line 683)
>
> I have followed a number of suggestions from this site & others & installed
> some missing libraries, but still get this message.
> Have done strace -o output.txt gap4 and not sure of any more errors in that
> file.
> I will try to attach the file
> http://www.nabble.com/file/p21740409/output.txt output.txt
>
> Can anyone help please
> --
> View this message in context: http://www.nabble.com/gap4-running-problem-load_alignment_matrix-error-tp21740409p21740409.html
> Sent from the Bio.net - Staden mailing list archive at Nabble.com.
>
> _______________________________________________
> Staden mailing list
> Staden@net.bio.net
> http://www.bio.net/biomail/listinfo/staden
>

_______________________________________________
Staden mailing list
Staden@net.bio.net
http://www.bio.net/biomail/listinfo/staden

Re: gap4 running problem load_alignment_matrix error

2009-01-31T07:01:52Z

I don't see anything in particular in your strace output after a quick look.

Try running 'export STADEN_DEBUG=1' before running staden, and see what that says.
You can ignore the 'libiwidgets.so' error, but any other errors need to be fixed.

Note that you can use the 'Search the contents of packages' form at http://packages.ubuntu.com/ to figure out the appropriate package to install for any missing libraries.

Hope that helps.
-Paul

On Thu, Jan 29, 2009 at 06:27:19PM -0800, alig wrote:

>
> Hi,
>
> I am trying to install Staden Gap4 on a 64 bit machine with Ubuntu
> installed.
>
> It appears that trev & pregap will start. But when I type gap4& I get this
> message -
>
> invalid command name "load_alignment_matrix"
> while executing
> "load_alignment_matrix [keylget gap_defs ALIGNMENT.MATRIX_FILE]"
> (file
> "/usr/local/staden-linux-x86_64-1-7-1b/linux-x86_64-bin/../lib/gap/gap.tcl"
> line 683)
>
> I have followed a number of suggestions from this site & others & installed
> some missing libraries, but still get this message.
> Have done strace -o output.txt gap4 and not sure of any more errors in that
> file.
> I will try to attach the file
> http://www.nabble.com/file/p21740409/output.txt output.txt
>
> Can anyone help please
> --
> View this message in context: http://www.nabble.com/gap4-running-problem-load_alignment_matrix-error-tp21740409p21740409.html
> Sent from the Bio.net - Staden mailing list archive at Nabble.com.
>
> _______________________________________________
> Staden mailing list
> Staden@...
> http://www.bio.net/biomail/listinfo/staden
>

_______________________________________________
Staden mailing list
Staden@...
http://www.bio.net/biomail/listinfo/staden

gap4 running problem load_alignment_matrix error

2009-01-29T18:27:19Z

Hi,

I am trying to install Staden Gap4 on a 64 bit machine with Ubuntu installed.

It appears that trev & pregap will start. But when I type gap4& I get this message -

invalid command name "load_alignment_matrix"
while executing
"load_alignment_matrix [keylget gap_defs ALIGNMENT.MATRIX_FILE]"
(file "/usr/local/staden-linux-x86_64-1-7-1b/linux-x86_64-bin/../lib/gap/gap.tcl" line 683)

I have followed a number of suggestions from this site & others & installed some missing libraries, but still get this message.
Have done strace -o output.txt gap4 and not sure of any more errors in that file.
I will try to attach the fileoutput.txt

Can anyone help please

phred and pregap4

2008-12-08T19:27:24Z

Hello,
I apologise in advance if this is a stupid question. I couldn't seem to
find this in the staden help documentation.
Where do I install phred so that it can be accessed by the pregap4 phred
module.
Thank you,
Glenn

_______________________________________________
Staden mailing list
Staden@...
http://www.bio.net/biomail/listinfo/staden

invalid command name "open_db"

2008-08-27T10:09:32Z

Hello, staden-linux-1-6-0 here.

It seems that 'open_db' is missing from this release?!

I tried "find $STADENROOT -name open_db" to no avail ... (and yes,
$STADENROOT is set correctly). I was going through $STADENROOT/course/
unix_docs/course_unix.pdf, and I got as far as page 30 (36), when gap4
failed with the error:

- Report from 'Gap4 shotgun assembly' -
ERR: Failed to open database testdb.0.
ERR: "invalid command name "open_db""
ERR: Aborting.
invalid command name "open_db"

*** Processing finished ***

Will someone not float forth with a solution? Or should I go back from
whence I came? *1

GAH! Reading that document these last few days is making me talk
funny!

Googling around makes it look like 'open_db' should be an executable
binary distributed with the Staden package and located under
$STADENROOT/linux-bin/ ... However, in my case its missing... is this
an anomaly, or an issue with this release?

Thanks anyone for any suggestions,

Dan.

----
*1, The humid computer lab.

_______________________________________________
Staden mailing list
Staden@...
http://www.bio.net/biomail/listinfo/staden

permission for publication

2008-07-25T16:45:17Z

Dear Staden developers,

I would like to know if I need any special permission from you you to
publish a screenshot created by your software Trev (trace viewer)?
If yes, please let me know what should I do to get it.

Thank you,
Alla L.Lapidus, Ph.D
DOE_JGI

_______________________________________________
Staden mailing list
Staden@...
http://www.bio.net/biomail/listinfo/staden

UNIX Trev (trace viewer) now freely available

2008-07-24T12:37:13Z

Dear Staden developers,

I am contacting you to find out whether I need to get a special
permission from you to publish screen shots generated by using Trev (in
addition to the reference)?

Thank you,
Alla

--
Alla Lapidus, Ph.D.
Microbial Genomics
DOE Joint Genome Institute
2800 Mitchell Drive, B400
Walnut Creek, CA 94598
Phon: 925-296-5778
Fax: 925-296-5850
Cell: 925-997-4824
E-mail: alapidus@...

_______________________________________________
Staden mailing list
Staden@...
http://www.bio.net/biomail/listinfo/staden

Staden installation issues

2008-01-16T13:53:22Z

Hi,

I am unable to get staden to work. I essentially wish to use gap4. I
downloaded the linux-bin and got stash error when trying gap4. I had
already set the STADENROOT variable and sourced the staden.profile file.

[m049157@crick5 staden-linux-1-5-3]$ ./linux-bin/gap4
./linux-bin/gap4: line 123: exec: stash: not found
[m049157@crick5 staden-linux-1-5-3]$ uname -a
Linux crick5.mayo.edu 2.6.9-55.0.12.ELsmp #1 SMP Fri Nov 2 12:38:56 EDT
2007 x86_64 x86_64 x86_64 GNU/Linux
[m049157@crick5 staden-linux-ia64-1-6-0]$ echo $SHELL
/bin/bash

I even tried the 1.6 version for ia64 with same error:
[m049157@crick5 staden-linux-ia64-1-6-0]$ ./linux-ia64-bin/gap4
./linux-ia64-bin/gap4: line 123: exec: stash: not found

And x86 for ver 1.7
[m049157@crick5 staden-linux-x86-1-7-0]$ ./linux-bin/gap4
./linux-bin/gap4: line 83: exec: stash: not found

Sumit Middha
Bioinformatics Core
Division of Biomedical Informatics
Mayo Clinic: Stabile 11-02-16
Phone: 507-284-4706

_______________________________________________
Staden mailing list
Staden@...
http://www.bio.net/biomail/listinfo/staden

Re: Re: gap4 running problem load_alignment_matrix gap.tcl

2007-12-07T11:39:48Z

These look like the offending lines:

open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libg2c.so.0", O_RDONLY) = -1 ENOENT (No such file or directory)
open("/etc/ld.so.cache", O_RDONLY) = 4
fstat64(0x4, 0xffb476bc) = 0
mmap2(NULL, 183737, PROT_READ, MAP_PRIVATE, 4, 0) = 0xfffffffff778e000
close(4) = 0
open("/lib/i686/libg2c.so.0", O_RDONLY) = -1 ENOENT (No such file or directory)
open("/lib/libg2c.so.0", O_RDONLY) = -1 ENOENT (No such file or directory)
open("/usr/lib/sse2/libg2c.so.0", O_RDONLY) = -1 ENOENT (No such file or directory)
open("/usr/lib/libg2c.so.0", O_RDONLY) = -1 ENOENT (No such file or directory)
munmap(0xf778e000, 183737) = 0
munmap(0xf7841000, 2489824) = 0
munmap(0xf780e000, 208800) = 0
munmap(0xf7803000, 43824) = 0
munmap(0xf77d9000, 169568) = 0
munmap(0xf77bb000, 120136) = 0

It's trying to load libg2c.so.0 and failing...

I'm not particularly familiar with rpm-based distros like Centos ... Debian/Ubuntu/etc have tools to let you search for packages which contain a certain file name - in the case of Debian, the 'libg2c0' package contains libg2c.so.0 - I'm not sure what packages contain this file in Centos.

Perhaps you could try installing the compat-g77 package? (See https://sourceforge.net/forum/forum.php?thread_id=1373652&forum_id=347718)

On Fri, Dec 07, 2007 at 10:52:37AM +0200, Derek Litthauer wrote:

> Hi
> I have installed staden on one of my 64 bit machines with Centos5.
> After some pain, it runs beautifully. Attempting installation on a
> second machine (actually just copying the appropriate dierctory
> containing the staden packege to the new machine) which is (supposed to
> be) similar to the first one I get.
>
> invalid command name "load_alignment_matrix"
> while executing
> "load_alignment_matrix [keylget gap_defs ALIGNMENT.MATRIX_FILE]"
> (file "/usr/local/staden-linux-x86-1-7-0//lib/gap/gap.tcl" line
> 683)
> Running in debug mode some libraries are identified as not loading but
> they are there. Have followed the advice given in various forum pages,
> including http://www.bio.net/bionet/mm/staden/2006-January/001358.html
> doing strace -o output.txt gap4 as suggested, and looking at the
> resulting file does not make sense to me. The file is attached. Can you
> look at it and help, please. DerekLDerek Litthauer (PhD)
> BioPAD Metagenomics Platform
> Department of Microbial, Biochemical and Food Biotechnology
> Faculty of Natural and Agricultural Sciences
> Internal Postbox 61
> University of the Free State
> PO Box 339
> Bloemfontein
> SOUTH AFRICA
> Tel: +27 51 4012122
> Fax: +27 51 4443219
> http://www.uovs.ac.za/biotech
>
>
> _____________________________________________________________________
>
> University of the Free State: This message and its contents are subject to a disclaimer.
> Please refer to http://www.ufs.ac.za/disclaimer for full details.
>
> Universiteit van die Vrystaat:
> Hierdie boodskap en sy inhoud is aan 'n vrywaringsklousule onderhewig.
> Volledige besonderhede is by http://www.ufs.ac.za/vrywaring beskikbaar.
> _____________________________________________________________________

> execve("/usr/local/staden-linux-x86-1-7-0//linux-bin/gap4", ["gap4"], [/* 53 vars */]) = 0
> brk(0) = 0x1935a000
> mmap(NULL, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_ANONYMOUS, -1, 0) = 0x2aaaaaaab000
> uname({sys="Linux", node="mkbpc86", ...}) = 0
> access("/etc/ld.so.preload", R_OK) = -1 ENOENT (No such file or directory)
> open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/tls/x86_64/libtermcap.so.2", O_RDONLY) = -1 ENOENT (No such file or directory)
> stat("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/tls/x86_64", 0x7fffdf82eec0) = -1 ENOENT (No such file or directory)
> open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/tls/libtermcap.so.2", O_RDONLY) = -1 ENOENT (No such file or directory)
> stat("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/tls", 0x7fffdf82eec0) = -1 ENOENT (No such file or directory)
> open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/x86_64/libtermcap.so.2", O_RDONLY) = -1 ENOENT (No such file or directory)
> stat("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/x86_64", 0x7fffdf82eec0) = -1 ENOENT (No such file or directory)
> open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libtermcap.so.2", O_RDONLY) = -1 ENOENT (No such file or directory)
> stat("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries", {st_mode=S_IFDIR|0775, st_size=4096, ...}) = 0
> open("/etc/ld.so.cache", O_RDONLY) = 3
> fstat(3, {st_mode=S_IFREG|0644, st_size=183737, ...}) = 0
> mmap(NULL, 183737, PROT_READ, MAP_PRIVATE, 3, 0) = 0x2aaaaaaac000
> close(3) = 0
> open("/lib64/libtermcap.so.2", O_RDONLY) = 3
> read(3, "\177ELF\2\1\1\0\0\0\0\0\0\0\0\0\3\0>\0\1\0\0\0@\17\340"..., 832) = 832
> fstat(3, {st_mode=S_IFREG|0755, st_size=15584, ...}) = 0
> mmap(NULL, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_ANONYMOUS, -1, 0) = 0x2aaaaaad9000
> mmap(0x35c3e00000, 2108688, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 3, 0) = 0x35c3e00000
> mprotect(0x35c3e03000, 2093056, PROT_NONE) = 0
> mmap(0x35c4002000, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 3, 0x2000) = 0x35c4002000
> close(3) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libdl.so.2", O_RDONLY) = -1 ENOENT (No such file or directory)
> open("/lib64/libdl.so.2", O_RDONLY) = 3
> read(3, "\177ELF\2\1\1\0\0\0\0\0\0\0\0\0\3\0>\0\1\0\0\0 \16\340"..., 832) = 832
> fstat(3, {st_mode=S_IFREG|0755, st_size=23520, ...}) = 0
> mmap(0x35bee00000, 2109728, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 3, 0) = 0x35bee00000
> mprotect(0x35bee02000, 2097152, PROT_NONE) = 0
> mmap(0x35bf002000, 8192, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 3, 0x2000) = 0x35bf002000
> close(3) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libc.so.6", O_RDONLY) = -1 ENOENT (No such file or directory)
> open("/lib64/libc.so.6", O_RDONLY) = 3
> read(3, "\177ELF\2\1\1\0\0\0\0\0\0\0\0\0\3\0>\0\1\0\0\0\240\331"..., 832) = 832
> fstat(3, {st_mode=S_IFREG|0755, st_size=1678480, ...}) = 0
> mmap(0x35be600000, 3461272, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 3, 0) = 0x35be600000
> mprotect(0x35be744000, 2097152, PROT_NONE) = 0
> mmap(0x35be944000, 20480, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 3, 0x144000) = 0x35be944000
> mmap(0x35be949000, 16536, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_ANONYMOUS, -1, 0) = 0x35be949000
> close(3) = 0
> mmap(NULL, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_ANONYMOUS, -1, 0) = 0x2aaaaaada000
> mmap(NULL, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_ANONYMOUS, -1, 0) = 0x2aaaaaadb000
> arch_prctl(ARCH_SET_FS, 0x2aaaaaadadb0) = 0
> mprotect(0x35bf002000, 4096, PROT_READ) = 0
> mprotect(0x35be944000, 16384, PROT_READ) = 0
> mprotect(0x35bd819000, 4096, PROT_READ) = 0
> munmap(0x2aaaaaaac000, 183737) = 0
> rt_sigprocmask(SIG_BLOCK, NULL, [], 8) = 0
> open("/dev/tty", O_RDWR|O_NONBLOCK) = 3
> close(3) = 0
> brk(0) = 0x1935a000
> brk(0x1937b000) = 0x1937b000
> open("/usr/lib/locale/locale-archive", O_RDONLY) = 3
> fstat(3, {st_mode=S_IFREG|0644, st_size=55574016, ...}) = 0
> mmap(NULL, 55574016, PROT_READ, MAP_PRIVATE, 3, 0) = 0x2aaaaaadc000
> close(3) = 0
> getuid() = 500
> getgid() = 500
> geteuid() = 500
> getegid() = 500
> rt_sigprocmask(SIG_BLOCK, NULL, [], 8) = 0
> time(NULL) = 1196950288
> open("/proc/meminfo", O_RDONLY) = 3
> fstat(3, {st_mode=S_IFREG|0444, st_size=0, ...}) = 0
> mmap(NULL, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_ANONYMOUS, -1, 0) = 0x2aaaadfdc000
> read(3, "MemTotal: 1926312 kB\nMemFre"..., 4096) = 682
> close(3) = 0
> munmap(0x2aaaadfdc000, 4096) = 0
> rt_sigaction(SIGCHLD, {SIG_DFL}, {SIG_DFL}, 8) = 0
> rt_sigaction(SIGCHLD, {SIG_DFL}, {SIG_DFL}, 8) = 0
> rt_sigaction(SIGINT, {SIG_DFL}, {SIG_DFL}, 8) = 0
> rt_sigaction(SIGINT, {SIG_DFL}, {SIG_DFL}, 8) = 0
> rt_sigaction(SIGQUIT, {SIG_DFL}, {SIG_DFL}, 8) = 0
> rt_sigaction(SIGQUIT, {SIG_DFL}, {SIG_DFL}, 8) = 0
> rt_sigprocmask(SIG_BLOCK, NULL, [], 8) = 0
> rt_sigaction(SIGQUIT, {SIG_IGN}, {SIG_DFL}, 8) = 0
> uname({sys="Linux", node="mkbpc86", ...}) = 0
> stat("/home/kamini/STADEN", {st_mode=S_IFDIR|0777, st_size=4096, ...}) = 0
> stat(".", {st_mode=S_IFDIR|0777, st_size=4096, ...}) = 0
> getpid() = 3541
> open("/usr/lib64/gconv/gconv-modules.cache", O_RDONLY) = 3
> fstat(3, {st_mode=S_IFREG|0644, st_size=25462, ...}) = 0
> mmap(NULL, 25462, PROT_READ, MAP_SHARED, 3, 0) = 0x2aaaadfdc000
> close(3) = 0
> getppid() = 3540
> getpgrp() = 3540
> rt_sigaction(SIGCHLD, {0x4352d0, [], SA_RESTORER, 0x35be630070}, {SIG_DFL}, 8) = 0
> rt_sigprocmask(SIG_BLOCK, NULL, [], 8) = 0
> open("/usr/local/staden-linux-x86-1-7-0//linux-bin/gap4", O_RDONLY) = 3
> ioctl(3, SNDCTL_TMR_TIMEBASE or TCGETS, 0x7fffdf82f6d0) = -1 ENOTTY (Inappropriate ioctl for device)
> lseek(3, 0, SEEK_CUR) = 0
> read(3, "#!/bin/sh\n\n# Finds the directory"..., 80) = 80
> lseek(3, 0, SEEK_SET) = 0
> getrlimit(RLIMIT_NOFILE, {rlim_cur=1024, rlim_max=1024}) = 0
> dup2(3, 255) = 255
> close(3) = 0
> fcntl(255, F_SETFD, FD_CLOEXEC) = 0
> fcntl(255, F_GETFL) = 0x8000 (flags O_RDONLY|O_LARGEFILE)
> fstat(255, {st_mode=S_IFREG|0755, st_size=1751, ...}) = 0
> lseek(255, 0, SEEK_CUR) = 0
> rt_sigprocmask(SIG_BLOCK, NULL, [], 8) = 0
> read(255, "#!/bin/sh\n\n# Finds the directory"..., 1751) = 1751
> rt_sigprocmask(SIG_BLOCK, NULL, [], 8) = 0
> rt_sigprocmask(SIG_BLOCK, NULL, [], 8) = 0
> rt_sigprocmask(SIG_BLOCK, NULL, [], 8) = 0
> rt_sigprocmask(SIG_BLOCK, NULL, [], 8) = 0
> rt_sigprocmask(SIG_BLOCK, NULL, [], 8) = 0
> rt_sigprocmask(SIG_BLOCK, NULL, [], 8) = 0
> rt_sigprocmask(SIG_BLOCK, NULL, [], 8) = 0
> rt_sigprocmask(SIG_BLOCK, NULL, [], 8) = 0
> rt_sigprocmask(SIG_BLOCK, NULL, [], 8) = 0
> rt_sigprocmask(SIG_SETMASK, [], NULL, 8) = 0
> rt_sigprocmask(SIG_BLOCK, NULL, [], 8) = 0
> rt_sigprocmask(SIG_BLOCK, NULL, [], 8) = 0
> rt_sigprocmask(SIG_BLOCK, NULL, [], 8) = 0
> rt_sigprocmask(SIG_BLOCK, NULL, [], 8) = 0
> rt_sigprocmask(SIG_BLOCK, NULL, [], 8) = 0
> stat(".", {st_mode=S_IFDIR|0777, st_size=4096, ...}) = 0
> stat("/usr/local/staden-linux-x86-1-7-0//linux-bin/stash", {st_mode=S_IFREG|0755, st_size=199395, ...}) = 0
> access("/usr/local/staden-linux-x86-1-7-0//linux-bin/stash", X_OK) = 0
> access("/usr/local/staden-linux-x86-1-7-0//linux-bin/stash", R_OK) = 0
> stat("/usr/local/staden-linux-x86-1-7-0//linux-bin/stash", {st_mode=S_IFREG|0755, st_size=199395, ...}) = 0
> access("/usr/local/staden-linux-x86-1-7-0//linux-bin/stash", X_OK) = 0
> access("/usr/local/staden-linux-x86-1-7-0//linux-bin/stash", R_OK) = 0
> rt_sigaction(SIGINT, {SIG_DFL}, {SIG_DFL}, 8) = 0
> rt_sigaction(SIGQUIT, {SIG_DFL}, {SIG_IGN}, 8) = 0
> rt_sigaction(SIGCHLD, {SIG_DFL}, {0x4352d0, [], SA_RESTORER, 0x35be630070}, 8) = 0
> execve("/usr/local/staden-linux-x86-1-7-0//linux-bin/stash", ["stash", "/usr/local/staden-linux-x86-1-7-"...], [/* 51 vars */]) = 0
> brk(0) = 0x804a000
> mmap2(NULL, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_ANONYMOUS, -1, 0) = 0xfffffffff7ffd000
> access("/etc/ld.so.preload", R_OK) = -1 ENOENT (No such file or directory)
> open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/tls/i686/sse2/libtk_utils.so", O_RDONLY) = -1 ENOENT (No such file or directory)
> stat64(0xffb48da0, 0xffb48e28) = -1 ENOENT (No such file or directory)
> open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/tls/i686/libtk_utils.so", O_RDONLY) = -1 ENOENT (No such file or directory)
> stat64(0xffb48da0, 0xffb48e28) = -1 ENOENT (No such file or directory)
> open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/tls/sse2/libtk_utils.so", O_RDONLY) = -1 ENOENT (No such file or directory)
> stat64(0xffb48da0, 0xffb48e28) = -1 ENOENT (No such file or directory)
> open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/tls/libtk_utils.so", O_RDONLY) = -1 ENOENT (No such file or directory)
> stat64(0xffb48da0, 0xffb48e28) = -1 ENOENT (No such file or directory)
> open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/i686/sse2/libtk_utils.so", O_RDONLY) = -1 ENOENT (No such file or directory)
> stat64(0xffb48da0, 0xffb48e28) = -1 ENOENT (No such file or directory)
> open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/i686/libtk_utils.so", O_RDONLY) = -1 ENOENT (No such file or directory)
> stat64(0xffb48da0, 0xffb48e28) = -1 ENOENT (No such file or directory)
> open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/sse2/libtk_utils.so", O_RDONLY) = -1 ENOENT (No such file or directory)
> stat64(0xffb48da0, 0xffb48e28) = -1 ENOENT (No such file or directory)
> open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libtk_utils.so", O_RDONLY) = 3
> read(3, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0P\243\0"..., 512) = 512
> fstat64(0x3, 0xffb48e18) = 0
> mmap2(NULL, 262008, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 3, 0) = 0xfffffffff7fbd000
> mmap2(0xf7ff4000, 12288, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 3, 0x36) = 0xfffffffff7ff4000
> mmap2(0xf7ff7000, 24440, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_ANONYMOUS, -1, 0) = 0xfffffffff7ff7000
> close(3) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libtk8.4.so", O_RDONLY) = 3
> read(3, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0P]\1\000"..., 512) = 512
> fstat64(0x3, 0xffb48dfc) = 0
> mmap2(NULL, 844948, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 3, 0) = 0xfffffffff7eee000
> mmap2(0xf7fb0000, 49152, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 3, 0xc1) = 0xfffffffff7fb0000
> mmap2(0xf7fbc000, 1172, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_ANONYMOUS, -1, 0) = 0xfffffffff7fbc000
> close(3) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libtcl8.4.so", O_RDONLY) = 3
> read(3, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0\340:\1"..., 512) = 512
> fstat64(0x3, 0xffb48de0) = 0
> mmap2(NULL, 666228, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 3, 0) = 0xfffffffff7e4b000
> mmap2(0xf7ee3000, 40960, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 3, 0x97) = 0xfffffffff7ee3000
> mmap2(0xf7eed000, 2676, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_ANONYMOUS, -1, 0) = 0xfffffffff7eed000
> close(3) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libm.so.6", O_RDONLY) = -1 ENOENT (No such file or directory)
> open("/etc/ld.so.cache", O_RDONLY) = 3
> fstat64(0x3, 0xffb48d60) = 0
> mmap2(NULL, 183737, PROT_READ, MAP_PRIVATE, 3, 0) = 0xfffffffff7e1e000
> close(3) = 0
> open("/lib/libm.so.6", O_RDONLY) = 3
> read(3, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0\20\24\263"..., 512) = 512
> fstat64(0x3, 0xffb48dc4) = 0
> mmap2(0xb2e000, 155776, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 3, 0) = 0xb2e000
> mmap2(0xb53000, 8192, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 3, 0x24) = 0xb53000
> close(3) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libX11.so.6", O_RDONLY) = -1 ENOENT (No such file or directory)
> open("/usr/lib/libX11.so.6", O_RDONLY) = 3
> read(3, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0pO\270\000"..., 512) = 512
> fstat64(0x3, 0xffb48da8) = 0
> mmap2(NULL, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_ANONYMOUS, -1, 0) = 0xfffffffff7e1d000
> mmap2(0xb70000, 1060732, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 3, 0) = 0xb70000
> mmap2(0xc6f000, 16384, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 3, 0xfe) = 0xc6f000
> close(3) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libdl.so.2", O_RDONLY) = -1 ENOENT (No such file or directory)
> open("/lib/libdl.so.2", O_RDONLY) = 3
> read(3, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0PZ\307\000"..., 512) = 512
> fstat64(0x3, 0xffb48d8c) = 0
> mmap2(0xc75000, 12408, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 3, 0) = 0xc75000
> mmap2(0xc77000, 8192, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 3, 0x1) = 0xc77000
> close(3) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libc.so.6", O_RDONLY) = -1 ENOENT (No such file or directory)
> open("/lib/libc.so.6", O_RDONLY) = 3
> read(3, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0000O\240"..., 512) = 512
> fstat64(0x3, 0xffb48d70) = 0
> mmap2(0x9ef000, 1295780, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 3, 0) = 0x9ef000
> mmap2(0xb26000, 12288, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 3, 0x137) = 0xb26000
> mmap2(0xb29000, 9636, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_ANONYMOUS, -1, 0) = 0xb29000
> close(3) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libread.so", O_RDONLY) = 3
> read(3, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0 _\0\000"..., 512) = 512
> fstat64(0x3, 0xffb48cc8) = 0
> mmap2(NULL, 461472, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 3, 0) = 0xfffffffff7dac000
> mmap2(0xf7dda000, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 3, 0x2e) = 0xfffffffff7dda000
> mmap2(0xf7ddb000, 268960, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_ANONYMOUS, -1, 0) = 0xfffffffff7ddb000
> close(3) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libmisc.so", O_RDONLY) = 3
> read(3, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0`\'\0\000"..., 512) = 512
> fstat64(0x3, 0xffb48cac) = 0
> mmap2(NULL, 39940, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 3, 0) = 0xfffffffff7da2000
> mmap2(0xf7da9000, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 3, 0x7) = 0xfffffffff7da9000
> mmap2(0xf7daa000, 7172, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_ANONYMOUS, -1, 0) = 0xfffffffff7daa000
> close(3) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libpng12.so.0", O_RDONLY) = 3
> read(3, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0\220[\0"..., 512) = 512
> fstat64(0x3, 0xffb48c90) = 0
> mmap2(NULL, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_ANONYMOUS, -1, 0) = 0xfffffffff7da1000
> mmap2(NULL, 199188, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 3, 0) = 0xfffffffff7d70000
> mmap2(0xf7da0000, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 3, 0x2f) = 0xfffffffff7da0000
> close(3) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libXau.so.6", O_RDONLY) = -1 ENOENT (No such file or directory)
> open("/usr/lib/libXau.so.6", O_RDONLY) = 3
> read(3, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0Pi\315\000"..., 512) = 512
> fstat64(0x3, 0xffb48a58) = 0
> mmap2(0xcd6000, 10788, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 3, 0) = 0xcd6000
> mmap2(0xcd8000, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 3, 0x1) = 0xcd8000
> close(3) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libXdmcp.so.6", O_RDONLY) = -1 ENOENT (No such file or directory)
> open("/usr/lib/libXdmcp.so.6", O_RDONLY) = 3
> read(3, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0000\276"..., 512) = 512
> fstat64(0x3, 0xffb48a3c) = 0
> mmap2(0xcdb000, 21460, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 3, 0) = 0xcdb000
> mmap2(0xce0000, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 3, 0x4) = 0xce0000
> close(3) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libcurl.so.3", O_RDONLY) = -1 ENOENT (No such file or directory)
> open("/usr/lib/libcurl.so.3", O_RDONLY) = 3
> read(3, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0\300x\0"..., 512) = 512
> fstat64(0x3, 0xffb4887c) = 0
> mmap2(NULL, 245372, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 3, 0) = 0xfffffffff7d34000
> mmap2(0xf7d6f000, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 3, 0x3b) = 0xfffffffff7d6f000
> close(3) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libidn.so.11", O_RDONLY) = -1 ENOENT (No such file or directory)
> open("/usr/lib/libidn.so.11", O_RDONLY) = 3
> read(3, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0\240,\\"..., 512) = 512
> fstat64(0x3, 0xffb48860) = 0
> mmap2(0x5c1000, 199952, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 3, 0) = 0x5c1000
> mmap2(0x5f1000, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 3, 0x2f) = 0x5f1000
> close(3) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libssl.so.0.9.7", O_RDONLY) = -1 ENOENT (No such file or directory)
> open("/lib/tls/i686/sse2/libssl.so.0.9.7", O_RDONLY) = -1 ENOENT (No such file or directory)
> stat64(0xffb487d0, 0xffb48854) = -1 ENOENT (No such file or directory)
> open("/lib/tls/i686/libssl.so.0.9.7", O_RDONLY) = -1 ENOENT (No such file or directory)
> stat64(0xffb487d0, 0xffb48854) = -1 ENOENT (No such file or directory)
> open("/lib/tls/sse2/libssl.so.0.9.7", O_RDONLY) = -1 ENOENT (No such file or directory)
> stat64(0xffb487d0, 0xffb48854) = -1 ENOENT (No such file or directory)
> open("/lib/tls/libssl.so.0.9.7", O_RDONLY) = -1 ENOENT (No such file or directory)
> stat64(0xffb487d0, 0xffb48854) = -1 ENOENT (No such file or directory)
> open("/lib/i686/sse2/libssl.so.0.9.7", O_RDONLY) = -1 ENOENT (No such file or directory)
> stat64(0xffb487d0, 0xffb48854) = -1 ENOENT (No such file or directory)
> open("/lib/i686/libssl.so.0.9.7", O_RDONLY) = -1 ENOENT (No such file or directory)
> stat64(0xffb487d0, 0xffb48854) = 0
> open("/lib/sse2/libssl.so.0.9.7", O_RDONLY) = -1 ENOENT (No such file or directory)
> stat64(0xffb487d0, 0xffb48854) = -1 ENOENT (No such file or directory)
> open("/lib/libssl.so.0.9.7", O_RDONLY) = -1 ENOENT (No such file or directory)
> stat64(0xffb487d0, 0xffb48854) = 0
> open("/usr/lib/tls/i686/sse2/libssl.so.0.9.7", O_RDONLY) = -1 ENOENT (No such file or directory)
> stat64(0xffb487d0, 0xffb48854) = -1 ENOENT (No such file or directory)
> open("/usr/lib/tls/i686/libssl.so.0.9.7", O_RDONLY) = -1 ENOENT (No such file or directory)
> stat64(0xffb487d0, 0xffb48854) = -1 ENOENT (No such file or directory)
> open("/usr/lib/tls/sse2/libssl.so.0.9.7", O_RDONLY) = -1 ENOENT (No such file or directory)
> stat64(0xffb487d0, 0xffb48854) = -1 ENOENT (No such file or directory)
> open("/usr/lib/tls/libssl.so.0.9.7", O_RDONLY) = -1 ENOENT (No such file or directory)
> stat64(0xffb487d0, 0xffb48854) = -1 ENOENT (No such file or directory)
> open("/usr/lib/i686/sse2/libssl.so.0.9.7", O_RDONLY) = -1 ENOENT (No such file or directory)
> stat64(0xffb487d0, 0xffb48854) = -1 ENOENT (No such file or directory)
> open("/usr/lib/i686/libssl.so.0.9.7", O_RDONLY) = -1 ENOENT (No such file or directory)
> stat64(0xffb487d0, 0xffb48854) = -1 ENOENT (No such file or directory)
> open("/usr/lib/sse2/libssl.so.0.9.7", O_RDONLY) = -1 ENOENT (No such file or directory)
> stat64(0xffb487d0, 0xffb48854) = 0
> open("/usr/lib/libssl.so.0.9.7", O_RDONLY) = 3
> read(3, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0\20\262"..., 512) = 512
> fstat64(0x3, 0xffb48844) = 0
> mmap2(NULL, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_ANONYMOUS, -1, 0) = 0xfffffffff7d33000
> mmap2(0x1b0000, 281660, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 3, 0) = 0x1b0000
> mmap2(0x1f1000, 16384, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 3, 0x40) = 0x1f1000
> close(3) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libcrypto.so.0.9.7", O_RDONLY) = -1 ENOENT (No such file or directory)
> open("/lib/i686/libcrypto.so.0.9.7", O_RDONLY) = -1 ENOENT (No such file or directory)
> open("/lib/libcrypto.so.0.9.7", O_RDONLY) = -1 ENOENT (No such file or directory)
> open("/usr/lib/sse2/libcrypto.so.0.9.7", O_RDONLY) = -1 ENOENT (No such file or directory)
> open("/usr/lib/libcrypto.so.0.9.7", O_RDONLY) = 3
> read(3, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0\300\300"..., 512) = 512
> fstat64(0x3, 0xffb48828) = 0
> mmap2(0x734b000, 1250008, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 3, 0) = 0x734b000
> mmap2(0x7467000, 73728, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 3, 0x11c) = 0x7467000
> mmap2(0x7479000, 13016, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_ANONYMOUS, -1, 0) = 0x7479000
> close(3) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libgssapi_krb5.so.2", O_RDONLY) = -1 ENOENT (No such file or directory)
> open("/usr/lib/libgssapi_krb5.so.2", O_RDONLY) = 3
> read(3, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0\360\314"..., 512) = 512
> fstat64(0x3, 0xffb485a0) = 0
> mmap2(0x939000, 175772, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 3, 0) = 0x939000
> mmap2(0x963000, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 3, 0x29) = 0x963000
> close(3) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libkrb5.so.3", O_RDONLY) = -1 ENOENT (No such file or directory)
> open("/usr/lib/libkrb5.so.3", O_RDONLY) = 3
> read(3, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0000j.\007"..., 512) = 512
> fstat64(0x3, 0xffb48584) = 0
> mmap2(0x72d7000, 556612, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 3, 0) = 0xfffffffff7cab000
> mmap2(0xf7d31000, 8192, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 3, 0x86) = 0xfffffffff7d31000
> close(3) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libk5crypto.so.3", O_RDONLY) = -1 ENOENT (No such file or directory)
> open("/usr/lib/libk5crypto.so.3", O_RDONLY) = 3
> read(3, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0\220\225"..., 512) = 512
> fstat64(0x3, 0xffb48568) = 0
> mmap2(0x7186000, 155040, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 3, 0) = 0x7186000
> mmap2(0x71ab000, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 3, 0x25) = 0x71ab000
> close(3) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libcom_err.so.2", O_RDONLY) = -1 ENOENT (No such file or directory)
> open("/lib/libcom_err.so.2", O_RDONLY) = 3
> read(3, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0\360\247"..., 512) = 512
> fstat64(0x3, 0xffb4854c) = 0
> mmap2(NULL, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_ANONYMOUS, -1, 0) = 0xfffffffff7caa000
> mmap2(0xdea000, 9132, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 3, 0) = 0xdea000
> mmap2(0xdec000, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 3, 0x1) = 0xdec000
> close(3) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libresolv.so.2", O_RDONLY) = -1 ENOENT (No such file or directory)
> open("/lib/libresolv.so.2", O_RDONLY) = 3
> read(3, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0\320 \321"..., 512) = 512
> fstat64(0x3, 0xffb48530) = 0
> mmap2(0xd10000, 75976, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 3, 0) = 0xd10000
> mmap2(0xd1f000, 8192, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 3, 0xe) = 0xd1f000
> mmap2(0xd21000, 6344, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_ANONYMOUS, -1, 0) = 0xd21000
> close(3) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libz.so.1", O_RDONLY) = -1 ENOENT (No such file or directory)
> open("/usr/lib/libz.so.1", O_RDONLY) = 3
> read(3, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0\300E\316"..., 512) = 512
> fstat64(0x3, 0xffb48514) = 0
> mmap2(0xce3000, 76400, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 3, 0) = 0xce3000
> mmap2(0xcf5000, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 3, 0x11) = 0xcf5000
> close(3) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libkrb5support.so.0", O_RDONLY) = -1 ENOENT (No such file or directory)
> open("/usr/lib/libkrb5support.so.0", O_RDONLY) = 3
> read(3, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0000\364"..., 512) = 512
> fstat64(0x3, 0xffb482d8) = 0
> mmap2(0x753e000, 31848, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 3, 0) = 0x753e000
> mmap2(0x7545000, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 3, 0x6) = 0x7545000
> close(3) = 0
> mmap2(NULL, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_ANONYMOUS, -1, 0) = 0xfffffffff7ca9000
> mmap2(NULL, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_ANONYMOUS, -1, 0) = 0xfffffffff7ca8000
> set_thread_area(0xffb49300) = 0
> mprotect(0xd1f000, 4096, PROT_READ) = 0
> mprotect(0xf7dac000, 188416, PROT_READ|PROT_WRITE) = 0
> mprotect(0xf7dac000, 188416, PROT_READ|PROT_EXEC) = 0
> mprotect(0xb26000, 8192, PROT_READ) = 0
> mprotect(0xc77000, 4096, PROT_READ) = 0
> mprotect(0xb53000, 4096, PROT_READ) = 0
> mprotect(0x9eb000, 4096, PROT_READ) = 0
> munmap(0xf7e1e000, 183737) = 0
> _llseek(0, 0, 0xffb49310, SEEK_CUR) = -1 ESPIPE (Illegal seek)
> _llseek(1, 0, 0xffb49310, SEEK_CUR) = -1 ESPIPE (Illegal seek)
> _llseek(2, 0, 0xffb49310, SEEK_CUR) = -1 ESPIPE (Illegal seek)
> rt_sigaction(SIGPIPE, {0x1000000000000001, [], SA_RESTORER|SA_STACK|SA_RESTART|SA_INTERRUPT|SA_NOMASK|SA_ONESHOT|SA_SIGINFO|0x3b491a8, (nil)}, {SIG_DFL}, 8) = 0
> brk(0) = 0x804a000
> brk(0x806b000) = 0x806b000
> access("/usr/local/staden-linux-x86-1-7-0//linux-bin/stash", X_OK) = 0
> stat64(0xffb4921c, 0xffb492f0) = 0
> open("/usr/lib/locale/locale-archive", O_RDONLY|O_LARGEFILE) = 3
> fstat64(0x3, 0xb28aa0) = 0
> mmap2(NULL, 2097152, PROT_READ, MAP_PRIVATE, 3, 0) = 0xfffffffff7aa8000
> close(3) = 0
> lstat64(0xffb47be0, 0xffb4797c) = 0
> lstat64(0xffb47be0, 0xffb4797c) = 0
> lstat64(0xffb47be0, 0xffb4797c) = 0
> lstat64(0xffb47be0, 0xffb4797c) = 0
> lstat64(0xffb47be0, 0xffb4797c) = 0
> lstat64(0xffb47be0, 0xffb4797c) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/tcl/encoding/iso8859-1.enc", O_RDONLY|O_LARGEFILE) = 3
> fcntl64(3, F_SETFD, FD_CLOEXEC) = 0
> ioctl(3, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb48bb8) = -1 ENOTTY (Inappropriate ioctl for device)
> read(3, "# Encoding file: iso8859-1, sing"..., 4096) = 1094
> read(3, "", 4096) = 0
> close(3) = 0
> uname({sys="Linux", node="mkbpc86", ...}) = 0
> ioctl(0, SNDCTL_TMR_TIMEBASE or TCGETS, {B38400 opost isig icanon echo ...}) = 0
> lstat64(0xffb47660, 0xffb473fc) = 0
> lstat64(0xffb47660, 0xffb473fc) = 0
> lstat64(0xffb47660, 0xffb473fc) = 0
> lstat64(0xffb47660, 0xffb473fc) = 0
> lstat64(0xffb47660, 0xffb473fc) = 0
> access("/usr/local/staden-linux-x86-1-7-0/lib/tcl/init.tcl", F_OK) = 0
> stat64(0x80552a0, 0xffb489d0) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/tcl/init.tcl", O_RDONLY|O_LARGEFILE) = 3
> fcntl64(3, F_SETFD, FD_CLOEXEC) = 0
> ioctl(3, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb48778) = -1 ENOTTY (Inappropriate ioctl for device)
> read(3, "# init.tcl --\n#\n# Default system"..., 4096) = 4096
> read(3, "nts onto the end and evaluate it"..., 4096) = 4096
> read(3, "} {\n\t\tset errorCode $savedErrorC"..., 4096) = 4096
> read(3, "ex file, version 2.0\"]} {\n\t\t "..., 4096) = 4096
> read(3, "he Path or PATH environment vari"..., 4096) = 4096
> read(3, "dest\\\": file already exists\"\n\t} "..., 4096) = 1617
> read(3, "", 4096) = 0
> close(3) = 0
> lstat64(0xffb48300, 0xffb4809c) = 0
> lstat64(0xffb48300, 0xffb4809c) = 0
> lstat64(0xffb48300, 0xffb4809c) = 0
> lstat64(0xffb48300, 0xffb4809c) = 0
> lstat64(0xffb48300, 0xffb4809c) = 0
> stat64(0x80551a8, 0xffb494f0) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/gap/gap.tcl", O_RDONLY|O_LARGEFILE) = 3
> fcntl64(3, F_SETFD, FD_CLOEXEC) = 0
> ioctl(3, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb49298) = -1 ENOTTY (Inappropriate ioctl for device)
> read(3, "#\n# Copyright (c) Medical Resear"..., 4096) = 4096
> read(3, "g %15.2f\\"..., 4096) = 4096
> read(3, "]\n}\n############################"..., 4096) = 4096
> read(3, "o\n }\n}\n######################"..., 4096) = 4096
> read(3, "\n v \t\t{append GAP_VERSION \" ("..., 4096) = 4096
> read(3, "reateMain\n\n#display contig selec"..., 4096) = 1292
> read(3, "", 4096) = 0
> close(3) = 0
> uname({sys="Linux", node="mkbpc86", ...}) = 0
> socket(PF_FILE, SOCK_STREAM, 0) = 3
> uname({sys="Linux", node="mkbpc86", ...}) = 0
> uname({sys="Linux", node="mkbpc86", ...}) = 0
> connect(3, {sa_family=AF_FILE, path="/tmp/.X11-unix/X0"}, 19) = 0
> uname({sys="Linux", node="mkbpc86", ...}) = 0
> fcntl64(3, F_SETFD, FD_CLOEXEC) = 0
> access("/tmp/.gdmSU412T", R_OK) = 0
> open("/tmp/.gdmSU412T", O_RDONLY) = 4
> fstat64(0x4, 0xffb4779c) = 0
> mmap2(NULL, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_ANONYMOUS, -1, 0) = 0xfffffffff7e4a000
> read(4, "\1\0\0\7mkbpc86\0\0010\0\22MIT-MAGIC-COOKIE"..., 4096) = 118
> read(4, "", 4096) = 0
> close(4) = 0
> munmap(0xf7e4a000, 4096) = 0
> writev(3, [{"l\0\v\0\0\0\22\0\20\0\0\0", 12}, {"MIT-MAGIC-COOKIE-1", 18}, {"\0\0", 2}, {"\370\277\252\212\236\364\216\334\3207\210x\241N\362\265"..., 16}], 4) = 48
> fcntl64(3, F_GETFL) = 0x2 (flags O_RDWR)
> fcntl64(3, F_SETFL, O_RDWR|O_NONBLOCK) = 0
> read(3, "\1\0\v\0\0\0Q\0", 8) = 8
> read(3, "\10\250-\4\0\0\0\3\377\377\37\0\0\1\0\0\24\0\377\377\1"..., 324) = 324
> write(3, "7\0\5\0\0\0\0\3?\0\0\0\10\0\0\0\377\377\377\0b\0\5\0\f"..., 64) = 64
> read(3, "\1e\2\0\0\0\0\0\1\202\0\0\0\0\0\0\0\0\0\0\0\0\0\0l>\0\0"..., 32) = 32
> read(3, "\1\10\3\0\241\6\0\0\37\0\0\0\0\0\0\0\204\32\0\0\0\0\0\0"..., 32) = 32
> readv(3, [{"*Box.background:\t#ede9e3\n*Box.fo"..., 6788}, {"", 0}], 2) = 6788
> write(3, "\202\0\1\0", 4) = 4
> read(3, "\1e\4\0\0\0\0\0\377\377?\0\0\0\0\0\0\0\0\0\0\0\0\0l>\0"..., 32) = 32
> writev(3, [{"b\0\5\0\t\0\0\3", 8}, {"XKEYBOARD", 9}, {"\0\0\0", 3}], 3) = 20
> read(3, "\1e\5\0\0\0\0\0\1\224n\256\0\0\0\0\0\0\0\0\0\0\0\0l>\0"..., 32) = 32
> write(3, "\224\0\2\0\1\0\0\0", 8) = 8
> read(3, "\1\1\6\0\0\0\0\0\1\0\0\0\0\0\0\0\360e\356\261\377\177\0"..., 32) = 32
> brk(0x808d000) = 0x808d000
> open("/usr/share/X11/locale/locale.alias", O_RDONLY) = 4
> fstat64(0x4, 0xffb43558) = 0
> mmap2(NULL, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_ANONYMOUS, -1, 0) = 0xfffffffff7e4a000
> read(4, "#\t$XdotOrg: lib/X11/nls/locale.a"..., 4096) = 4096
> read(4, "br_FR.iso88591\t\t\t\t\tbr_FR.ISO8859"..., 4096) = 4096
> read(4, "iso88597\t\t\t\t\tel_GR.ISO8859-7\nel_"..., 4096) = 4096
> read(4, "1.en\t\t\t\t\tes_ES.ISO8859-1\nes_ES.i"..., 4096) = 4096
> read(4, "\nfr_CA.iso88591\t\t\t\t\tfr_CA.ISO885"..., 4096) = 4096
> read(4, "5\t\t\t\tit_CH.ISO8859-15\nit_CH.utf8"..., 4096) = 4096
> read(4, "\tnl_BE.ISO8859-1\nnl_BE.88591\t\t\t\t"..., 4096) = 4096
> read(4, "RW.ISO8859-1\nrw_RW.iso8859-1 "..., 4096) = 4096
> read(4, "\ntn_ZA.utf8\t\t\t\ttn_ZA.UTF-8\ntr\t\t\t"..., 4096) = 4096
> read(4, "\t\tfr_CH.ISO8859-1\ngalego\t\t\t\t\t\tgl"..., 4096) = 4096
> read(4, "r_OM:\t\t\t\t\t\tar_OM.ISO8859-6\nar_OM"..., 4096) = 4096
> read(4, "59-15\nde_AT.UTF-8@euro:\t\t\t\tde_AT"..., 4096) = 4096
> read(4, "n_US.ISO8859-15@euro:\t\t\t\ten_US.I"..., 4096) = 4096
> read(4, "onian local standards, ISO8859-4"..., 4096) = 4096
> read(4, "59-14:\t\t\t\tgd_GB.ISO8859-14\ngd_GB"..., 4096) = 4096
> read(4, "R\nko_KR:\t\t\t\t\t\tko_KR.eucKR\nKO_KR:"..., 4096) = 4096
> read(4, ".iso885915:\t\t\t\tny_NO.ISO8859-15\n"..., 4096) = 4096
> read(4, ".ISO-8859-2:\t\t\t\tsr_CS.ISO8859-2\n"..., 4096) = 4096
> read(4, "8\nVI_VN.UTF-8:\t\t\t\t\tvi_VN.UTF-8\nw"..., 4096) = 4096
> read(4, "is and SunOS have iso_8859_1 and"..., 4096) = 298
> read(4, "", 4096) = 0
> close(4) = 0
> munmap(0xf7e4a000, 4096) = 0
> open("/usr/share/X11/locale/locale.alias", O_RDONLY) = 4
> fstat64(0x4, 0xffb43558) = 0
> mmap2(NULL, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_ANONYMOUS, -1, 0) = 0xfffffffff7e4a000
> read(4, "#\t$XdotOrg: lib/X11/nls/locale.a"..., 4096) = 4096
> read(4, "br_FR.iso88591\t\t\t\t\tbr_FR.ISO8859"..., 4096) = 4096
> read(4, "iso88597\t\t\t\t\tel_GR.ISO8859-7\nel_"..., 4096) = 4096
> read(4, "1.en\t\t\t\t\tes_ES.ISO8859-1\nes_ES.i"..., 4096) = 4096
> read(4, "\nfr_CA.iso88591\t\t\t\t\tfr_CA.ISO885"..., 4096) = 4096
> read(4, "5\t\t\t\tit_CH.ISO8859-15\nit_CH.utf8"..., 4096) = 4096
> read(4, "\tnl_BE.ISO8859-1\nnl_BE.88591\t\t\t\t"..., 4096) = 4096
> read(4, "RW.ISO8859-1\nrw_RW.iso8859-1 "..., 4096) = 4096
> read(4, "\ntn_ZA.utf8\t\t\t\ttn_ZA.UTF-8\ntr\t\t\t"..., 4096) = 4096
> read(4, "\t\tfr_CH.ISO8859-1\ngalego\t\t\t\t\t\tgl"..., 4096) = 4096
> read(4, "r_OM:\t\t\t\t\t\tar_OM.ISO8859-6\nar_OM"..., 4096) = 4096
> read(4, "59-15\nde_AT.UTF-8@euro:\t\t\t\tde_AT"..., 4096) = 4096
> read(4, "n_US.ISO8859-15@euro:\t\t\t\ten_US.I"..., 4096) = 4096
> close(4) = 0
> munmap(0xf7e4a000, 4096) = 0
> open("/usr/share/X11/locale/locale.dir", O_RDONLY) = 4
> fstat64(0x4, 0xffb43ad8) = 0
> mmap2(NULL, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_ANONYMOUS, -1, 0) = 0xfffffffff7e4a000
> read(4, "#\t$XdotOrg: lib/X11/nls/locale.d"..., 4096) = 4096
> read(4, "so8859-1/XLC_LOCALE\t\t\tes_US.ISO8"..., 4096) = 4096
> read(4, "CALE\t\t\tsr_CS.ISO8859-5\niso8859-2"..., 4096) = 4096
> read(4, "UTF-8/XLC_LOCALE\t\t\tes_MX.UTF-8\ne"..., 4096) = 4096
> read(4, ",v 1.3 2000/08/17 19:46:48 cpqbl"..., 4096) = 4096
> read(4, "9-1/XLC_LOCALE:\t\t\tes_US.ISO8859-"..., 4096) = 4096
> read(4, "\niso8859-2/XLC_LOCALE: \t\t\tsq_AL."..., 4096) = 4096
> close(4) = 0
> munmap(0xf7e4a000, 4096) = 0
> access("/usr/share/X11/locale/en_US.UTF-8/XLC_LOCALE", R_OK) = 0
> open("/usr/share/X11/locale/en_US.UTF-8/XLC_LOCALE", O_RDONLY) = 4
> fstat64(0x4, 0xffb44f78) = 0
> mmap2(NULL, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_ANONYMOUS, -1, 0) = 0xfffffffff7e4a000
> read(4, "# $XFree86: xc/nls/XLC_LOCALE/e"..., 4096) = 2036
> read(4, "", 4096) = 0
> close(4) = 0
> munmap(0xf7e4a000, 4096) = 0
> geteuid32() = 500
> getegid32() = 500
> open("/home/kamini/.XCompose", O_RDONLY) = -1 ENOENT (No such file or directory)
> open("/usr/share/X11/locale/compose.dir", O_RDONLY) = 4
> fstat64(0x4, 0xffb46798) = 0
> mmap2(NULL, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_ANONYMOUS, -1, 0) = 0xfffffffff7e4a000
> read(4, "# $Xorg: compose.dir,v 1.3 2000/"..., 4096) = 4096
> read(4, "859-14\niso8859-15/Compose\t\tgd_GB"..., 4096) = 4096
> read(4, ".Big5\nzh_TW/Compose\t\t\tzh_TW.eucT"..., 4096) = 4096
> read(4, "F-8\nen_US.UTF-8/Compose\t\trw_RW.U"..., 4096) = 4096
> read(4, "\niso8859-1/Compose:\t\tes_PY.ISO88"..., 4096) = 4096
> read(4, "o8859-5/Compose:\t\tsr_CS.ISO8859-"..., 4096) = 4096
> close(4) = 0
> munmap(0xf7e4a000, 4096) = 0
> access("/usr/share/X11/locale/en_US.UTF-8/Compose", R_OK) = 0
> getuid32() = 500
> getgid32() = 500
> stat64(0x8071520, 0xffb47c20) = 0
> stat64(0xc59780, 0xffb47c20) = -1 ENOENT (No such file or directory)
> getuid32() = 500
> getgid32() = 500
> stat64(0x8071520, 0xffb47c20) = 0
> stat64(0x8071550, 0xffb47c20) = -1 ENOENT (No such file or directory)
> open("/usr/share/X11/locale/en_US.UTF-8/Compose", O_RDONLY) = 4
> fstat64(0x4, 0xffb45840) = 0
> mmap2(NULL, 565248, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_ANONYMOUS, -1, 0) = 0xfffffffff7a1e000
> fstat64(0x4, 0xffb45770) = 0
> mmap2(NULL, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_ANONYMOUS, -1, 0) = 0xfffffffff7a1d000
> read(4, "# UTF-8 (Unicode) compose sequen"..., 4096) = 4096
> open("/usr/share/X11/XKeysymDB", O_RDONLY) = 5
> fstat64(0x5, 0xffb456e0) = 0
> read(5, "! $Xorg: XKeysymDB,v 1.3 2000/08"..., 8298) = 8298
> close(5) = 0
> read(4, "sciitilde # TILDE\n<Multi_key> <s"..., 4096) = 4096
> read(4, " \t: \"\342\202\245\" U20a5 # MILL SIGN\n<"..., 4096) = 4096
> read(4, " RIEUL-MIEUM-KIYEOK\n<Multi_key> "..., 4096) = 4096
> read(4, " <U10001100> \t: \"\341\205\201\" U1141 # "..., 4096) = 4096
> read(4, "NGUL JUNGSEONG YU-A\n<Multi_key> "..., 4096) = 4096
> read(4, "d # HANGUL JONGSEONG MIEUM-SIOS\n"..., 4096) = 4096
> read(4, "i_key> <U10001107> <U10001132> \t"..., 4096) = 4096
> read(4, "> <A> \t: \"\303\201\" U00C1 #"..., 4096) = 4096
> read(4, "ITAL LETTER O WITH CIRCUMFLEX\n<M"..., 4096) = 4096
> read(4, " WITH ACUTE\n<Multi_key> <apostro"..., 4096) = 4096
> read(4, "AERESIS\n<Multi_key> <quotedbl> <"..., 4096) = 4096
> read(4, "slash> <D> \t: \"\304\220\" U0"..., 4096) = 4096
> read(4, "RCUMFLEX\n<dead_circumflex> <h> "..., 4096) = 4096
> read(4, "cute> <l> \t: \"\304\272\" U"..., 4096) = 4096
> read(4, " U0154 # LATIN CAPITAL LETTER "..., 4096) = 4096
> read(4, " CAPITAL LETTER U WITH TILDE\n<co"..., 4096) = 4096
> read(4, "ey> <period> <Z> \t: \"\305\273\""..., 4096) = 4096
> read(4, " DIAERESIS AND MACRON\n<Multi_key"..., 4096) = 4096
> read(4, "CAPITAL LETTER U WITH DIAERESIS "..., 4096) = 4096
> read(4, "LL LETTER A WITH DIAERESIS AND M"..., 4096) = 4096
> read(4, "<U100001EA> \t: \"\307\254\" U01EC # LA"..., 4096) = 4096
> read(4, "y> <apostrophe> <dead_abovering>"..., 4096) = 4096
> read(4, "apostrophe> <slash> <o> \t: \"\307\277\" "..., 4096) = 4096
> read(4, "L LETTER E WITH CEDILLA\n<dead_ce"..., 4096) = 4096
> read(4, " <asciitilde> <o> \t: \"\310\255\" U022"..., 4096) = 4096
> read(4, "mflex> <Multi_key> <underbar> <U"..., 4096) = 4096
> read(4, "IFIER LETTER SMALL X\n<dead_circu"..., 4096) = 4096
> read(4, "ETTER IOTA WITH DIALYTIKA AND TO"..., 4096) = 4096
> read(4, " U03B0 # GREEK SMALL LETTER UPS"..., 4096) = 4096
> read(4, " \t: \"\320\271\" U0439 # CYRILLIC SMA"..., 4096) = 4096
> read(4, "lic_a> \t: \"\323\221\" U04D1 # CYR"..., 4096) = 4096
> read(4, "U04ED # CYRILLIC SMALL LETTER E "..., 4096) = 4096
> read(4, "0009BC> <U100009AF> \t: \"\340\247\237\" U"..., 4096) = 4096
> read(4, " \t: \"\341\270\202\" U1E02 # LATIN C"..., 4096) = 4096
> read(4, "d> \t: \"\341\270\215\" U1E0D"..., 4096) = 4096
> read(4, "on> <E> \t: \"\341\270\226\" U1E16 # LATIN"..., 4096) = 4096
> brk(0x80be000) = 0x80be000
> read(4, "1E1D # LATIN SMALL LETTER E WITH"..., 4096) = 4096
> read(4, "ti_key> <apostrophe> <dead_diaer"..., 4096) = 4096
> read(4, " AND MACRON\n<dead_macron> <Multi"..., 4096) = 4096
> read(4, "_abovedot> <N> \t: \""..., 4096) = 4096
> read(4, " \t: \"\341\271\215\" U1E4D # LATIN SMAL"..., 4096) = 4096
> read(4, "TIN SMALL LETTER O WITH MACRON A"..., 4096) = 4096
> read(4, "key> <apostrophe> <p> \t: \"\341\271"..., 4096) = 4096
> read(4, "LATIN SMALL LETTER R WITH LINE B"..., 4096) = 4096
> read(4, "BOVE\n<Multi_key> <period> <c> <s"..., 4096) = 4096
> read(4, " U1E78 # LATIN CAPITAL LETTER U "..., 4096) = 4096
> read(4, "IN SMALL LETTER U WITH MACRON AN"..., 4096) = 4096
> read(4, " DOT ABOVE\n<Multi_key> <period> "..., 4096) = 4096
> read(4, "ircumflex> <A> \t: \"\341\272\244\" U1EA4 "..., 4096) = 4096
> read(4, "R A WITH CIRCUMFLEX AND GRAVE\n<d"..., 4096) = 4096
> read(4, "0> \t: \"\341\272\254\" U1EAC # LATIN CAPI"..., 4096) = 4096
> read(4, "i_key> <acute> <U> <a> \t: \""..., 4096) = 4096
> read(4, "ning_hook> <dead_breve> <A> \t: \""..., 4096) = 4096
> read(4, "TAL LETTER A WITH BREVE AND DOT "..., 4096) = 4096
> read(4, ": \"\341\272\276\" U1EBE # LATIN CAPITAL "..., 4096) = 4096
> read(4, "AVE\n<combining_grave> <dead_circ"..., 4096) = 4096
> read(4, "1EC5 # LATIN SMALL LETTER E WITH"..., 4096) = 4096
> read(4, "TTER O WITH HOOK ABOVE\n<combinin"..., 4096) = 4096
> read(4, "# LATIN SMALL LETTER O WITH CIRC"..., 4096) = 4096
> read(4, " <ocircumflex> \t: \"\341\273\227\" U1ED7"..., 4096) = 4096
> read(4, "MALL LETTER O WITH HORN AND ACUT"..., 4096) = 4096
> read(4, "ER O WITH HORN AND HOOK ABOVE\n<M"..., 4096) = 4096
> read(4, "o> \t: \"\341\273\243\" U1EE3 # LATIN SMA"..., 4096) = 4096
> read(4, " CAPITAL LETTER U WITH HORN AND "..., 4096) = 4096
> read(4, " U1EEE # LATIN CAPITAL LETTER "..., 4096) = 4096
> read(4, "ALL LETTER Y WITH GRAVE\n<dead_be"..., 4096) = 4096
> read(4, "XIA\n<Multi_key> <apostrophe> <U1"..., 4096) = 4096
> read(4, "<parenleft> <Greek_alpha> \t: \"\341\274"..., 4096) = 4096
> read(4, "A\n<Multi_key> <acute> <U10001F09"..., 4096) = 4096
> read(4, "VARIA\n<Multi_key> <grave> <U1000"..., 4096) = 4096
> read(4, "IA AND OXIA\n<combining_acute> <M"..., 4096) = 4096
> read(4, "IA AND OXIA\n<Multi_key> <apostro"..., 4096) = 4096
> read(4, "OXIA\n<Multi_key> <apostrophe> <U"..., 4096) = 4096
> read(4, "F29 # GREEK CAPITAL LETTER ETA W"..., 4096) = 4096
> read(4, "enleft> <Greek_ETA> \t: \"\341\274\255\" U"..., 4096) = 4096
> read(4, "U1F33 # GREEK SMALL LETTER IOTA "..., 4096) = 4096
> read(4, "EK SMALL LETTER IOTA WITH PSILI "..., 4096) = 4096
> read(4, "IA\n<Multi_key> <apostrophe> <U10"..., 4096) = 4096
> read(4, "10000314> <Greek_omicron> \t"..., 4096) = 4096
> read(4, " U1F45 # GREEK SMALL LETTER OMI"..., 4096) = 4096
> read(4, "MICRON> \t: \"\341\275\214\" U1F4C # GREEK"..., 4096) = 4096
> read(4, "K SMALL LETTER UPSILON WITH DASI"..., 4096) = 4096
> read(4, "0000314> <Greek_upsilon> \t: \"\341\275\227"..., 4096) = 4096
> read(4, "> <asciitilde> <U10000314> <Gree"..., 4096) = 4096
> read(4, "L LETTER OMEGA WITH DASIA AND OX"..., 4096) = 4096
> read(4, "A\n<combining_grave> <U10001F68> "..., 4096) = 4096
> read(4, " U1F6E # GREEK CAPITAL LETTER "..., 4096) = 4096
> read(4, "ER ALPHA WITH PSILI AND YPOGEGRA"..., 4096) = 4096
> read(4, "d_iota> <dead_grave> <U10001F01>"..., 4096) = 4096
> read(4, "e> <U10000313> <Greek_alpha> \t: "..., 4096) = 4096
> read(4, " OXIA AND YPOGEGRAMMENI\n<Multi_k"..., 4096) = 4096
> read(4, "L LETTER ALPHA WITH PSILI AND PE"..., 4096) = 4096
> read(4, "H DASIA AND PROSGEGRAMMENI\n<dead"..., 4096) = 4096
> read(4, "D PROSGEGRAMMENI\n<dead_iota> <de"..., 4096) = 4096
> read(4, " PROSGEGRAMMENI\n<Multi_key> <Gre"..., 4096) = 4096
> read(4, "MENI\n<Multi_key> <Greek_iota> <a"..., 4096) = 4096
> read(4, "10001F0F> \t: \"\341\276\217\" U1F8F # GRE"..., 4096) = 4096
> read(4, " DASIA AND YPOGEGRAMMENI\n<dead_i"..., 4096) = 4096
> read(4, "ASIA AND VARIA AND YPOGEGRAMMENI"..., 4096) = 4096
> read(4, "mbining_acute> <U10001F20> \t: \"\341"..., 4096) = 4096
> read(4, "U1F95 # GREEK SMALL LETTER ETA W"..., 4096) = 4096
> read(4, "> \t: \"\341\276\227\" U1F97 # GREEK SMALL"..., 4096) = 4096
> read(4, "ND VARIA AND PROSGEGRAMMENI\n<dea"..., 4096) = 4096
> read(4, "ek_ETA> \t: \"\341\276\233\" U1F9B # GREEK"..., 4096) = 4096
> read(4, "1F9D # GREEK CAPITAL LETTER ETA "..., 4096) = 4096
> read(4, "10001F28> \t: \"\341\276\236\" U1F9E # GRE"..., 4096) = 4096
> read(4, " PERISPOMENI AND PROSGEGRAMMENI\n"..., 4096) = 4096
> read(4, "ing_grave> <U10001F60> \t: \"\341\276\242\" "..., 4096) = 4096
> read(4, " <U10001F60> \t: \"\341\276\244\" U1FA4 # "..., 4096) = 4096
> read(4, " <Greek_omega> \t: \"\341\276\245\" U1FA5 "..., 4096) = 4096
> read(4, "GREEK SMALL LETTER OMEGA WITH PS"..., 4096) = 4096
> read(4, "R OMEGA WITH DASIA AND PERISPOME"..., 4096) = 4096
> read(4, "A WITH PSILI AND VARIA AND PROSG"..., 4096) = 4096
> read(4, "EEK CAPITAL LETTER OMEGA WITH PS"..., 4096) = 4096
> read(4, "L LETTER OMEGA WITH DASIA AND OX"..., 4096) = 4096
> read(4, "y> <Greek_iota> <U10000342> <U10"..., 4096) = 4096
> read(4, "A WITH VRACHY\n<dead_macron> <Gre"..., 4096) = 4096
> read(4, " \t: \"\341\276\270\" U1FB8 # GREEK CAP"..., 4096) = 4096
> read(4, "de> <Greek_eta> \t: \"\341\277\207\" U1FC7"..., 4096) = 4096
> read(4, "resis> \t: \"\341\277\227\" U1FD7 # GREEK "..., 4096) = 4096
> read(4, " GREEK SMALL LETTER RHO WITH PSI"..., 4096) = 4096
> read(4, "LETTER OMEGA WITH YPOGEGRAMMENI\n"..., 4096) = 4096
> read(4, "SUPERSCRIPT FOUR\n<Multi_key> <as"..., 4096) = 4096
> read(4, "rbar> <KP_3> \t: \"\342\202\203\" U2083"..., 4096) = 4096
> read(4, "Y NOR ACTUALLY EQUAL TO\n<Multi_k"..., 4096) = 4096
> read(4, "LED DIGIT EIGHT\n<Multi_key> <par"..., 4096) = 4096
> read(4, " \"\342\221\263\" U2473 # CIRCLED NUMBER "..., 4096) = 4096
> read(4, "MALL LETTER N\n<Multi_key> <paren"..., 4096) = 4096
> read(4, "ER DI\n<dead_voiced_sound> <kana_"..., 4096) = 4096
> read(4, "CIRCLED NUMBER TWENTY ONE\n<Multi"..., 4096) = 4096
> read(4, "> <parenright> \t: \"\343\211\230\" U3258 "..., 4096) = 4096
> read(4, "i_key> <parenleft> <U10001109> <"..., 4096) = 4096
> read(4, "renleft> <U10007279> <parenright"..., 4096) = 4096
> read(4, "MBER THIRTY NINE\n<Multi_key> <pa"..., 4096) = 4096
> brk(0x80e0000) = 0x80e0000
> read(4, " <parenleft> <KP_5> <0> <parenri"..., 4096) = 4096
> read(4, "FD # CIRCLED KATAKANA WE\n<Multi_"..., 4096) = 4096
> read(4, "> \t: \"\357\255\215\" UFB4D # HEBREW LETT"..., 4096) = 2146
> read(4, "", 4096) = 0
> munmap(0xf7a1e000, 565248) = 0
> close(4) = 0
> munmap(0xf7a1d000, 4096) = 0
> write(3, "\1\30\r\0\1\0\0\3?\0\0\0\0\0\0\0\1\0\1\0\0\0\1\0\"\0\0"..., 64) = 64
> read(3, "\1e\10\0\0\0\0\0\200\1\0\0\0\0\0\0\0\0\0\0\0\0\0\0\200"..., 32) = 32
> write(3, "\20\0\6\0\16\0\0\3InterpRegistry\1\0", 24) = 24
> read(3, "\1e\t\0\0\0\0\0\201\1\0\0\0\0\0\0\0\0\0\0\0\0\0\0\200>"..., 32) = 32
> write(3, "\20\0\6\0\16\0\0\3TK_APPLICATION\1\0", 24) = 24
> read(3, "\1e\n\0\0\0\0\0\202\1\0\0\0\0\0\0\0\0\0\0\0\0\0\0\200>"..., 32) = 32
> write(3, "$\0\1\0\24\0\6\0?\0\0\0\201\1\0\0\37\0\0\0\0\0\0\0\240"..., 28) = 28
> read(3, "\1\0\f\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0"..., 32) = 32
> write(3, "\22\0\n\0?\0\0\0\201\1\0\0\37\0\0\0\10\0\0\0\20\0\0\000"..., 44) = 44
> uname({sys="Linux", node="mkbpc86", ...}) = 0
> write(3, "\22\0\10\0\1\0\0\3\202\1\0\0\37\0\0\0\10\0\0\0\7\0\0\0"..., 56) = 56
> read(3, "\34\0\17\0\1\0\0\3\202\1\0\0\304\370\313\257\0\0\0\0\0"..., 32) = 32
> read(3, "\1\10\20\0\241\6\0\0\37\0\0\0\0\0\0\0\204\32\0\0\0\0\0"..., 32) = 32
> readv(3, [{"*Box.background:\t#ede9e3\n*Box.fo"..., 6788}, {"", 0}], 2) = 6788
> write(3, "T\0\4\0 \0\0\0\0\355\0\351\0\343\0\0", 16) = 16
> read(3, "\1\0\21\0\0\0\0\0\355\355\351\351\343\343\0\0\343\351\355"..., 32) = 32
> write(3, "7\0\5\0\2\0\0\3?\0\0\0\4\0\0\0\343\351\355\0T\0\4\0 \0"..., 36) = 36
> read(3, "\1\0\23\0\0\0\0\0\331\331\331\331\331\331\0\0\331\331\331"..., 32) = 32
> write(3, "\20\1\t\0\33\0\0\3XDCCC_LINEAR_RGB_CORRECT"..., 36) = 36
> read(3, "\1e\24\0\0\0\0\0i\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\200>\0"..., 32) = 32
> write(3, "\20\1\t\0\31\0\0\3XDCCC_LINEAR_RGB_MATRICE"..., 36) = 36
> read(3, "\1e\25\0\0\0\0\0j\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\200>\0"..., 32) = 32
> write(3, "\24\0\6\0?\0\0\0j\0\0\0\23\0\0\0\0\0\0\0t\31\0\0", 24) = 24
> read(3, "\1\0\26\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0"..., 32) = 32
> stat64(0xc5acbc, 0xffb47670) = -1 ENOENT (No such file or directory)
> writev(3, [{"U\0\5\0 \0\0\0\5\0\0\0", 12}, {"Black", 5}, {"\0\0\0", 3}], 3) = 20
> read(3, "\1\254\27\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\304"..., 32) = 32
> lstat64(0xffb45580, 0xffb4531c) = 0
> lstat64(0xffb45580, 0xffb4531c) = 0
> lstat64(0xffb45580, 0xffb4531c) = 0
> lstat64(0xffb45580, 0xffb4531c) = 0
> lstat64(0xffb45580, 0xffb4531c) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/tk_utils/tclIndex", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb46558) = -1 ENOTTY (Inappropriate ioctl for device)
> _llseek(0, 0, 0xffb465d0, SEEK_CUR) = -1 ESPIPE (Illegal seek)
> ioctl(0, SNDCTL_TMR_TIMEBASE or TCGETS, {B38400 opost isig icanon echo ...}) = 0
> ioctl(0, SNDCTL_TMR_TIMEBASE or TCGETS, {B38400 opost isig icanon echo ...}) = 0
> _llseek(1, 0, 0xffb465d0, SEEK_CUR) = -1 ESPIPE (Illegal seek)
> ioctl(1, SNDCTL_TMR_TIMEBASE or TCGETS, {B38400 opost isig icanon echo ...}) = 0
> ioctl(1, SNDCTL_TMR_TIMEBASE or TCGETS, {B38400 opost isig icanon echo ...}) = 0
> _llseek(2, 0, 0xffb465d0, SEEK_CUR) = -1 ESPIPE (Illegal seek)
> ioctl(2, SNDCTL_TMR_TIMEBASE or TCGETS, {B38400 opost isig icanon echo ...}) = 0
> ioctl(2, SNDCTL_TMR_TIMEBASE or TCGETS, {B38400 opost isig icanon echo ...}) = 0
> read(4, "# Tcl autoload index file, versi"..., 4096) = 4096
> read(4, "_def) [list source [file join $d"..., 4096) = 4096
> read(4, "ndex(CheckFloatRange) [list sour"..., 4096) = 4096
> read(4, "ist source [file join $dir html_"..., 4096) = 4096
> read(4, "its) [list source [file join $di"..., 4096) = 4096
> read(4, " [list source [file join $dir ca"..., 4096) = 4096
> read(4, "yme_map.tcl]]\nset auto_index(Sel"..., 4096) = 4096
> read(4, "set auto_index(spBiolimsDialog_I"..., 4096) = 4096
> read(4, "index(::Widget::Xmclistbox::_bin"..., 4096) = 4096
> read(4, "extract_element_name) [list sour"..., 4096) = 4096
> read(4, "_element_different) [list source"..., 4096) = 1259
> read(4, "", 4096) = 0
> brk(0x8101000) = 0x8101000
> close(4) = 0
> lstat64(0xffb45580, 0xffb4531c) = 0
> lstat64(0xffb45580, 0xffb4531c) = 0
> lstat64(0xffb45580, 0xffb4531c) = 0
> open("/usr/local/lib/tclIndex", O_RDONLY|O_LARGEFILE) = -1 ENOENT (No such file or directory)
> open("/usr/lib/gconv/gconv-modules.cache", O_RDONLY) = 4
> fstat64(0x4, 0xffb45b94) = 0
> mmap2(NULL, 25460, PROT_READ, MAP_SHARED, 4, 0) = 0xfffffffff7aa1000
> close(4) = 0
> lstat64(0xffb45580, 0xffb4531c) = 0
> lstat64(0xffb45580, 0xffb4531c) = 0
> lstat64(0xffb45580, 0xffb4531c) = 0
> lstat64(0xffb45580, 0xffb4531c) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/tclIndex", O_RDONLY|O_LARGEFILE) = -1 ENOENT (No such file or directory)
> lstat64(0xffb45580, 0xffb4531c) = 0
> lstat64(0xffb45580, 0xffb4531c) = 0
> lstat64(0xffb45580, 0xffb4531c) = 0
> lstat64(0xffb45580, 0xffb4531c) = 0
> lstat64(0xffb45580, 0xffb4531c) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/tcl/tclIndex", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb46558) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "# Tcl autoload index file, versi"..., 4096) = 4096
> read(4, ") [list source [file join $dir s"..., 4096) = 1913
> read(4, "", 4096) = 0
> close(4) = 0
> lstat64(0xffb457b0, 0xffb4554c) = 0
> lstat64(0xffb457b0, 0xffb4554c) = 0
> lstat64(0xffb457b0, 0xffb4554c) = 0
> lstat64(0xffb457b0, 0xffb4554c) = 0
> lstat64(0xffb457b0, 0xffb4554c) = 0
> stat64(0x80c64c0, 0xffb469a0) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/tcl/auto.tcl", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb46748) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "# auto.tcl --\n#\n# utility procs "..., 4096) = 4096
> read(4, "pend errors \"$file: $msg\\n$error"..., 4096) = 4096
> read(4, "d $oldDir\n } msg]\n if {$er"..., 4096) = 4096
> read(4, " command. When you execute them"..., 4096) = 4096
> read(4, "source\" call to handle platform\n"..., 4096) = 3054
> read(4, "", 4096) = 0
> close(4) = 0
> lstat64(0xffb453f0, 0xffb4518c) = 0
> lstat64(0xffb453f0, 0xffb4518c) = 0
> lstat64(0xffb453f0, 0xffb4518c) = 0
> lstat64(0xffb453f0, 0xffb4518c) = 0
> lstat64(0xffb453f0, 0xffb4518c) = 0
> access("/usr/local/staden-linux-x86-1-7-0/lib/tk/tk.tcl", F_OK) = 0
> stat64(0x80c7f50, 0xffb46760) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/tk/tk.tcl", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb46508) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "# tk.tcl --\n#\n# Initialization s"..., 4096) = 4096
> read(4, "dowingsystem] eq \"macintosh\" \\\n\t"..., 4096) = 4096
> read(4, "herwise, if someone references i"..., 4096) = 4096
> read(4, "rm(platform) \"macintosh\"]} {\n\tpr"..., 4096) = 4096
> read(4, "r label which has appropriate un"..., 4096) = 704
> brk(0x8127000) = 0x8127000
> read(4, "", 4096) = 0
> close(4) = 0
> lstat64(0xffb435c0, 0xffb4335c) = 0
> lstat64(0xffb435c0, 0xffb4335c) = 0
> lstat64(0xffb435c0, 0xffb4335c) = 0
> lstat64(0xffb435c0, 0xffb4335c) = 0
> lstat64(0xffb435c0, 0xffb4335c) = 0
> stat64(0x80cf938, 0xffb447b0) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/tcl/package.tcl", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb44558) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "# package.tcl --\n#\n# utility pro"..., 4096) = 4096
> read(4, "dx]\n set patternList [lrange "..., 4096) = 4096
> read(4, "each ::tcl::x [package names] {\n"..., 4096) = 4096
> read(4, "e of this file\'s directory.\\n\"\n\n"..., 4096) = 4096
> read(4, "ing package index file $file: $m"..., 4096) = 4096
> read(4, "st $lazyFileList]\\]\"\n }\n a"..., 4096) = 91
> read(4, "", 4096) = 0
> close(4) = 0
> lstat64(0xffb430f0, 0xffb42e8c) = 0
> lstat64(0xffb430f0, 0xffb42e8c) = 0
> lstat64(0xffb430f0, 0xffb42e8c) = 0
> lstat64(0xffb430f0, 0xffb42e8c) = 0
> stat64(0xffb440cc, 0xffb441a0) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/tk_utils/", O_RDONLY|O_NONBLOCK|O_LARGEFILE|O_DIRECTORY) = 4
> fstat64(0x4, 0xffb43e4c) = 0
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> getdents(4, /* 1 entries */, 4096) = 1392
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> getdents(4, /* 0 entries */, 4096) = 0
> close(4) = 0
> lstat64(0xffb43200, 0xffb42f9c) = 0
> lstat64(0xffb43200, 0xffb42f9c) = 0
> lstat64(0xffb43200, 0xffb42f9c) = 0
> lstat64(0xffb43200, 0xffb42f9c) = 0
> lstat64(0xffb43200, 0xffb42f9c) = 0
> access("/usr/local/staden-linux-x86-1-7-0/lib/tk_utils/pkgIndex.tcl", R_OK) = -1 ENOENT (No such file or directory)
> lstat64(0xffb430f0, 0xffb42e8c) = 0
> lstat64(0xffb430f0, 0xffb42e8c) = 0
> stat64(0xffb440cc, 0xffb441a0) = 0
> open("/usr/local/lib/", O_RDONLY|O_NONBLOCK|O_LARGEFILE|O_DIRECTORY) = 4
> fstat64(0x4, 0xffb43e4c) = 0
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> getdents(4, /* 1 entries */, 4096) = 56
> stat64(0xffb440cc, 0xffb43e40) = 0
> getdents(4, /* 0 entries */, 4096) = 0
> close(4) = 0
> lstat64(0xffb43200, 0xffb42f9c) = 0
> lstat64(0xffb43200, 0xffb42f9c) = 0
> lstat64(0xffb43200, 0xffb42f9c) = 0
> access("/usr/local/lib/pkgIndex.tcl", R_OK) = -1 ENOENT (No such file or directory)
> lstat64(0xffb430f0, 0xffb42e8c) = 0
> lstat64(0xffb430f0, 0xffb42e8c) = 0
> lstat64(0xffb430f0, 0xffb42e8c) = 0
> stat64(0xffb440cc, 0xffb441a0) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/", O_RDONLY|O_NONBLOCK|O_LARGEFILE|O_DIRECTORY) = 4
> fstat64(0x4, 0xffb43e4c) = 0
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> getdents(4, /* 1 entries */, 4096) = 484
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> getdents(4, /* 0 entries */, 4096) = 0
> close(4) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0x8106a10, 0xffb43be0) = -1 ENOENT (No such file or directory)
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0x8106a10, 0xffb43be0) = -1 ENOENT (No such file or directory)
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0x8106880, 0xffb43be0) = -1 ENOENT (No such file or directory)
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0x8106980, 0xffb43be0) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0x8107bf0, 0xffb43be0) = -1 ENOENT (No such file or directory)
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0x8107b18, 0xffb43be0) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0x8107df8, 0xffb43be0) = -1 ENOENT (No such file or directory)
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0x8107da0, 0xffb43be0) = -1 ENOENT (No such file or directory)
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0x8108010, 0xffb43be0) = -1 ENOENT (No such file or directory)
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0x8108010, 0xffb43be0) = -1 ENOENT (No such file or directory)
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0x81080e8, 0xffb43be0) = -1 ENOENT (No such file or directory)
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0x8107fc8, 0xffb43be0) = -1 ENOENT (No such file or directory)
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0x8107de0, 0xffb43be0) = -1 ENOENT (No such file or directory)
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0x8107da0, 0xffb43be0) = -1 ENOENT (No such file or directory)
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0x81080e8, 0xffb43be0) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0x8108440, 0xffb43be0) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0x8108608, 0xffb43be0) = -1 ENOENT (No such file or directory)
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0x8108590, 0xffb43be0) = -1 ENOENT (No such file or directory)
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0x8108550, 0xffb43be0) = -1 ENOENT (No such file or directory)
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0x8108510, 0xffb43be0) = -1 ENOENT (No such file or directory)
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0x8108510, 0xffb43be0) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0x8108870, 0xffb43be0) = -1 ENOENT (No such file or directory)
> access("/usr/local/staden-linux-x86-1-7-0/lib/itk3.3/pkgIndex.tcl", R_OK) = 0
> stat64(0x8106980, 0xffb447b0) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/itk3.3/pkgIndex.tcl", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb44558) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "# Tcl package index file, versio"..., 4096) = 245
> read(4, "", 4096) = 0
> close(4) = 0
> access("/usr/local/staden-linux-x86-1-7-0/lib/tablelist3.4/pkgIndex.tcl", R_OK) = 0
> stat64(0x8107b18, 0xffb447b0) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/tablelist3.4/pkgIndex.tcl", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb44558) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "#==============================="..., 4096) = 707
> read(4, "", 4096) = 0
> close(4) = 0
> access("/usr/local/staden-linux-x86-1-7-0/lib/itcl3.3/pkgIndex.tcl", R_OK) = 0
> stat64(0x81080e8, 0xffb447b0) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/itcl3.3/pkgIndex.tcl", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb44558) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "# Tcl package index file, versio"..., 4096) = 252
> read(4, "", 4096) = 0
> close(4) = 0
> access("/usr/local/staden-linux-x86-1-7-0/lib/tk/pkgIndex.tcl", R_OK) = 0
> stat64(0x8108440, 0xffb447b0) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/tk/pkgIndex.tcl", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb44558) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "if {[package vcompare [package p"..., 4096) = 281
> read(4, "", 4096) = 0
> close(4) = 0
> access("/usr/local/staden-linux-x86-1-7-0/lib/iwidgets/pkgIndex.tcl", R_OK) = 0
> stat64(0x8108510, 0xffb447b0) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/iwidgets/pkgIndex.tcl", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb44558) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "# Tcl package index file, versio"..., 4096) = 115
> read(4, "", 4096) = 0
> close(4) = 0
> lstat64(0xffb43200, 0xffb42f9c) = 0
> lstat64(0xffb43200, 0xffb42f9c) = 0
> lstat64(0xffb43200, 0xffb42f9c) = 0
> lstat64(0xffb43200, 0xffb42f9c) = 0
> access("/usr/local/staden-linux-x86-1-7-0/lib/pkgIndex.tcl", R_OK) = -1 ENOENT (No such file or directory)
> lstat64(0xffb430f0, 0xffb42e8c) = 0
> lstat64(0xffb430f0, 0xffb42e8c) = 0
> lstat64(0xffb430f0, 0xffb42e8c) = 0
> lstat64(0xffb430f0, 0xffb42e8c) = 0
> stat64(0xffb440cc, 0xffb441a0) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/tcl/", O_RDONLY|O_NONBLOCK|O_LARGEFILE|O_DIRECTORY) = 4
> fstat64(0x4, 0xffb43e4c) = 0
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> getdents(4, /* 1 entries */, 4096) = 488
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> stat64(0xffb440cc, 0xffb43e40) = 0
> getdents(4, /* 0 entries */, 4096) = 0
> close(4) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0x81064d0, 0xffb43be0) = -1 ENOENT (No such file or directory)
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0x8107f08, 0xffb43be0) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0x81086f0, 0xffb43be0) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0x8108930, 0xffb43be0) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0x8108b68, 0xffb43be0) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0xffb42e90, 0xffb42c2c) = 0
> lstat64(0x8108dd0, 0xffb43be0) = 0
> access("/usr/local/staden-linux-x86-1-7-0/lib/tcl/http1.0/pkgIndex.tcl", R_OK) = 0
> stat64(0x8107f08, 0xffb447b0) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/tcl/http1.0/pkgIndex.tcl", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb44558) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "# Tcl package index file, versio"..., 4096) = 735
> read(4, "", 4096) = 0
> close(4) = 0
> access("/usr/local/staden-linux-x86-1-7-0/lib/tcl/msgcat1.3/pkgIndex.tcl", R_OK) = 0
> stat64(0x81086f0, 0xffb447b0) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/tcl/msgcat1.3/pkgIndex.tcl", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb44558) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "if {![package vsatisfies [packag"..., 4096) = 132
> read(4, "", 4096) = 0
> close(4) = 0
> access("/usr/local/staden-linux-x86-1-7-0/lib/tcl/http2.4/pkgIndex.tcl", R_OK) = 0
> stat64(0x8108930, 0xffb447b0) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/tcl/http2.4/pkgIndex.tcl", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb44558) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "# Tcl package index file, versio"..., 4096) = 726
> read(4, "", 4096) = 0
> close(4) = 0
> access("/usr/local/staden-linux-x86-1-7-0/lib/tcl/opt0.4/pkgIndex.tcl", R_OK) = 0
> stat64(0x8108b68, 0xffb447b0) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/tcl/opt0.4/pkgIndex.tcl", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb44558) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "# Tcl package index file, versio"..., 4096) = 605
> read(4, "", 4096) = 0
> close(4) = 0
> access("/usr/local/staden-linux-x86-1-7-0/lib/tcl/tcltest2.2/pkgIndex.tcl", R_OK) = 0
> stat64(0x8108dd0, 0xffb447b0) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/tcl/tcltest2.2/pkgIndex.tcl", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb44558) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "# Tcl package index file, versio"..., 4096) = 608
> read(4, "", 4096) = 0
> close(4) = 0
> lstat64(0xffb43200, 0xffb42f9c) = 0
> lstat64(0xffb43200, 0xffb42f9c) = 0
> lstat64(0xffb43200, 0xffb42f9c) = 0
> lstat64(0xffb43200, 0xffb42f9c) = 0
> lstat64(0xffb43200, 0xffb42f9c) = 0
> access("/usr/local/staden-linux-x86-1-7-0/lib/tcl/pkgIndex.tcl", R_OK) = -1 ENOENT (No such file or directory)
> lstat64(0xffb44390, 0xffb4412c) = 0
> lstat64(0xffb44390, 0xffb4412c) = 0
> lstat64(0xffb44390, 0xffb4412c) = 0
> lstat64(0xffb44390, 0xffb4412c) = 0
> lstat64(0xffb44390, 0xffb4412c) = 0
> lstat64(0xffb44390, 0xffb4412c) = 0
> stat64(0x80d6010, 0xffb45580) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/tcl/msgcat1.3/msgcat.tcl", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb45328) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "# msgcat.tcl --\n#\n#\tThis file de"..., 4096) = 4096
> read(4, "a_IN\n 50 mn\n 51 bo"..., 4096) = 4096
> read(4, " $src\n }\n\n set ns [uplevel"..., 4096) = 4096
> read(4, "re translations to the WinRegToI"..., 4096) = 396
> read(4, "", 4096) = 0
> close(4) = 0
> brk(0x8148000) = 0x8148000
> lstat64(0xffb43ef0, 0xffb43c8c) = 0
> lstat64(0xffb43ef0, 0xffb43c8c) = 0
> lstat64(0xffb43ef0, 0xffb43c8c) = 0
> lstat64(0xffb43ef0, 0xffb43c8c) = 0
> lstat64(0xffb43ef0, 0xffb43c8c) = 0
> lstat64(0xffb43ef0, 0xffb43c8c) = 0
> access("/usr/local/staden-linux-x86-1-7-0/lib/tk/msgs/en_us.msg", F_OK) = -1 ENOENT (No such file or directory)
> lstat64(0xffb43ef0, 0xffb43c8c) = 0
> lstat64(0xffb43ef0, 0xffb43c8c) = 0
> lstat64(0xffb43ef0, 0xffb43c8c) = 0
> lstat64(0xffb43ef0, 0xffb43c8c) = 0
> lstat64(0xffb43ef0, 0xffb43c8c) = 0
> lstat64(0xffb43ef0, 0xffb43c8c) = 0
> access("/usr/local/staden-linux-x86-1-7-0/lib/tk/msgs/en.msg", F_OK) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/tk/msgs/en.msg", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb453b8) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "namespace eval ::tk {\n ::msgc"..., 4096) = 2540
> read(4, "", 4096) = 0
> close(4) = 0
> lstat64(0xffb43fc0, 0xffb43d5c) = 0
> lstat64(0xffb43fc0, 0xffb43d5c) = 0
> lstat64(0xffb43fc0, 0xffb43d5c) = 0
> lstat64(0xffb43fc0, 0xffb43d5c) = 0
> lstat64(0xffb43fc0, 0xffb43d5c) = 0
> stat64(0x811f9b0, 0xffb451b0) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/tk/button.tcl", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb44f58) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "# button.tcl --\n#\n# This file de"..., 4096) = 4096
> read(4, "k::Priv\n if {[$w cget -state]"..., 4096) = 4096
> read(4, "on is disabled.\n#\n# Arguments:\n#"..., 4096) = 4096
> read(4, " $w configure -state active\n\t} "..., 4096) = 4096
> read(4, "ked\n# through the keyboard. It "..., 4096) = 318
> read(4, "", 4096) = 0
> close(4) = 0
> lstat64(0xffb43fc0, 0xffb43d5c) = 0
> lstat64(0xffb43fc0, 0xffb43d5c) = 0
> lstat64(0xffb43fc0, 0xffb43d5c) = 0
> lstat64(0xffb43fc0, 0xffb43d5c) = 0
> lstat64(0xffb43fc0, 0xffb43d5c) = 0
> stat64(0x8110798, 0xffb451b0) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/tk/entry.tcl", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb44f58) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "# entry.tcl --\n#\n# This file def"..., 4096) = 4096
> read(4, "etCursor %W 0\n}\nbind Entry <Shif"..., 4096) = 4096
> read(4, " the button press.\n\nproc ::tk::E"..., 4096) = 4096
> read(4, "\n EntrySeeInsert $w\n}\n\n# ::tk"..., 4096) = 4096
> read(4, ")]} { set ::tk::Priv(x) $x }\n "..., 4096) = 641
> read(4, "", 4096) = 0
> close(4) = 0
> lstat64(0xffb43fc0, 0xffb43d5c) = 0
> lstat64(0xffb43fc0, 0xffb43d5c) = 0
> lstat64(0xffb43fc0, 0xffb43d5c) = 0
> lstat64(0xffb43fc0, 0xffb43d5c) = 0
> lstat64(0xffb43fc0, 0xffb43d5c) = 0
> stat64(0x810a180, 0xffb451b0) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/tk/listbox.tcl", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb44f58) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "# listbox.tcl --\n#\n# This file d"..., 4096) = 4096
> read(4, "[%W index active]\n}\nbind Listbox"..., 4096) = 4096
> read(4, " set $i\n\t\t}\n\t\tincr i -1\n\t }\n\t"..., 4096) = 4096
> read(4, "oxMotion $w [$w index active]\n}\n"..., 4096) = 2110
> read(4, "", 4096) = 0
> close(4) = 0
> lstat64(0xffb43fc0, 0xffb43d5c) = 0
> lstat64(0xffb43fc0, 0xffb43d5c) = 0
> lstat64(0xffb43fc0, 0xffb43d5c) = 0
> lstat64(0xffb43fc0, 0xffb43d5c) = 0
> lstat64(0xffb43fc0, 0xffb43d5c) = 0
> stat64(0x810d0f8, 0xffb451b0) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/tk/menu.tcl", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb44f58) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "# menu.tcl --\n#\n# This file defi"..., 4096) = 4096
> read(4, " tk::MbMotion %W up %X %Y\n}\nbind"..., 4096) = 4096
> read(4, "rateMenuSelect $menu\n\n # If t"..., 4096) = 4096
> read(4, "etely).\n\n catch {focus $Priv("..., 4096) = 4096
> read(4, "l $menu $Priv(window)]} {\n\tif {["..., 4096) = 4096
> read(4, "a cascade; this prevents\n\t# the "..., 4096) = 4096
> read(4, "ndex last] \"none\"]} {\n\t break"..., 4096) = 4096
> read(4, "oks for a menubutton with that c"..., 4096) = 4096
> read(4, "\"\"]} {\n\t\t $menu postcascade $"..., 4096) = 4096
> read(4, " menu entry to center over (x,y)"..., 4096) = 500
> read(4, "", 4096) = 0
> close(4) = 0
> lstat64(0xffb43fc0, 0xffb43d5c) = 0
> lstat64(0xffb43fc0, 0xffb43d5c) = 0
> lstat64(0xffb43fc0, 0xffb43d5c) = 0
> lstat64(0xffb43fc0, 0xffb43d5c) = 0
> lstat64(0xffb43fc0, 0xffb43d5c) = 0
> stat64(0x810a0f0, 0xffb451b0) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/tk/panedwindow.tcl", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb44f58) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "# panedwindow.tcl --\n#\n# This fi"..., 4096) = 4096
> read(4, "# Arguments:\n# w\t\tthe widget\n#"..., 4096) = 945
> read(4, "", 4096) = 0
> close(4) = 0
> lstat64(0xffb43fc0, 0xffb43d5c) = 0
> lstat64(0xffb43fc0, 0xffb43d5c) = 0
> lstat64(0xffb43fc0, 0xffb43d5c) = 0
> lstat64(0xffb43fc0, 0xffb43d5c) = 0
> lstat64(0xffb43fc0, 0xffb43d5c) = 0
> stat64(0x8129fe8, 0xffb451b0) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/tk/scale.tcl", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb44f58) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "# scale.tcl --\n#\n# This file def"..., 4096) = 4096
> read(4, "oords 0]}]\n\tset Priv(deltaY) [ex"..., 4096) = 3767
> read(4, "", 4096) = 0
> close(4) = 0
> lstat64(0xffb43fc0, 0xffb43d5c) = 0
> lstat64(0xffb43fc0, 0xffb43d5c) = 0
> lstat64(0xffb43fc0, 0xffb43d5c) = 0
> lstat64(0xffb43fc0, 0xffb43d5c) = 0
> lstat64(0xffb43fc0, 0xffb43d5c) = 0
> stat64(0x812beb8, 0xffb451b0) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/tk/scrlbar.tcl", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb44f58) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "# scrlbar.tcl --\n#\n# This file d"..., 4096) = 4096
> read(4, " tk::ScrollButtonDown {w x y} {\n"..., 4096) = 4096
> read(4, "position at the end of the drag "..., 4096) = 4064
> read(4, "", 4096) = 0
> close(4) = 0
> lstat64(0xffb43fc0, 0xffb43d5c) = 0
> lstat64(0xffb43fc0, 0xffb43d5c) = 0
> lstat64(0xffb43fc0, 0xffb43d5c) = 0
> lstat64(0xffb43fc0, 0xffb43d5c) = 0
> lstat64(0xffb43fc0, 0xffb43d5c) = 0
> stat64(0x812be78, 0xffb451b0) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/tk/spinbox.tcl", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb44f58) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "# spinbox.tcl --\n#\n# This file d"..., 4096) = 4096
> read(4, "box <Control-Right> {\n ::tk::"..., 4096) = 4096
> read(4, " set delay [$w cget -repeatint"..., 4096) = 4096
> read(4, "dBreakAfter [$w get] [expr {$anc"..., 4096) = 2873
> read(4, "", 4096) = 0
> close(4) = 0
> lstat64(0xffb43fc0, 0xffb43d5c) = 0
> lstat64(0xffb43fc0, 0xffb43d5c) = 0
> lstat64(0xffb43fc0, 0xffb43d5c) = 0
> lstat64(0xffb43fc0, 0xffb43d5c) = 0
> lstat64(0xffb43fc0, 0xffb43d5c) = 0
> stat64(0x812ffc0, 0xffb451b0) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/tk/text.tcl", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb44f58) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "# text.tcl --\n#\n# This file defi"..., 4096) = 4096
> read(4, "rt]\n}\nbind Text <Prior> {\n tk"..., 4096) = 4096
> read(4, "extSetCursor %W [tk::TextUpDownL"..., 4096) = 4096
> read(4, " Text <5> {\n\tif {!$tk_strictMoti"..., 4096) = 4096
> read(4, "\n $w tag remove sel $last end"..., 4096) = 4096
> brk(0x816a000) = 0x816a000
> read(4, "ex $index]\n set b [$w index s"..., 4096) = 4096
> read(4, "et pos [$w index \"$pos + 1 line\""..., 4096) = 4096
> read(4, "ext position.\n\nproc ::tk::TextNe"..., 4096) = 2699
> read(4, "", 4096) = 0
> close(4) = 0
> lstat64(0xffb46be0, 0xffb4697c) = 0
> lstat64(0xffb46be0, 0xffb4697c) = 0
> lstat64(0xffb46be0, 0xffb4697c) = 0
> lstat64(0xffb46be0, 0xffb4697c) = 0
> lstat64(0xffb46be0, 0xffb4697c) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/tk/tclIndex", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb47bb8) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "# Tcl autoload index file, versi"..., 4096) = 4096
> read(4, "]]\nset auto_index(::tk::FocusGro"..., 4096) = 4096
> read(4, "::tk::MenuDownArrow) [list sourc"..., 4096) = 4096
> read(4, " [list source [file join $dir sp"..., 4096) = 4096
> read(4, "\nset auto_index(::tk::IconList_A"..., 4096) = 4096
> read(4, "_InterpFilter) [list source [fil"..., 4096) = 1730
> read(4, "", 4096) = 0
> close(4) = 0
> lstat64(0xffb46be0, 0xffb4697c) = 0
> lstat64(0xffb46be0, 0xffb4697c) = 0
> lstat64(0xffb46be0, 0xffb4697c) = 0
> lstat64(0xffb46be0, 0xffb4697c) = 0
> lstat64(0xffb46be0, 0xffb4697c) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/tk_utils/tclIndex", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb47bb8) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "# Tcl autoload index file, versi"..., 4096) = 4096
> read(4, "_def) [list source [file join $d"..., 4096) = 4096
> read(4, "ndex(CheckFloatRange) [list sour"..., 4096) = 4096
> read(4, "ist source [file join $dir html_"..., 4096) = 4096
> read(4, "its) [list source [file join $di"..., 4096) = 4096
> read(4, " [list source [file join $dir ca"..., 4096) = 4096
> read(4, "yme_map.tcl]]\nset auto_index(Sel"..., 4096) = 4096
> read(4, "set auto_index(spBiolimsDialog_I"..., 4096) = 4096
> read(4, "index(::Widget::Xmclistbox::_bin"..., 4096) = 4096
> read(4, "extract_element_name) [list sour"..., 4096) = 4096
> read(4, "_element_different) [list source"..., 4096) = 1259
> read(4, "", 4096) = 0
> close(4) = 0
> lstat64(0xffb46be0, 0xffb4697c) = 0
> lstat64(0xffb46be0, 0xffb4697c) = 0
> lstat64(0xffb46be0, 0xffb4697c) = 0
> open("/usr/local/lib/tclIndex", O_RDONLY|O_LARGEFILE) = -1 ENOENT (No such file or directory)
> lstat64(0xffb46be0, 0xffb4697c) = 0
> lstat64(0xffb46be0, 0xffb4697c) = 0
> lstat64(0xffb46be0, 0xffb4697c) = 0
> lstat64(0xffb46be0, 0xffb4697c) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/tclIndex", O_RDONLY|O_LARGEFILE) = -1 ENOENT (No such file or directory)
> lstat64(0xffb46be0, 0xffb4697c) = 0
> lstat64(0xffb46be0, 0xffb4697c) = 0
> lstat64(0xffb46be0, 0xffb4697c) = 0
> lstat64(0xffb46be0, 0xffb4697c) = 0
> lstat64(0xffb46be0, 0xffb4697c) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/tcl/tclIndex", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb47bb8) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "# Tcl autoload index file, versi"..., 4096) = 4096
> read(4, ") [list source [file join $dir s"..., 4096) = 1913
> read(4, "", 4096) = 0
> close(4) = 0
> lstat64(0xffb47ec0, 0xffb47c5c) = 0
> lstat64(0xffb47ec0, 0xffb47c5c) = 0
> lstat64(0xffb47ec0, 0xffb47c5c) = 0
> lstat64(0xffb47ec0, 0xffb47c5c) = 0
> stat64(0x80bffc8, 0xffb490b0) = 0
> open("/usr/local/staden-linux-x86-1-7-0/tables/shlib.conf", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb48e58) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "switch -glob \"$env(MACHINE)\" {\n "..., 4096) = 839
> read(4, "", 4096) = 0
> close(4) = 0
> lstat64(0xffb47bb0, 0xffb4794c) = 0
> lstat64(0xffb47bb0, 0xffb4794c) = 0
> lstat64(0xffb47bb0, 0xffb4794c) = 0
> lstat64(0xffb47bb0, 0xffb4794c) = 0
> lstat64(0xffb47bb0, 0xffb4794c) = 0
> lstat64(0xffb470f0, 0xffb46e8c) = 0
> lstat64(0xffb470f0, 0xffb46e8c) = 0
> lstat64(0xffb470f0, 0xffb46e8c) = 0
> lstat64(0xffb470f0, 0xffb46e8c) = 0
> lstat64(0xffb470f0, 0xffb46e8c) = 0
> stat64(0x8145b08, 0xffb482e0) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/tk_utils/user_defaults.tcl", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb48088) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "#\n# Copyright (c) Medical Resear"..., 4096) = 4096
> read(4, "${lib_prefix}${name}${lib_suffix"..., 4096) = 3321
> read(4, "", 4096) = 0
> close(4) = 0
> lstat64(0xffb46cb0, 0xffb46a4c) = 0
> lstat64(0xffb46cb0, 0xffb46a4c) = 0
> lstat64(0xffb46cb0, 0xffb46a4c) = 0
> lstat64(0xffb46cb0, 0xffb46a4c) = 0
> stat64(0x8145d10, 0xffb47ea0) = 0
> open("/usr/local/staden-linux-x86-1-7-0/tables/shlib.conf", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb47c48) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "switch -glob \"$env(MACHINE)\" {\n "..., 4096) = 839
> read(4, "", 4096) = 0
> close(4) = 0
> lstat64(0xffb461f0, 0xffb45f8c) = 0
> lstat64(0xffb461f0, 0xffb45f8c) = 0
> access("/home/kamini/.tk_utilsrc", F_OK) = -1 ENOENT (No such file or directory)
> getcwd("/home/kamini/STADEN", 4097) = 20
> lstat64(0xffb461c0, 0xffb45f5c) = 0
> lstat64(0xffb461c0, 0xffb45f5c) = 0
> lstat64(0xffb461f0, 0xffb45f8c) = 0
> lstat64(0xffb461f0, 0xffb45f8c) = 0
> lstat64(0xffb461f0, 0xffb45f8c) = 0
> access("/home/kamini/STADEN/.tk_utilsrc", F_OK) = -1 ENOENT (No such file or directory)
> lstat64(0xffb461f0, 0xffb45f8c) = 0
> lstat64(0xffb461f0, 0xffb45f8c) = 0
> lstat64(0xffb461f0, 0xffb45f8c) = 0
> lstat64(0xffb461f0, 0xffb45f8c) = 0
> access("/usr/local/staden-linux-x86-1-7-0/tables/tk_utilsrc", F_OK) = 0
> stat64(0x81585f8, 0xffb47560) = 0
> open("/usr/local/staden-linux-x86-1-7-0/tables/tk_utilsrc", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb47308) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "#global auto_path\n#lappend auto_"..., 4096) = 4096
> read(4, "\nset_def R_ENZ.E_FILE.3 "..., 4096) = 4096
> read(4, "\t.scale_y\nset_def RASTER.SCALEX."..., 4096) = 2816
> read(4, "", 4096) = 0
> close(4) = 0
> lstat64(0xffb45160, 0xffb44efc) = 0
> lstat64(0xffb45160, 0xffb44efc) = 0
> lstat64(0xffb45160, 0xffb44efc) = 0
> lstat64(0xffb45160, 0xffb44efc) = 0
> lstat64(0xffb45160, 0xffb44efc) = 0
> stat64(0x815f260, 0xffb46350) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/tk_utils/menu.tcl", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb460f8) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "#\n# Copyright (c) Medical Resear"..., 4096) = 4096
> read(4, "\"\" && \\\n\t\t\t[lsearch -exact [lind"..., 4096) = 4096
> read(4, "\t\t\t-state [lindex {disabled norm"..., 4096) = 4096
> read(4, "tore {menu menu_name state {firs"..., 4096) = 2188
> read(4, "", 4096) = 0
> close(4) = 0
> lstat64(0xffb461f0, 0xffb45f8c) = 0
> lstat64(0xffb461f0, 0xffb45f8c) = 0
> lstat64(0xffb461f0, 0xffb45f8c) = 0
> lstat64(0xffb461f0, 0xffb45f8c) = 0
> access("/usr/local/staden-linux-x86-1-7-0/tables/tk_utilsrc.local", F_OK) = -1 ENOENT (No such file or directory)
> lstat64(0xffb461f0, 0xffb45f8c) = 0
> lstat64(0xffb461f0, 0xffb45f8c) = 0
> access("/home/kamini/.tk_utilsrc", F_OK) = -1 ENOENT (No such file or directory)
> lstat64(0xffb461f0, 0xffb45f8c) = 0
> lstat64(0xffb461f0, 0xffb45f8c) = 0
> access("/home/kamini/.tk_utilsrc.local", F_OK) = -1 ENOENT (No such file or directory)
> lstat64(0xffb46120, 0xffb45ebc) = 0
> lstat64(0xffb46120, 0xffb45ebc) = 0
> getcwd("/home/kamini/STADEN", 4097) = 20
> lstat64(0xffb461c0, 0xffb45f5c) = 0
> lstat64(0xffb461c0, 0xffb45f5c) = 0
> lstat64(0xffb461f0, 0xffb45f8c) = 0
> lstat64(0xffb461f0, 0xffb45f8c) = 0
> lstat64(0xffb461f0, 0xffb45f8c) = 0
> access("/home/kamini/STADEN/.tk_utilsrc", F_OK) = -1 ENOENT (No such file or directory)
> getcwd("/home/kamini/STADEN", 4097) = 20
> lstat64(0xffb461c0, 0xffb45f5c) = 0
> lstat64(0xffb461c0, 0xffb45f5c) = 0
> lstat64(0xffb461f0, 0xffb45f8c) = 0
> lstat64(0xffb461f0, 0xffb45f8c) = 0
> lstat64(0xffb461f0, 0xffb45f8c) = 0
> access("/home/kamini/STADEN/.tk_utilsrc.local", F_OK) = -1 ENOENT (No such file or directory)
> lstat64(0xffb470f0, 0xffb46e8c) = 0
> lstat64(0xffb470f0, 0xffb46e8c) = 0
> lstat64(0xffb470f0, 0xffb46e8c) = 0
> lstat64(0xffb470f0, 0xffb46e8c) = 0
> lstat64(0xffb470f0, 0xffb46e8c) = 0
> stat64(0x8169748, 0xffb482e0) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/tk_utils/init.tcl", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb48088) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "#\n# Copyright (c) Medical Resear"..., 4096) = 4096
> read(4, "t>\n event add <<paste>>\t\t\t<Co"..., 4096) = 4096
> read(4, "l userDefault\n\toption add *Text."..., 4096) = 1407
> brk(0x818e000) = 0x818e000
> read(4, "", 4096) = 0
> close(4) = 0
> lstat64(0xffb45bf0, 0xffb4598c) = 0
> lstat64(0xffb45bf0, 0xffb4598c) = 0
> lstat64(0xffb45bf0, 0xffb4598c) = 0
> lstat64(0xffb45bf0, 0xffb4598c) = 0
> lstat64(0xffb45bf0, 0xffb4598c) = 0
> stat64(0x816fb28, 0xffb46de0) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/tk/palette.tcl", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb46b88) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "# palette.tcl --\n#\n# This file c"..., 4096) = 4096
> read(4, "n database changes that need to "..., 4096) = 4096
> read(4, " None.\n\nproc ::tk_bisque {} {\n "..., 4096) = 356
> read(4, "", 4096) = 0
> close(4) = 0
> write(3, "\20\0\4\0\10\0\0\0MULTIPLE", 16) = 16
> read(3, "\1e\30\0\0\0\0\0\23\1\0\0\0\0\0\0\0\0\0\0\0\0\0\0\224>"..., 32) = 32
> write(3, "\20\0\3\0\4\0\0\0INCR", 12) = 12
> read(3, "\1e\31\0\0\0\0\0\20\1\0\0\0\0\0\0\0\0\0\0\0\0\0\0\224>"..., 32) = 32
> write(3, "\20\0\4\0\7\0\0\0TARGETSE", 16) = 16
> read(3, "\1e\32\0\0\0\0\0\26\1\0\0\0\0\0\0\0\0\0\0\0\0\0\0\224>"..., 32) = 32
> write(3, "\20\0\5\0\t\0\0\0TIMESTAMP\0\0\0", 20) = 20
> read(3, "\1e\33\0\0\0\0\0\27\1\0\0\0\0\0\0\0\0\0\0\0\0\0\0\224>"..., 32) = 32
> write(3, "\20\0\3\0\4\0\0\0TEXT", 12) = 12
> read(3, "\1e\34\0\0\0\0\0\203\1\0\0\0\0\0\0\0\0\0\0\0\0\0\0\224"..., 32) = 32
> write(3, "\20\0\6\0\r\0\0\0COMPOUND_TEXT\31\0\0", 24) = 24
> read(3, "\1e\35\0\0\0\0\0\5\1\0\0\0\0\0\0\0\0\0\0\0\0\0\0\224>\0"..., 32) = 32
> write(3, "\20\0\5\0\t\0\0\0TK_WINDOWTEX", 20) = 20
> read(3, "\1e\36\0\0\0\0\0\204\1\0\0\0\0\0\0\0\0\0\0\0\0\0\0\224"..., 32) = 32
> write(3, "\20\0\5\0\t\0\0\0CLIPBOARDTEX", 20) = 20
> read(3, "\1e\37\0\0\0\0\0\16\1\0\0\0\0\0\0\0\0\0\0\0\0\0\0\224>"..., 32) = 32
> write(3, "\20\0\5\0\v\0\0\0UTF8_STRINGX", 20) = 20
> read(3, "\1e \0\0\0\0\0\347\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\224>\0"..., 32) = 32
> open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libXcursor.so.1", O_RDONLY) = -1 ENOENT (No such file or directory)
> open("/etc/ld.so.cache", O_RDONLY) = 4
> fstat64(0x4, 0xffb4795c) = 0
> mmap2(NULL, 183737, PROT_READ, MAP_PRIVATE, 4, 0) = 0xfffffffff7a74000
> close(4) = 0
> open("/usr/lib/libXcursor.so.1", O_RDONLY) = 4
> read(4, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0\300\0\311"..., 512) = 512
> fstat64(0x4, 0xffb479c0) = 0
> mmap2(0xc8e000, 39660, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 4, 0) = 0xc8e000
> mmap2(0xc97000, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 4, 0x8) = 0xc97000
> close(4) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libXrender.so.1", O_RDONLY) = -1 ENOENT (No such file or directory)
> open("/usr/lib/libXrender.so.1", O_RDONLY) = 4
> read(4, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0p\302\314"..., 512) = 512
> fstat64(0x4, 0xffb477c4) = 0
> mmap2(0xccb000, 33960, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 4, 0) = 0xccb000
> mmap2(0xcd3000, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 4, 0x7) = 0xcd3000
> close(4) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libXfixes.so.3", O_RDONLY) = -1 ENOENT (No such file or directory)
> open("/usr/lib/libXfixes.so.3", O_RDONLY) = 4
> read(4, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0 \36\20"..., 512) = 512
> fstat64(0x4, 0xffb477a8) = 0
> mmap2(0x101000, 18744, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 4, 0) = 0x101000
> mmap2(0x105000, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 4, 0x3) = 0x105000
> close(4) = 0
> munmap(0xf7a74000, 183737) = 0
> writev(3, [{"-\0\5\0\3\0\0\3\6\0F8cursorGXb\31\4\0\6\0AT", 28}, {"RENDER", 6}, {"\0\0", 2}], 3) = 36
> read(3, "\1e\"\0\0\0\0\0\1\231\0\263\0\0\0\0\0\0\0\0\0\0\0\0\250"..., 32) = 32
> write(3, "\231\0\3\0\0\0\0\0\n\0\0\0\231\1\1\0", 16) = 16
> read(3, "\1e#\0\0\0\0\0\0\0\0\0\n\0\0\0\0\0\0\0\0\0\0\0\250>\0\0"..., 32) = 32
> read(3, "\1\237$\0\265\0\0\0\26\0\0\0\1\0\0\0\7\0\0\0\5\0\0\0\1"..., 32) = 32
> read(3, "&\0\0\0\1\1\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\1\0\0\0\0\0"..., 724) = 724
> uname({sys="Linux", node="mkbpc86", ...}) = 0
> open("/home/kamini/.Xdefaults-mkbpc86", O_RDONLY) = -1 ENOENT (No such file or directory)
> writev(3, [{"b\0\6\0\17\0\0\0", 8}, {"XFree86-Bigfont", 15}, {"\0", 1}], 3) = 24
> read(3, "\1e%\0\0\0\0\0\1\230\0\0\0\0\0\0\0\0\0\0\0\0\0\0\250>\0"..., 32) = 32
> write(3, "\230\0\1\0", 4) = 4
> read(3, "\1\1&\0\0\0\0\0\1\0\1\0\0\0\0\0\0\0\0\0a+9\233\250>\0\0"..., 32) = 32
> write(3, "\230\1\3\0\3\0\0\3\1\0\0\0", 12) = 12
> read(3, "\1\0\'\0\263\1\0\0\361\377\0\0\n\0\377\377\0\0\0\0*\0*"..., 32) = 32
> read(3, "\20\0\0\0*\0*\0\0\0\231\0\0\0\t\0\0\0\0\1\20\0\21\0\232"..., 40) = 40
> read(3, "=\0\0\0\335\0\0\0;\0\0\0006\1\0\0\22\0\0\0\336\0\0\0:\0"..., 72) = 72
> read(3, "\372\377\10\0\21\0\6\0\10\0\0\0\371\377\t\0\21\0\7\0\t"..., 1628) = 1628
> write(3, "\20\0\4\0\6\0\0\3cursor\1\0", 16) = 16
> read(3, "\1e(\0\0\0\0\0\336\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\250>\0"..., 32) = 32
> open("/home/kamini/.icons/Bluecurve/cursors/xterm", O_RDONLY) = -1 ENOENT (No such file or directory)
> open("/home/kamini/.icons/Bluecurve/index.theme", O_RDONLY) = -1 ENOENT (No such file or directory)
> open("/usr/share/icons/Bluecurve/cursors/xterm", O_RDONLY) = 4
> fstat64(0x4, 0xffb47d7c) = 0
> mmap2(NULL, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_ANONYMOUS, -1, 0) = 0xfffffffff7aa0000
> read(4, "Xcur\20\0\0\0\0\0\1\0\3\0\0\0\2\0\375\377\30\0\0\0004\0"..., 4096) = 4096
> _llseek(4, 0, [0], SEEK_SET) = 0
> read(4, "Xcur\20\0\0\0\0\0\1\0\3\0\0\0\2\0\375\377\30\0\0\0004\0"..., 4096) = 4096
> close(4) = 0
> munmap(0xf7aa0000, 4096) = 0
> writev(3, [{"5 \4\0\4\0\0\3?\0\0\0\f\0\30\0007r\4\0\5\0\0\3\4\0\0\3"..., 1276}, {"XFIXES", 6}, {"\0\0", 2}], 3) = 1284
> read(3, "\1e1\0\0\0\0\0\1\227p\262\0\0\0\0\0\0\0\0\0\0\0\0\250>"..., 32) = 32
> write(3, "\227\0\3\0\4\0\0\0\0\0\0\0", 12) = 12
> read(3, "\1e2\0\0\0\0\0\4\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\250>\0\0"..., 32) = 32
> write(3, "\227\27\5\0\7\0\0\3\5\0\0\0xtermr\4\0007\0\5\0\10\0\0\3"..., 56) = 56
> read(3, "\1\0005\0\0\0\0\0\243\243\243\243\243\243\0\0\243\243\243"..., 32) = 32
> writev(3, [{"1\27\v\0\20\'\"\0", 8}, {"-*-Courier-*-*-*-*-*-*-*-*-*-*-*"..., 34}, {"\0\0", 2}], 3) = 44
> read(3, 0xffb47e4c, 32) = -1 EAGAIN (Resource temporarily unavailable)
> poll([{fd=3, events=POLLIN, revents=POLLIN}], 1, 4294967295) = 1
> read(3, "\1\0006\0H\10\0\0\220\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0"..., 32) = 32
> readv(3, [{"7-adobe-courier-bold-o-normal--8"..., 8480}, {"", 0}], 2) = 8480
> write(3, "-\27\22\0\t\0\0\3;\0\0\0-adobe-courier-mediu"..., 84) = 84
> read(3, 0xffb47d74, 32) = -1 EAGAIN (Resource temporarily unavailable)
> poll([{fd=3, events=POLLIN, revents=POLLIN}], 1, 4294967295) = 1
> read(3, "\1\0008\0\225\1\0\0\0\0\1\0\7\0\376\377\371\377\0\0\377"..., 32) = 32
> read(3, "\3\0\0\0\0\0\0\0\0\0\377\0\0\0\33\0\0\0\0\0\n\0\3\0\0\1"..., 40) = 40
> read(3, "\275\0\0\0\205\1\0\0@\0\0\0\206\1\0\0\276\0\0\0\325\0\0"..., 216) = 216
> read(3, "\0\0\7\0\7\0\7\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\1"..., 1364) = 1364
> write(3, "\21\27\2\0\217\1\0\0", 8) = 8
> read(3, "\1\0009\0\17\0\0\0;\0|\0\0\0\0\0\360e\356\261\377\177\0"..., 32) = 32
> readv(3, [{"-Adobe-Courier-Medium-R-Normal--"..., 59}, {"\0", 1}], 2) = 60
> write(3, "T\27\4\0 \0\0\0\0\0\0\0\0\0do", 16) = 16
> read(3, "\1\0:\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\377\177\0\0\300"..., 32) = 32
> write(3, "T\27\4\0 \0\0\0\0\377\0\377\0\377do", 16) = 16
> read(3, "\1\0;\0\0\0\0\0\377\377\377\377\377\377\0\0\377\377\377"..., 32) = 32
> write(3, "7\27\4\0\n\0\0\3?\0\0\0\0\0\0\0Te\4\0 \0\0\0\0U\0\230\0"..., 32) = 32
> read(3, "\1\0=\0\0\0\0\0UU\230\230\327\327\0\0\327\230U\0\377\177"..., 32) = 32
> writev(3, [{"7\27\5\0\v\0\0\3?\0\0\0\4\0\0\0\327\230U\0007\0\6\0\f\0"..., 96}, {"-*-Helvetica-*-*-*-*-*-*-*-*-*-*"..., 36}], 2) = 132
> read(3, "\1\244B\0\337\5\0\0`\0x\6\0\0\0\0`\244x\6\0\0\0\0x\244"..., 32) = 32
> readv(3, [{"9-adobe-helvetica-bold-o-normal-"..., 6012}, {"", 0}], 2) = 6012
> write(3, "-\27\22\0\17\0\0\3;\0\0\0-adobe-helvetica-bol"..., 84) = 84
> read(3, 0xffb47d54, 32) = -1 EAGAIN (Resource temporarily unavailable)
> poll([{fd=3, events=POLLIN, revents=POLLIN}], 1, 4294967295) = 1
> read(3, "\1\0D\0\335\1\0\0\377\377\1\0\3\0\376\377\370\377\0\0\0"..., 32) = 32
> read(3, "\3\0\0\0\0\0\0\0\0\0\377\0\0\0\33\0\0\0\0\0\v\0\3\0\0\1"..., 40) = 40
> read(3, "\275\0\0\0\205\1\0\0@\0\0\0\220\1\0\0\276\0\0\0\221\1\0"..., 216) = 216
> read(3, "\1\0\10\0\t\0\t\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\1"..., 1652) = 1652
> write(3, "\21\27\2\0\226\1\0\0", 8) = 8
> read(3, "\1\0E\0\17\0\0\0;\0|\0\0\0\0\0\360e\356\261\377\177\0\0"..., 32) = 32
> readv(3, [{"-Adobe-Helvetica-Bold-R-Normal--"..., 59}, {"\0", 1}], 2) = 60
> uname({sys="Linux", node="mkbpc86", ...}) = 0
> gettimeofday({1196950288, 828776}, {4294967176, 0}) = 0
> write(3, "7\27\7\0\20\0\0\3?\0\0\0\10@\1\0\343\351\355\0\17\0\0\3"..., 432) = 432
> read(3, "\1eX\0\0\0\0\0\351\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\274>\0"..., 32) = 32
> lstat64(0xffb46a20, 0xffb467bc) = 0
> lstat64(0xffb46a20, 0xffb467bc) = 0
> access("/home/kamini/.gaprc", F_OK) = -1 ENOENT (No such file or directory)
> getcwd("/home/kamini/STADEN", 4097) = 20
> lstat64(0xffb469f0, 0xffb4678c) = 0
> lstat64(0xffb469f0, 0xffb4678c) = 0
> lstat64(0xffb46a20, 0xffb467bc) = 0
> lstat64(0xffb46a20, 0xffb467bc) = 0
> lstat64(0xffb46a20, 0xffb467bc) = 0
> access("/home/kamini/STADEN/.gaprc", F_OK) = -1 ENOENT (No such file or directory)
> lstat64(0xffb46a20, 0xffb467bc) = 0
> lstat64(0xffb46a20, 0xffb467bc) = 0
> lstat64(0xffb46a20, 0xffb467bc) = 0
> lstat64(0xffb46a20, 0xffb467bc) = 0
> access("/usr/local/staden-linux-x86-1-7-0/tables/gaprc", F_OK) = 0
> stat64(0x80bf9f0, 0xffb47d90) = 0
> open("/usr/local/staden-linux-x86-1-7-0/tables/gaprc", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb47b38) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "#-------------------------------"..., 4096) = 4096
> read(4, "R.FONT_MB\t\t{-*-helvetica-*-r-*-*"..., 4096) = 4096
> read(4, "R.STATUS_FRAME2P\t0\nset_def CONTI"..., 4096) = 4096
> read(4, "set_def\tTEMPLATE.PLOT_HEIGHT\t\t40"..., 4096) = 4096
> read(4, "s of failures\"\nset_defx defs_for"..., 4096) = 4096
> read(4, "S.SAVENAME.NAME\t\"File name\"\nset_"..., 4096) = 4096
> read(4, "f AUTO_ASSEMBLE.MISMATCH.MIN\t0.0"..., 4096) = 4096
> read(4, "me\"\nset_def LOAD_LIST.LISTNAME\t\t"..., 4096) = 4096
> read(4, "E.NAME\t\t\"Trace filename\"\nset_def"..., 4096) = 4096
> brk(0x81b7000) = 0x81b7000
> brk(0x81af000) = 0x81af000
> read(4, "\n\nset_def FIND_PROBES.OLIGOSIZE."..., 4096) = 4096
> read(4, "IDTH\t100\nset_def R_ENZ.PLOT_HEIG"..., 4096) = 4096
> read(4, "verage\nset_def STRAND_COVERAGE.C"..., 4096) = 1945
> read(4, "", 4096) = 0
> close(4) = 0
> lstat64(0xffb452c0, 0xffb4505c) = 0
> lstat64(0xffb452c0, 0xffb4505c) = 0
> access("/home/kamini/.copy_readsrc", F_OK) = -1 ENOENT (No such file or directory)
> getcwd("/home/kamini/STADEN", 4097) = 20
> lstat64(0xffb45290, 0xffb4502c) = 0
> lstat64(0xffb45290, 0xffb4502c) = 0
> lstat64(0xffb452c0, 0xffb4505c) = 0
> lstat64(0xffb452c0, 0xffb4505c) = 0
> lstat64(0xffb452c0, 0xffb4505c) = 0
> access("/home/kamini/STADEN/.copy_readsrc", F_OK) = -1 ENOENT (No such file or directory)
> lstat64(0xffb452c0, 0xffb4505c) = 0
> lstat64(0xffb452c0, 0xffb4505c) = 0
> lstat64(0xffb452c0, 0xffb4505c) = 0
> lstat64(0xffb452c0, 0xffb4505c) = 0
> access("/usr/local/staden-linux-x86-1-7-0/tables/copy_readsrc", F_OK) = 0
> stat64(0x815c410, 0xffb46630) = 0
> open("/usr/local/staden-linux-x86-1-7-0/tables/copy_readsrc", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb463d8) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "#-------------------------------"..., 4096) = 2570
> read(4, "", 4096) = 0
> close(4) = 0
> lstat64(0xffb452c0, 0xffb4505c) = 0
> lstat64(0xffb452c0, 0xffb4505c) = 0
> lstat64(0xffb452c0, 0xffb4505c) = 0
> lstat64(0xffb452c0, 0xffb4505c) = 0
> access("/usr/local/staden-linux-x86-1-7-0/tables/copy_readsrc.local", F_OK) = -1 ENOENT (No such file or directory)
> lstat64(0xffb452c0, 0xffb4505c) = 0
> lstat64(0xffb452c0, 0xffb4505c) = 0
> access("/home/kamini/.copy_readsrc", F_OK) = -1 ENOENT (No such file or directory)
> lstat64(0xffb452c0, 0xffb4505c) = 0
> lstat64(0xffb452c0, 0xffb4505c) = 0
> access("/home/kamini/.copy_readsrc.local", F_OK) = -1 ENOENT (No such file or directory)
> getcwd("/home/kamini/STADEN", 4097) = 20
> lstat64(0xffb45290, 0xffb4502c) = 0
> lstat64(0xffb45290, 0xffb4502c) = 0
> lstat64(0xffb452c0, 0xffb4505c) = 0
> lstat64(0xffb452c0, 0xffb4505c) = 0
> lstat64(0xffb452c0, 0xffb4505c) = 0
> access("/home/kamini/STADEN/.copy_readsrc", F_OK) = -1 ENOENT (No such file or directory)
> getcwd("/home/kamini/STADEN", 4097) = 20
> lstat64(0xffb45290, 0xffb4502c) = 0
> lstat64(0xffb45290, 0xffb4502c) = 0
> lstat64(0xffb452c0, 0xffb4505c) = 0
> lstat64(0xffb452c0, 0xffb4505c) = 0
> lstat64(0xffb452c0, 0xffb4505c) = 0
> access("/home/kamini/STADEN/.copy_readsrc.local", F_OK) = -1 ENOENT (No such file or directory)
> getcwd("/home/kamini/STADEN", 4097) = 20
> lstat64(0xffb458e0, 0xffb4567c) = 0
> lstat64(0xffb458e0, 0xffb4567c) = 0
> lstat64(0xffb45910, 0xffb456ac) = 0
> lstat64(0xffb45910, 0xffb456ac) = 0
> lstat64(0xffb45910, 0xffb456ac) = 0
> open("/home/kamini/STADEN/libcopy_reads.so", O_RDONLY) = -1 ENOENT (No such file or directory)
> open("/usr/local/lib/tls/i686/sse2/libcopy_reads.so", O_RDONLY) = -1 ENOENT (No such file or directory)
> stat64(0xffb46270, 0xffb46300) = -1 ENOENT (No such file or directory)
> open("/usr/local/lib/tls/i686/libcopy_reads.so", O_RDONLY) = -1 ENOENT (No such file or directory)
> stat64(0xffb46270, 0xffb46300) = -1 ENOENT (No such file or directory)
> open("/usr/local/lib/tls/sse2/libcopy_reads.so", O_RDONLY) = -1 ENOENT (No such file or directory)
> stat64(0xffb46270, 0xffb46300) = -1 ENOENT (No such file or directory)
> open("/usr/local/lib/tls/libcopy_reads.so", O_RDONLY) = -1 ENOENT (No such file or directory)
> stat64(0xffb46270, 0xffb46300) = -1 ENOENT (No such file or directory)
> open("/usr/local/lib/i686/sse2/libcopy_reads.so", O_RDONLY) = -1 ENOENT (No such file or directory)
> stat64(0xffb46270, 0xffb46300) = -1 ENOENT (No such file or directory)
> open("/usr/local/lib/i686/libcopy_reads.so", O_RDONLY) = -1 ENOENT (No such file or directory)
> stat64(0xffb46270, 0xffb46300) = -1 ENOENT (No such file or directory)
> open("/usr/local/lib/sse2/libcopy_reads.so", O_RDONLY) = -1 ENOENT (No such file or directory)
> stat64(0xffb46270, 0xffb46300) = -1 ENOENT (No such file or directory)
> open("/usr/local/lib/libcopy_reads.so", O_RDONLY) = -1 ENOENT (No such file or directory)
> stat64(0xffb46270, 0xffb46300) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libcopy_reads.so", O_RDONLY) = 4
> read(4, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0P\33\0\000"..., 512) = 512
> fstat64(0x4, 0xffb462f0) = 0
> mmap2(NULL, 23076, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 4, 0) = 0xfffffffff7a9b000
> mmap2(0xf7aa0000, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 4, 0x4) = 0xfffffffff7aa0000
> close(4) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libseq_utils.so", O_RDONLY) = 4
> read(4, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0\220@\0"..., 512) = 512
> fstat64(0x4, 0xffb46068) = 0
> mmap2(NULL, 208800, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 4, 0) = 0xfffffffff7a68000
> mmap2(0xf7a86000, 12288, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 4, 0x1d) = 0xfffffffff7a86000
> mmap2(0xf7a89000, 73632, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_ANONYMOUS, -1, 0) = 0xfffffffff7a89000
> close(4) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libgap.so", O_RDONLY) = 4
> read(4, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0\300\271"..., 512) = 512
> fstat64(0x4, 0xffb46014) = 0
> mmap2(NULL, 2489824, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 4, 0) = 0xfffffffff7808000
> mmap2(0xf78e4000, 24576, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 4, 0xdb) = 0xfffffffff78e4000
> mmap2(0xf78ea000, 1564128, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_ANONYMOUS, -1, 0) = 0xfffffffff78ea000
> close(4) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libg2c.so.0", O_RDONLY) = -1 ENOENT (No such file or directory)
> open("/etc/ld.so.cache", O_RDONLY) = 4
> fstat64(0x4, 0xffb45f94) = 0
> mmap2(NULL, 183737, PROT_READ, MAP_PRIVATE, 4, 0) = 0xfffffffff7e1e000
> close(4) = 0
> open("/lib/i686/libg2c.so.0", O_RDONLY) = -1 ENOENT (No such file or directory)
> open("/lib/libg2c.so.0", O_RDONLY) = -1 ENOENT (No such file or directory)
> open("/usr/lib/sse2/libg2c.so.0", O_RDONLY) = -1 ENOENT (No such file or directory)
> open("/usr/lib/libg2c.so.0", O_RDONLY) = -1 ENOENT (No such file or directory)
> munmap(0xf7e1e000, 183737) = 0
> munmap(0xf7a9b000, 23076) = 0
> munmap(0xf7a68000, 208800) = 0
> munmap(0xf7808000, 2489824) = 0
> lstat64(0xffb44fd0, 0xffb44d6c) = 0
> lstat64(0xffb44fd0, 0xffb44d6c) = 0
> access("/home/kamini/.iwidgetsrc", F_OK) = -1 ENOENT (No such file or directory)
> getcwd("/home/kamini/STADEN", 4097) = 20
> lstat64(0xffb44fa0, 0xffb44d3c) = 0
> lstat64(0xffb44fa0, 0xffb44d3c) = 0
> lstat64(0xffb44fd0, 0xffb44d6c) = 0
> lstat64(0xffb44fd0, 0xffb44d6c) = 0
> lstat64(0xffb44fd0, 0xffb44d6c) = 0
> access("/home/kamini/STADEN/.iwidgetsrc", F_OK) = -1 ENOENT (No such file or directory)
> lstat64(0xffb44fd0, 0xffb44d6c) = 0
> lstat64(0xffb44fd0, 0xffb44d6c) = 0
> lstat64(0xffb44fd0, 0xffb44d6c) = 0
> lstat64(0xffb44fd0, 0xffb44d6c) = 0
> access("/usr/local/staden-linux-x86-1-7-0/tables/iwidgetsrc", F_OK) = 0
> stat64(0x817df30, 0xffb46340) = 0
> open("/usr/local/staden-linux-x86-1-7-0/tables/iwidgetsrc", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb460e8) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "set tcl_pkgPath \"\"\nif {\"$tcl_pla"..., 4096) = 428
> read(4, "", 4096) = 0
> close(4) = 0
> lstat64(0xffb43580, 0xffb4331c) = 0
> lstat64(0xffb43580, 0xffb4331c) = 0
> access("/home/kamini/.itcl3.3rc", F_OK) = -1 ENOENT (No such file or directory)
> getcwd("/home/kamini/STADEN", 4097) = 20
> lstat64(0xffb43550, 0xffb432ec) = 0
> lstat64(0xffb43550, 0xffb432ec) = 0
> lstat64(0xffb43580, 0xffb4331c) = 0
> lstat64(0xffb43580, 0xffb4331c) = 0
> lstat64(0xffb43580, 0xffb4331c) = 0
> access("/home/kamini/STADEN/.itcl3.3rc", F_OK) = -1 ENOENT (No such file or directory)
> lstat64(0xffb43580, 0xffb4331c) = 0
> lstat64(0xffb43580, 0xffb4331c) = 0
> lstat64(0xffb43580, 0xffb4331c) = 0
> lstat64(0xffb43580, 0xffb4331c) = 0
> access("/usr/local/staden-linux-x86-1-7-0/tables/itcl3.3rc", F_OK) = 0
> stat64(0x8179bb8, 0xffb448f0) = 0
> open("/usr/local/staden-linux-x86-1-7-0/tables/itcl3.3rc", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb44698) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "set env(ITCL_LIBRARY) $env(STADL"..., 4096) = 44
> read(4, "", 4096) = 0
> close(4) = 0
> lstat64(0xffb43580, 0xffb4331c) = 0
> lstat64(0xffb43580, 0xffb4331c) = 0
> lstat64(0xffb43580, 0xffb4331c) = 0
> lstat64(0xffb43580, 0xffb4331c) = 0
> access("/usr/local/staden-linux-x86-1-7-0/tables/itcl3.3rc.local", F_OK) = -1 ENOENT (No such file or directory)
> lstat64(0xffb43580, 0xffb4331c) = 0
> lstat64(0xffb43580, 0xffb4331c) = 0
> access("/home/kamini/.itcl3.3rc", F_OK) = -1 ENOENT (No such file or directory)
> lstat64(0xffb43580, 0xffb4331c) = 0
> lstat64(0xffb43580, 0xffb4331c) = 0
> access("/home/kamini/.itcl3.3rc.local", F_OK) = -1 ENOENT (No such file or directory)
> getcwd("/home/kamini/STADEN", 4097) = 20
> lstat64(0xffb43550, 0xffb432ec) = 0
> lstat64(0xffb43550, 0xffb432ec) = 0
> lstat64(0xffb43580, 0xffb4331c) = 0
> lstat64(0xffb43580, 0xffb4331c) = 0
> lstat64(0xffb43580, 0xffb4331c) = 0
> access("/home/kamini/STADEN/.itcl3.3rc", F_OK) = -1 ENOENT (No such file or directory)
> getcwd("/home/kamini/STADEN", 4097) = 20
> lstat64(0xffb43550, 0xffb432ec) = 0
> lstat64(0xffb43550, 0xffb432ec) = 0
> lstat64(0xffb43580, 0xffb4331c) = 0
> lstat64(0xffb43580, 0xffb4331c) = 0
> lstat64(0xffb43580, 0xffb4331c) = 0
> access("/home/kamini/STADEN/.itcl3.3rc.local", F_OK) = -1 ENOENT (No such file or directory)
> getcwd("/home/kamini/STADEN", 4097) = 20
> lstat64(0xffb43ba0, 0xffb4393c) = 0
> lstat64(0xffb43ba0, 0xffb4393c) = 0
> lstat64(0xffb43bd0, 0xffb4396c) = 0
> lstat64(0xffb43bd0, 0xffb4396c) = 0
> lstat64(0xffb43bd0, 0xffb4396c) = 0
> open("/home/kamini/STADEN/libitcl3.3.so", O_RDONLY) = -1 ENOENT (No such file or directory)
> open("/usr/local/lib/libitcl3.3.so", O_RDONLY) = -1 ENOENT (No such file or directory)
> open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libitcl3.3.so", O_RDONLY) = 4
> read(4, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0\340/\0"..., 512) = 512
> fstat64(0x4, 0xffb445b0) = 0
> mmap2(NULL, 98208, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 4, 0) = 0xfffffffff7e33000
> mmap2(0xf7e4a000, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 4, 0x17) = 0xfffffffff7e4a000
> close(4) = 0
> lstat64(0xffb42b90, 0xffb4292c) = 0
> lstat64(0xffb42b90, 0xffb4292c) = 0
> lstat64(0xffb42b90, 0xffb4292c) = 0
> lstat64(0xffb42b90, 0xffb4292c) = 0
> lstat64(0xffb42b90, 0xffb4292c) = 0
> stat64(0x818f730, 0xffb43d80) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/itcl3.3/itcl.tcl", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb43b28) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "#\n# itcl.tcl\n# -----------------"..., 4096) = 4096
> read(4, "--------------------------------"..., 4096) = 903
> read(4, "", 4096) = 0
> close(4) = 0
> lstat64(0xffb43580, 0xffb4331c) = 0
> lstat64(0xffb43580, 0xffb4331c) = 0
> access("/home/kamini/.itk3.3rc", F_OK) = -1 ENOENT (No such file or directory)
> getcwd("/home/kamini/STADEN", 4097) = 20
> lstat64(0xffb43550, 0xffb432ec) = 0
> lstat64(0xffb43550, 0xffb432ec) = 0
> lstat64(0xffb43580, 0xffb4331c) = 0
> lstat64(0xffb43580, 0xffb4331c) = 0
> lstat64(0xffb43580, 0xffb4331c) = 0
> access("/home/kamini/STADEN/.itk3.3rc", F_OK) = -1 ENOENT (No such file or directory)
> lstat64(0xffb43580, 0xffb4331c) = 0
> lstat64(0xffb43580, 0xffb4331c) = 0
> lstat64(0xffb43580, 0xffb4331c) = 0
> lstat64(0xffb43580, 0xffb4331c) = 0
> access("/usr/local/staden-linux-x86-1-7-0/tables/itk3.3rc", F_OK) = 0
> stat64(0x8190680, 0xffb448f0) = 0
> open("/usr/local/staden-linux-x86-1-7-0/tables/itk3.3rc", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb44698) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "set env(ITK_LIBRARY) $env(STADLI"..., 4096) = 42
> read(4, "", 4096) = 0
> close(4) = 0
> lstat64(0xffb43580, 0xffb4331c) = 0
> lstat64(0xffb43580, 0xffb4331c) = 0
> lstat64(0xffb43580, 0xffb4331c) = 0
> lstat64(0xffb43580, 0xffb4331c) = 0
> access("/usr/local/staden-linux-x86-1-7-0/tables/itk3.3rc.local", F_OK) = -1 ENOENT (No such file or directory)
> lstat64(0xffb43580, 0xffb4331c) = 0
> lstat64(0xffb43580, 0xffb4331c) = 0
> access("/home/kamini/.itk3.3rc", F_OK) = -1 ENOENT (No such file or directory)
> lstat64(0xffb43580, 0xffb4331c) = 0
> lstat64(0xffb43580, 0xffb4331c) = 0
> access("/home/kamini/.itk3.3rc.local", F_OK) = -1 ENOENT (No such file or directory)
> getcwd("/home/kamini/STADEN", 4097) = 20
> lstat64(0xffb43550, 0xffb432ec) = 0
> lstat64(0xffb43550, 0xffb432ec) = 0
> lstat64(0xffb43580, 0xffb4331c) = 0
> lstat64(0xffb43580, 0xffb4331c) = 0
> lstat64(0xffb43580, 0xffb4331c) = 0
> access("/home/kamini/STADEN/.itk3.3rc", F_OK) = -1 ENOENT (No such file or directory)
> getcwd("/home/kamini/STADEN", 4097) = 20
> lstat64(0xffb43550, 0xffb432ec) = 0
> lstat64(0xffb43550, 0xffb432ec) = 0
> lstat64(0xffb43580, 0xffb4331c) = 0
> lstat64(0xffb43580, 0xffb4331c) = 0
> lstat64(0xffb43580, 0xffb4331c) = 0
> access("/home/kamini/STADEN/.itk3.3rc.local", F_OK) = -1 ENOENT (No such file or directory)
> getcwd("/home/kamini/STADEN", 4097) = 20
> lstat64(0xffb43ba0, 0xffb4393c) = 0
> lstat64(0xffb43ba0, 0xffb4393c) = 0
> lstat64(0xffb43bd0, 0xffb4396c) = 0
> lstat64(0xffb43bd0, 0xffb4396c) = 0
> lstat64(0xffb43bd0, 0xffb4396c) = 0
> open("/home/kamini/STADEN/libitk3.3.so", O_RDONLY) = -1 ENOENT (No such file or directory)
> open("/usr/local/lib/libitk3.3.so", O_RDONLY) = -1 ENOENT (No such file or directory)
> open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libitk3.3.so", O_RDONLY) = 4
> read(4, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0\240\16"..., 512) = 512
> fstat64(0x4, 0xffb445b0) = 0
> mmap2(NULL, 43696, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 4, 0) = 0xfffffffff7e28000
> mmap2(0xf7e32000, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 4, 0xa) = 0xfffffffff7e32000
> close(4) = 0
> lstat64(0xffb42b90, 0xffb4292c) = 0
> lstat64(0xffb42b90, 0xffb4292c) = 0
> lstat64(0xffb42b90, 0xffb4292c) = 0
> lstat64(0xffb42b90, 0xffb4292c) = 0
> lstat64(0xffb42b90, 0xffb4292c) = 0
> stat64(0x8190ad8, 0xffb43d80) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/itk3.3/itk.tcl", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb43b28) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "#\n# itk.tcl\n# ------------------"..., 4096) = 4096
> read(4, "lightcolor -highlightthickness\n "..., 4096) = 1206
> read(4, "", 4096) = 0
> close(4) = 0
> getcwd("/home/kamini/STADEN", 4097) = 20
> lstat64(0xffb43e90, 0xffb43c2c) = 0
> lstat64(0xffb43e90, 0xffb43c2c) = 0
> lstat64(0xffb43ec0, 0xffb43c5c) = 0
> lstat64(0xffb43ec0, 0xffb43c5c) = 0
> lstat64(0xffb43ec0, 0xffb43c5c) = 0
> open("/home/kamini/STADEN/libiwidgets.so", O_RDONLY) = -1 ENOENT (No such file or directory)
> open("/usr/local/lib/libiwidgets.so", O_RDONLY) = -1 ENOENT (No such file or directory)
> open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libiwidgets.so", O_RDONLY) = -1 ENOENT (No such file or directory)
> open("/etc/ld.so.cache", O_RDONLY) = 4
> fstat64(0x4, 0xffb4483c) = 0
> mmap2(NULL, 183737, PROT_READ, MAP_PRIVATE, 4, 0) = 0xfffffffff7a74000
> close(4) = 0
> open("/lib/i686/libiwidgets.so", O_RDONLY) = -1 ENOENT (No such file or directory)
> open("/lib/libiwidgets.so", O_RDONLY) = -1 ENOENT (No such file or directory)
> open("/usr/lib/sse2/libiwidgets.so", O_RDONLY) = -1 ENOENT (No such file or directory)
> open("/usr/lib/libiwidgets.so", O_RDONLY) = -1 ENOENT (No such file or directory)
> munmap(0xf7a74000, 183737) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/iwidgets/tclIndex", O_RDONLY|O_LARGEFILE) = -1 ENOENT (No such file or directory)
> lstat64(0xffb44140, 0xffb43edc) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/itk3.3/tclIndex", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb45118) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "# Tcl autoload index file, versi"..., 4096) = 578
> read(4, "", 4096) = 0
> close(4) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/itk3.3/tclIndex", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb45118) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "# Tcl autoload index file, versi"..., 4096) = 578
> read(4, "", 4096) = 0
> close(4) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/itcl3.3/tclIndex", O_RDONLY|O_LARGEFILE) = -1 ENOENT (No such file or directory)
> lstat64(0xffb44140, 0xffb43edc) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/iwidgets/tclIndex", O_RDONLY|O_LARGEFILE) = -1 ENOENT (No such file or directory)
> lstat64(0xffb44140, 0xffb43edc) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/tk_utils/tclIndex", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb45118) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "# Tcl autoload index file, versi"..., 4096) = 4096
> read(4, "_def) [list source [file join $d"..., 4096) = 4096
> read(4, "ndex(CheckFloatRange) [list sour"..., 4096) = 4096
> read(4, "ist source [file join $dir html_"..., 4096) = 4096
> read(4, "its) [list source [file join $di"..., 4096) = 4096
> read(4, " [list source [file join $dir ca"..., 4096) = 4096
> read(4, "yme_map.tcl]]\nset auto_index(Sel"..., 4096) = 4096
> read(4, "set auto_index(spBiolimsDialog_I"..., 4096) = 4096
> read(4, "index(::Widget::Xmclistbox::_bin"..., 4096) = 4096
> read(4, "extract_element_name) [list sour"..., 4096) = 4096
> read(4, "_element_different) [list source"..., 4096) = 1259
> read(4, "", 4096) = 0
> close(4) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/copy_reads/tclIndex", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb45118) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "# Tcl autoload index file, versi"..., 4096) = 1457
> read(4, "", 4096) = 0
> close(4) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/tk_utils/tclIndex", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb45118) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "# Tcl autoload index file, versi"..., 4096) = 4096
> read(4, "_def) [list source [file join $d"..., 4096) = 4096
> read(4, "ndex(CheckFloatRange) [list sour"..., 4096) = 4096
> read(4, "ist source [file join $dir html_"..., 4096) = 4096
> read(4, "its) [list source [file join $di"..., 4096) = 4096
> read(4, " [list source [file join $dir ca"..., 4096) = 4096
> read(4, "yme_map.tcl]]\nset auto_index(Sel"..., 4096) = 4096
> read(4, "set auto_index(spBiolimsDialog_I"..., 4096) = 4096
> read(4, "index(::Widget::Xmclistbox::_bin"..., 4096) = 4096
> read(4, "extract_element_name) [list sour"..., 4096) = 4096
> read(4, "_element_different) [list source"..., 4096) = 1259
> read(4, "", 4096) = 0
> close(4) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/gap/tclIndex", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb45118) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "# Tcl autoload index file, versi"..., 4096) = 4096
> read(4, "dex(popup_cs_contig_3) [list sou"..., 4096) = 4096
> read(4, "e join $dir list_proc.tcl]]\nset "..., 4096) = 4096
> read(4, "rce [file join $dir tag_editor.t"..., 4096) = 3803
> read(4, "", 4096) = 0
> close(4) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/tclIndex", O_RDONLY|O_LARGEFILE) = -1 ENOENT (No such file or directory)
> lstat64(0xffb44140, 0xffb43edc) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/tk_utils/tclIndex", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb45118) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "# Tcl autoload index file, versi"..., 4096) = 4096
> read(4, "_def) [list source [file join $d"..., 4096) = 4096
> read(4, "ndex(CheckFloatRange) [list sour"..., 4096) = 4096
> read(4, "ist source [file join $dir html_"..., 4096) = 4096
> read(4, "its) [list source [file join $di"..., 4096) = 4096
> read(4, " [list source [file join $dir ca"..., 4096) = 4096
> read(4, "yme_map.tcl]]\nset auto_index(Sel"..., 4096) = 4096
> read(4, "set auto_index(spBiolimsDialog_I"..., 4096) = 4096
> read(4, "index(::Widget::Xmclistbox::_bin"..., 4096) = 4096
> read(4, "extract_element_name) [list sour"..., 4096) = 4096
> brk(0x81e1000) = 0x81e1000
> brk(0x81d7000) = 0x81d7000
> read(4, "_element_different) [list source"..., 4096) = 1259
> read(4, "", 4096) = 0
> brk(0x81c5000) = 0x81c5000
> close(4) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/tk_utils/tclIndex", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb45118) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "# Tcl autoload index file, versi"..., 4096) = 4096
> read(4, "_def) [list source [file join $d"..., 4096) = 4096
> read(4, "ndex(CheckFloatRange) [list sour"..., 4096) = 4096
> read(4, "ist source [file join $dir html_"..., 4096) = 4096
> read(4, "its) [list source [file join $di"..., 4096) = 4096
> read(4, " [list source [file join $dir ca"..., 4096) = 4096
> read(4, "yme_map.tcl]]\nset auto_index(Sel"..., 4096) = 4096
> read(4, "set auto_index(spBiolimsDialog_I"..., 4096) = 4096
> read(4, "index(::Widget::Xmclistbox::_bin"..., 4096) = 4096
> read(4, "extract_element_name) [list sour"..., 4096) = 4096
> read(4, "_element_different) [list source"..., 4096) = 1259
> read(4, "", 4096) = 0
> close(4) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/tk/tclIndex", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb45118) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "# Tcl autoload index file, versi"..., 4096) = 4096
> read(4, "]]\nset auto_index(::tk::FocusGro"..., 4096) = 4096
> read(4, "::tk::MenuDownArrow) [list sourc"..., 4096) = 4096
> read(4, " [list source [file join $dir sp"..., 4096) = 4096
> read(4, "\nset auto_index(::tk::IconList_A"..., 4096) = 4096
> read(4, "_InterpFilter) [list source [fil"..., 4096) = 1730
> read(4, "", 4096) = 0
> close(4) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/tk_utils/tclIndex", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb45118) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "# Tcl autoload index file, versi"..., 4096) = 4096
> read(4, "_def) [list source [file join $d"..., 4096) = 4096
> read(4, "ndex(CheckFloatRange) [list sour"..., 4096) = 4096
> read(4, "ist source [file join $dir html_"..., 4096) = 4096
> read(4, "its) [list source [file join $di"..., 4096) = 4096
> read(4, " [list source [file join $dir ca"..., 4096) = 4096
> read(4, "yme_map.tcl]]\nset auto_index(Sel"..., 4096) = 4096
> read(4, "set auto_index(spBiolimsDialog_I"..., 4096) = 4096
> read(4, "index(::Widget::Xmclistbox::_bin"..., 4096) = 4096
> read(4, "extract_element_name) [list sour"..., 4096) = 4096
> read(4, "_element_different) [list source"..., 4096) = 1259
> read(4, "", 4096) = 0
> close(4) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> open("/usr/local/lib/tclIndex", O_RDONLY|O_LARGEFILE) = -1 ENOENT (No such file or directory)
> lstat64(0xffb44140, 0xffb43edc) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/tclIndex", O_RDONLY|O_LARGEFILE) = -1 ENOENT (No such file or directory)
> lstat64(0xffb44140, 0xffb43edc) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> lstat64(0xffb44140, 0xffb43edc) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/tcl/tclIndex", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb45118) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "# Tcl autoload index file, versi"..., 4096) = 4096
> read(4, ") [list source [file join $dir s"..., 4096) = 1913
> read(4, "", 4096) = 0
> close(4) = 0
> lstat64(0xffb44d10, 0xffb44aac) = 0
> lstat64(0xffb44d10, 0xffb44aac) = 0
> lstat64(0xffb44d10, 0xffb44aac) = 0
> lstat64(0xffb44d10, 0xffb44aac) = 0
> lstat64(0xffb44d10, 0xffb44aac) = 0
> stat64(0x816de28, 0xffb45f00) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/iwidgets/iwidgets.tcl", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb45ca8) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "#\n# iwidgets.tcl\n# -------------"..., 4096) = 1129
> read(4, "", 4096) = 0
> close(4) = 0
> lstat64(0xffb44fd0, 0xffb44d6c) = 0
> lstat64(0xffb44fd0, 0xffb44d6c) = 0
> lstat64(0xffb44fd0, 0xffb44d6c) = 0
> lstat64(0xffb44fd0, 0xffb44d6c) = 0
> access("/usr/local/staden-linux-x86-1-7-0/tables/iwidgetsrc.local", F_OK) = -1 ENOENT (No such file or directory)
> lstat64(0xffb44fd0, 0xffb44d6c) = 0
> lstat64(0xffb44fd0, 0xffb44d6c) = 0
> access("/home/kamini/.iwidgetsrc", F_OK) = -1 ENOENT (No such file or directory)
> lstat64(0xffb44fd0, 0xffb44d6c) = 0
> lstat64(0xffb44fd0, 0xffb44d6c) = 0
> access("/home/kamini/.iwidgetsrc.local", F_OK) = -1 ENOENT (No such file or directory)
> getcwd("/home/kamini/STADEN", 4097) = 20
> lstat64(0xffb44fa0, 0xffb44d3c) = 0
> lstat64(0xffb44fa0, 0xffb44d3c) = 0
> lstat64(0xffb44fd0, 0xffb44d6c) = 0
> lstat64(0xffb44fd0, 0xffb44d6c) = 0
> lstat64(0xffb44fd0, 0xffb44d6c) = 0
> access("/home/kamini/STADEN/.iwidgetsrc", F_OK) = -1 ENOENT (No such file or directory)
> getcwd("/home/kamini/STADEN", 4097) = 20
> lstat64(0xffb44fa0, 0xffb44d3c) = 0
> lstat64(0xffb44fa0, 0xffb44d3c) = 0
> lstat64(0xffb44fd0, 0xffb44d6c) = 0
> lstat64(0xffb44fd0, 0xffb44d6c) = 0
> lstat64(0xffb44fd0, 0xffb44d6c) = 0
> access("/home/kamini/STADEN/.iwidgetsrc.local", F_OK) = -1 ENOENT (No such file or directory)
> lstat64(0xffb45e00, 0xffb45b9c) = 0
> lstat64(0xffb45e00, 0xffb45b9c) = 0
> lstat64(0xffb45e00, 0xffb45b9c) = 0
> lstat64(0xffb45e00, 0xffb45b9c) = 0
> access("/usr/local/staden-linux-x86-1-7-0/tables/gaprc_menu_full", F_OK) = 0
> stat64(0x81bd710, 0xffb47170) = 0
> open("/usr/local/staden-linux-x86-1-7-0/tables/gaprc_menu_full", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb46f18) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "#-------------------------------"..., 4096) = 4096
> read(4, "6 {NClip \\$io} e\nadd_command\t{Ed"..., 4096) = 4096
> read(4, "Search template names} 12 6 {Sea"..., 4096) = 4096
> read(4, "Commands.S4}\nadd_command\t{Comman"..., 4096) = 4096
> read(4, "lay.Embed traces size 4} 1 0 \\\n\t"..., 4096) = 4096
> brk(0x81ec000) = 0x81ec000
> brk(0x81e8000) = 0x81e8000
> read(4, " {Editor-Quality Values}}\nadd_co"..., 4096) = 4096
> read(4, "StartShutdown $io $f}\nadd_comman"..., 4096) = 3075
> read(4, "", 4096) = 0
> close(4) = 0
> brk(0x8209000) = 0x8209000
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> access("/home/kamini/.cap2rc", F_OK) = -1 ENOENT (No such file or directory)
> getcwd("/home/kamini/STADEN", 4097) = 20
> lstat64(0xffb45540, 0xffb452dc) = 0
> lstat64(0xffb45540, 0xffb452dc) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> access("/home/kamini/STADEN/.cap2rc", F_OK) = -1 ENOENT (No such file or directory)
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> access("/usr/local/staden-linux-x86-1-7-0/lib/cap2/cap2rc", F_OK) = -1 ENOENT (No such file or directory)
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> access("/usr/local/staden-linux-x86-1-7-0/lib/cap2/cap2rc.local", F_OK) = -1 ENOENT (No such file or directory)
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> access("/usr/local/staden-linux-x86-1-7-0/tables/cap2rc", F_OK) = 0
> stat64(0x81c0d18, 0xffb468e0) = 0
> open("/usr/local/staden-linux-x86-1-7-0/tables/cap2rc", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb46688) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "load_package %L/cap2\t{}\tcap2\t0\n\n"..., 4096) = 2186
> read(4, "", 4096) = 0
> close(4) = 0
> getcwd("/home/kamini/STADEN", 4097) = 20
> lstat64(0xffb44920, 0xffb446bc) = 0
> lstat64(0xffb44920, 0xffb446bc) = 0
> lstat64(0xffb44950, 0xffb446ec) = 0
> lstat64(0xffb44950, 0xffb446ec) = 0
> lstat64(0xffb44950, 0xffb446ec) = 0
> access("/home/kamini/STADEN/libcap2.so", F_OK) = -1 ENOENT (No such file or directory)
> pipe([4, 5]) = 0
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> fcntl64(5, F_SETFD, FD_CLOEXEC) = 0
> gettimeofday({1196950289, 111551}, NULL) = 0
> getpid() = 3541
> open("/tmp/tclIM1Muc", O_RDWR|O_CREAT|O_EXCL, 0600) = 6
> fcntl64(6, F_SETFD, FD_CLOEXEC) = 0
> unlink("/tmp/tclIM1Muc") = 0
> pipe([7, 8]) = 0
> fcntl64(7, F_SETFD, FD_CLOEXEC) = 0
> fcntl64(8, F_SETFD, FD_CLOEXEC) = 0
> clone(child_stack=0, flags=CLONE_CHILD_CLEARTID|CLONE_CHILD_SETTID|SIGCHLD, child_tidptr=0) = 3542
> --- SIGCHLD (Child exited) @ 0 (0) ---
> close(8) = 0
> read(7, "2couldn\'t execute \"cap2_s\": ", 223) = 28
> waitpid(3542, [{WIFEXITED(s) && WEXITSTATUS(s) == 1}], 0) = 3542
> close(7) = 0
> close(4) = 0
> close(6) = 0
> close(5) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> access("/usr/local/staden-linux-x86-1-7-0/tables/cap2rc.local", F_OK) = -1 ENOENT (No such file or directory)
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> access("/home/kamini/.cap2rc", F_OK) = -1 ENOENT (No such file or directory)
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> access("/home/kamini/.cap2rc.local", F_OK) = -1 ENOENT (No such file or directory)
> getcwd("/home/kamini/STADEN", 4097) = 20
> lstat64(0xffb45540, 0xffb452dc) = 0
> lstat64(0xffb45540, 0xffb452dc) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> access("/home/kamini/STADEN/.cap2rc", F_OK) = -1 ENOENT (No such file or directory)
> getcwd("/home/kamini/STADEN", 4097) = 20
> lstat64(0xffb45540, 0xffb452dc) = 0
> lstat64(0xffb45540, 0xffb452dc) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> access("/home/kamini/STADEN/.cap2rc.local", F_OK) = -1 ENOENT (No such file or directory)
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> access("/home/kamini/.cap3rc", F_OK) = -1 ENOENT (No such file or directory)
> getcwd("/home/kamini/STADEN", 4097) = 20
> lstat64(0xffb45540, 0xffb452dc) = 0
> lstat64(0xffb45540, 0xffb452dc) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> access("/home/kamini/STADEN/.cap3rc", F_OK) = -1 ENOENT (No such file or directory)
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> access("/usr/local/staden-linux-x86-1-7-0/lib/cap3/cap3rc", F_OK) = -1 ENOENT (No such file or directory)
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> access("/usr/local/staden-linux-x86-1-7-0/lib/cap3/cap3rc.local", F_OK) = -1 ENOENT (No such file or directory)
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> access("/usr/local/staden-linux-x86-1-7-0/tables/cap3rc", F_OK) = 0
> stat64(0x81c09c0, 0xffb468e0) = 0
> open("/usr/local/staden-linux-x86-1-7-0/tables/cap3rc", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb46688) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "load_package %L/cap3\t{}\tcap3\t0\n\n"..., 4096) = 4096
> read(4, "VALUE\t4\nset_def HUANG_ASSEMBLY.M"..., 4096) = 332
> read(4, "", 4096) = 0
> close(4) = 0
> getcwd("/home/kamini/STADEN", 4097) = 20
> lstat64(0xffb44920, 0xffb446bc) = 0
> lstat64(0xffb44920, 0xffb446bc) = 0
> lstat64(0xffb44950, 0xffb446ec) = 0
> lstat64(0xffb44950, 0xffb446ec) = 0
> lstat64(0xffb44950, 0xffb446ec) = 0
> access("/home/kamini/STADEN/libcap3.so", F_OK) = -1 ENOENT (No such file or directory)
> pipe([4, 5]) = 0
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> fcntl64(5, F_SETFD, FD_CLOEXEC) = 0
> open("/tmp/tclkL51F5", O_RDWR|O_CREAT|O_EXCL, 0600) = 6
> fcntl64(6, F_SETFD, FD_CLOEXEC) = 0
> unlink("/tmp/tclkL51F5") = 0
> pipe([7, 8]) = 0
> fcntl64(7, F_SETFD, FD_CLOEXEC) = 0
> fcntl64(8, F_SETFD, FD_CLOEXEC) = 0
> clone(child_stack=0, flags=CLONE_CHILD_CLEARTID|CLONE_CHILD_SETTID|SIGCHLD, child_tidptr=0) = 3543
> --- SIGCHLD (Child exited) @ 0 (0) ---
> close(8) = 0
> read(7, "2couldn\'t execute \"cap3_s\": ", 223) = 28
> waitpid(3543, [{WIFEXITED(s) && WEXITSTATUS(s) == 1}], 0) = 3543
> close(7) = 0
> close(4) = 0
> close(6) = 0
> close(5) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> access("/usr/local/staden-linux-x86-1-7-0/tables/cap3rc.local", F_OK) = -1 ENOENT (No such file or directory)
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> access("/home/kamini/.cap3rc", F_OK) = -1 ENOENT (No such file or directory)
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> access("/home/kamini/.cap3rc.local", F_OK) = -1 ENOENT (No such file or directory)
> getcwd("/home/kamini/STADEN", 4097) = 20
> lstat64(0xffb45540, 0xffb452dc) = 0
> lstat64(0xffb45540, 0xffb452dc) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> access("/home/kamini/STADEN/.cap3rc", F_OK) = -1 ENOENT (No such file or directory)
> getcwd("/home/kamini/STADEN", 4097) = 20
> lstat64(0xffb45540, 0xffb452dc) = 0
> lstat64(0xffb45540, 0xffb452dc) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> access("/home/kamini/STADEN/.cap3rc.local", F_OK) = -1 ENOENT (No such file or directory)
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> access("/home/kamini/.fak2rc", F_OK) = -1 ENOENT (No such file or directory)
> getcwd("/home/kamini/STADEN", 4097) = 20
> lstat64(0xffb45540, 0xffb452dc) = 0
> lstat64(0xffb45540, 0xffb452dc) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> access("/home/kamini/STADEN/.fak2rc", F_OK) = -1 ENOENT (No such file or directory)
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> access("/usr/local/staden-linux-x86-1-7-0/lib/fak2/fak2rc", F_OK) = -1 ENOENT (No such file or directory)
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> access("/usr/local/staden-linux-x86-1-7-0/lib/fak2/fak2rc.local", F_OK) = -1 ENOENT (No such file or directory)
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> access("/usr/local/staden-linux-x86-1-7-0/tables/fak2rc", F_OK) = 0
> stat64(0x81c0be0, 0xffb468e0) = 0
> open("/usr/local/staden-linux-x86-1-7-0/tables/fak2rc", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb46688) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "load_package %L/fak2\t{}\tfak2\t0\n\n"..., 4096) = 4096
> read(4, "AK2_ASSEMBLY.IMPORT.C_NUM.VALUE\t"..., 4096) = 34
> read(4, "", 4096) = 0
> close(4) = 0
> getcwd("/home/kamini/STADEN", 4097) = 20
> lstat64(0xffb44920, 0xffb446bc) = 0
> lstat64(0xffb44920, 0xffb446bc) = 0
> lstat64(0xffb44950, 0xffb446ec) = 0
> lstat64(0xffb44950, 0xffb446ec) = 0
> lstat64(0xffb44950, 0xffb446ec) = 0
> access("/home/kamini/STADEN/libfak2.so", F_OK) = -1 ENOENT (No such file or directory)
> pipe([4, 5]) = 0
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> fcntl64(5, F_SETFD, FD_CLOEXEC) = 0
> open("/tmp/tclajzASY", O_RDWR|O_CREAT|O_EXCL, 0600) = 6
> fcntl64(6, F_SETFD, FD_CLOEXEC) = 0
> unlink("/tmp/tclajzASY") = 0
> pipe([7, 8]) = 0
> fcntl64(7, F_SETFD, FD_CLOEXEC) = 0
> fcntl64(8, F_SETFD, FD_CLOEXEC) = 0
> clone(child_stack=0, flags=CLONE_CHILD_CLEARTID|CLONE_CHILD_SETTID|SIGCHLD, child_tidptr=0) = 3544
> --- SIGCHLD (Child exited) @ 0 (0) ---
> close(8) = 0
> read(7, "2couldn\'t execute \"write_exp_fil"..., 223) = 36
> waitpid(3544, [{WIFEXITED(s) && WEXITSTATUS(s) == 1}], 0) = 3544
> close(7) = 0
> close(4) = 0
> close(6) = 0
> close(5) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> access("/usr/local/staden-linux-x86-1-7-0/tables/fak2rc.local", F_OK) = -1 ENOENT (No such file or directory)
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> access("/home/kamini/.fak2rc", F_OK) = -1 ENOENT (No such file or directory)
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> access("/home/kamini/.fak2rc.local", F_OK) = -1 ENOENT (No such file or directory)
> getcwd("/home/kamini/STADEN", 4097) = 20
> lstat64(0xffb45540, 0xffb452dc) = 0
> lstat64(0xffb45540, 0xffb452dc) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> access("/home/kamini/STADEN/.fak2rc", F_OK) = -1 ENOENT (No such file or directory)
> getcwd("/home/kamini/STADEN", 4097) = 20
> lstat64(0xffb45540, 0xffb452dc) = 0
> lstat64(0xffb45540, 0xffb452dc) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> access("/home/kamini/STADEN/.fak2rc.local", F_OK) = -1 ENOENT (No such file or directory)
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> access("/home/kamini/.phraprc", F_OK) = -1 ENOENT (No such file or directory)
> getcwd("/home/kamini/STADEN", 4097) = 20
> lstat64(0xffb45540, 0xffb452dc) = 0
> lstat64(0xffb45540, 0xffb452dc) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> access("/home/kamini/STADEN/.phraprc", F_OK) = -1 ENOENT (No such file or directory)
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> access("/usr/local/staden-linux-x86-1-7-0/lib/phrap/phraprc", F_OK) = -1 ENOENT (No such file or directory)
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> access("/usr/local/staden-linux-x86-1-7-0/lib/phrap/phraprc.local", F_OK) = -1 ENOENT (No such file or directory)
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> access("/usr/local/staden-linux-x86-1-7-0/tables/phraprc", F_OK) = 0
> stat64(0x81c0968, 0xffb468e0) = 0
> open("/usr/local/staden-linux-x86-1-7-0/tables/phraprc", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb46688) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "# Phrap Gap4 module\n\n# Menu spec"..., 4096) = 1145
> read(4, "", 4096) = 0
> close(4) = 0
> pipe([4, 5]) = 0
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> fcntl64(5, F_SETFD, FD_CLOEXEC) = 0
> open("/tmp/tclI4Rl6R", O_RDWR|O_CREAT|O_EXCL, 0600) = 6
> fcntl64(6, F_SETFD, FD_CLOEXEC) = 0
> unlink("/tmp/tclI4Rl6R") = 0
> pipe([7, 8]) = 0
> fcntl64(7, F_SETFD, FD_CLOEXEC) = 0
> fcntl64(8, F_SETFD, FD_CLOEXEC) = 0
> clone(child_stack=0, flags=CLONE_CHILD_CLEARTID|CLONE_CHILD_SETTID|SIGCHLD, child_tidptr=0) = 3545
> --- SIGCHLD (Child exited) @ 0 (0) ---
> close(8) = 0
> read(7, "2couldn\'t execute \"gcphrap\": ", 223) = 29
> waitpid(3545, [{WIFEXITED(s) && WEXITSTATUS(s) == 1}], 0) = 3545
> close(7) = 0
> close(4) = 0
> close(6) = 0
> close(5) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> access("/usr/local/staden-linux-x86-1-7-0/tables/phraprc.local", F_OK) = -1 ENOENT (No such file or directory)
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> access("/home/kamini/.phraprc", F_OK) = -1 ENOENT (No such file or directory)
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> access("/home/kamini/.phraprc.local", F_OK) = -1 ENOENT (No such file or directory)
> getcwd("/home/kamini/STADEN", 4097) = 20
> lstat64(0xffb45540, 0xffb452dc) = 0
> lstat64(0xffb45540, 0xffb452dc) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> access("/home/kamini/STADEN/.phraprc", F_OK) = -1 ENOENT (No such file or directory)
> getcwd("/home/kamini/STADEN", 4097) = 20
> lstat64(0xffb45540, 0xffb452dc) = 0
> lstat64(0xffb45540, 0xffb452dc) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> lstat64(0xffb45570, 0xffb4530c) = 0
> access("/home/kamini/STADEN/.phraprc.local", F_OK) = -1 ENOENT (No such file or directory)
> getcwd("/home/kamini/STADEN", 4097) = 20
> lstat64(0xffb45ae0, 0xffb4587c) = 0
> lstat64(0xffb45ae0, 0xffb4587c) = 0
> lstat64(0xffb45b10, 0xffb458ac) = 0
> lstat64(0xffb45b10, 0xffb458ac) = 0
> lstat64(0xffb45b10, 0xffb458ac) = 0
> access("/home/kamini/STADEN/libphrap.so", F_OK) = -1 ENOENT (No such file or directory)
> lstat64(0xffb452c0, 0xffb4505c) = 0
> lstat64(0xffb452c0, 0xffb4505c) = 0
> access("/home/kamini/.haplorc", F_OK) = -1 ENOENT (No such file or directory)
> getcwd("/home/kamini/STADEN", 4097) = 20
> lstat64(0xffb45290, 0xffb4502c) = 0
> lstat64(0xffb45290, 0xffb4502c) = 0
> lstat64(0xffb452c0, 0xffb4505c) = 0
> lstat64(0xffb452c0, 0xffb4505c) = 0
> lstat64(0xffb452c0, 0xffb4505c) = 0
> access("/home/kamini/STADEN/.haplorc", F_OK) = -1 ENOENT (No such file or directory)
> lstat64(0xffb452c0, 0xffb4505c) = 0
> lstat64(0xffb452c0, 0xffb4505c) = 0
> lstat64(0xffb452c0, 0xffb4505c) = 0
> lstat64(0xffb452c0, 0xffb4505c) = 0
> access("/usr/local/staden-linux-x86-1-7-0/tables/haplorc", F_OK) = 0
> stat64(0x81c09b0, 0xffb46630) = 0
> open("/usr/local/staden-linux-x86-1-7-0/tables/haplorc", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb463d8) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "set_menu gap_menu\nadd_command {V"..., 4096) = 331
> read(4, "", 4096) = 0
> close(4) = 0
> lstat64(0xffb452c0, 0xffb4505c) = 0
> lstat64(0xffb452c0, 0xffb4505c) = 0
> lstat64(0xffb452c0, 0xffb4505c) = 0
> lstat64(0xffb452c0, 0xffb4505c) = 0
> access("/usr/local/staden-linux-x86-1-7-0/tables/haplorc.local", F_OK) = -1 ENOENT (No such file or directory)
> lstat64(0xffb452c0, 0xffb4505c) = 0
> lstat64(0xffb452c0, 0xffb4505c) = 0
> access("/home/kamini/.haplorc", F_OK) = -1 ENOENT (No such file or directory)
> lstat64(0xffb452c0, 0xffb4505c) = 0
> lstat64(0xffb452c0, 0xffb4505c) = 0
> access("/home/kamini/.haplorc.local", F_OK) = -1 ENOENT (No such file or directory)
> getcwd("/home/kamini/STADEN", 4097) = 20
> lstat64(0xffb45290, 0xffb4502c) = 0
> lstat64(0xffb45290, 0xffb4502c) = 0
> lstat64(0xffb452c0, 0xffb4505c) = 0
> lstat64(0xffb452c0, 0xffb4505c) = 0
> lstat64(0xffb452c0, 0xffb4505c) = 0
> access("/home/kamini/STADEN/.haplorc", F_OK) = -1 ENOENT (No such file or directory)
> getcwd("/home/kamini/STADEN", 4097) = 20
> lstat64(0xffb45290, 0xffb4502c) = 0
> lstat64(0xffb45290, 0xffb4502c) = 0
> lstat64(0xffb452c0, 0xffb4505c) = 0
> lstat64(0xffb452c0, 0xffb4505c) = 0
> lstat64(0xffb452c0, 0xffb4505c) = 0
> access("/home/kamini/STADEN/.haplorc.local", F_OK) = -1 ENOENT (No such file or directory)
> getcwd("/home/kamini/STADEN", 4097) = 20
> lstat64(0xffb458e0, 0xffb4567c) = 0
> lstat64(0xffb458e0, 0xffb4567c) = 0
> lstat64(0xffb45910, 0xffb456ac) = 0
> lstat64(0xffb45910, 0xffb456ac) = 0
> lstat64(0xffb45910, 0xffb456ac) = 0
> open("/home/kamini/STADEN/libhaplo.so", O_RDONLY) = -1 ENOENT (No such file or directory)
> open("/usr/local/lib/libhaplo.so", O_RDONLY) = -1 ENOENT (No such file or directory)
> open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libhaplo.so", O_RDONLY) = 4
> read(4, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0\200 \0"..., 512) = 512
> fstat64(0x4, 0xffb462f0) = 0
> mmap2(NULL, 32472, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 4, 0) = 0xfffffffff7e20000
> mmap2(0xf7e27000, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 4, 0x6) = 0xfffffffff7e27000
> close(4) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libgap.so", O_RDONLY) = 4
> read(4, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0\300\271"..., 512) = 512
> fstat64(0x4, 0xffb4604c) = 0
> mmap2(NULL, 2489824, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 4, 0) = 0xfffffffff7841000
> mmap2(0xf791d000, 24576, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 4, 0xdb) = 0xfffffffff791d000
> mmap2(0xf7923000, 1564128, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_ANONYMOUS, -1, 0) = 0xfffffffff7923000
> close(4) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libseq_utils.so", O_RDONLY) = 4
> read(4, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0\220@\0"..., 512) = 512
> fstat64(0x4, 0xffb45ec8) = 0
> mmap2(NULL, 208800, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 4, 0) = 0xfffffffff780e000
> mmap2(0xf782c000, 12288, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 4, 0x1d) = 0xfffffffff782c000
> mmap2(0xf782f000, 73632, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_ANONYMOUS, -1, 0) = 0xfffffffff782f000
> close(4) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libg.so", O_RDONLY) = 4
> read(4, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0\0\36\0"..., 512) = 512
> fstat64(0x4, 0xffb45eac) = 0
> mmap2(NULL, 43824, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 4, 0) = 0xfffffffff7803000
> mmap2(0xf780d000, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 4, 0x9) = 0xfffffffff780d000
> close(4) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libmutlib.so", O_RDONLY) = 4
> read(4, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0P\272\0"..., 512) = 512
> fstat64(0x4, 0xffb45e90) = 0
> mmap2(NULL, 169568, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 4, 0) = 0xfffffffff77d9000
> mmap2(0xf7800000, 8192, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 4, 0x26) = 0xfffffffff7800000
> mmap2(0xf7802000, 1632, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_ANONYMOUS, -1, 0) = 0xfffffffff7802000
> close(4) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libprimer3.so", O_RDONLY) = 4
> read(4, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0\320\25"..., 512) = 512
> fstat64(0x4, 0xffb45e74) = 0
> mmap2(NULL, 120136, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 4, 0) = 0xfffffffff77bb000
> mmap2(0xf77d3000, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 4, 0x18) = 0xfffffffff77d3000
> mmap2(0xf77d4000, 17736, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_ANONYMOUS, -1, 0) = 0xfffffffff77d4000
> close(4) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libg2c.so.0", O_RDONLY) = -1 ENOENT (No such file or directory)
> open("/etc/ld.so.cache", O_RDONLY) = 4
> fstat64(0x4, 0xffb45df4) = 0
> mmap2(NULL, 183737, PROT_READ, MAP_PRIVATE, 4, 0) = 0xfffffffff778e000
> close(4) = 0
> open("/lib/i686/libg2c.so.0", O_RDONLY) = -1 ENOENT (No such file or directory)
> open("/lib/libg2c.so.0", O_RDONLY) = -1 ENOENT (No such file or directory)
> open("/usr/lib/sse2/libg2c.so.0", O_RDONLY) = -1 ENOENT (No such file or directory)
> open("/usr/lib/libg2c.so.0", O_RDONLY) = -1 ENOENT (No such file or directory)
> munmap(0xf778e000, 183737) = 0
> munmap(0xf7e20000, 32472) = 0
> munmap(0xf7841000, 2489824) = 0
> munmap(0xf780e000, 208800) = 0
> munmap(0xf7803000, 43824) = 0
> munmap(0xf77d9000, 169568) = 0
> munmap(0xf77bb000, 120136) = 0
> lstat64(0xffb46a20, 0xffb467bc) = 0
> lstat64(0xffb46a20, 0xffb467bc) = 0
> lstat64(0xffb46a20, 0xffb467bc) = 0
> lstat64(0xffb46a20, 0xffb467bc) = 0
> access("/usr/local/staden-linux-x86-1-7-0/tables/gaprc.local", F_OK) = -1 ENOENT (No such file or directory)
> lstat64(0xffb46a20, 0xffb467bc) = 0
> lstat64(0xffb46a20, 0xffb467bc) = 0
> access("/home/kamini/.gaprc", F_OK) = -1 ENOENT (No such file or directory)
> lstat64(0xffb46a20, 0xffb467bc) = 0
> lstat64(0xffb46a20, 0xffb467bc) = 0
> access("/home/kamini/.gaprc.local", F_OK) = -1 ENOENT (No such file or directory)
> getcwd("/home/kamini/STADEN", 4097) = 20
> lstat64(0xffb469f0, 0xffb4678c) = 0
> lstat64(0xffb469f0, 0xffb4678c) = 0
> lstat64(0xffb46a20, 0xffb467bc) = 0
> lstat64(0xffb46a20, 0xffb467bc) = 0
> lstat64(0xffb46a20, 0xffb467bc) = 0
> access("/home/kamini/STADEN/.gaprc", F_OK) = -1 ENOENT (No such file or directory)
> getcwd("/home/kamini/STADEN", 4097) = 20
> lstat64(0xffb469f0, 0xffb4678c) = 0
> lstat64(0xffb469f0, 0xffb4678c) = 0
> lstat64(0xffb46a20, 0xffb467bc) = 0
> lstat64(0xffb46a20, 0xffb467bc) = 0
> lstat64(0xffb46a20, 0xffb467bc) = 0
> access("/home/kamini/STADEN/.gaprc.local", F_OK) = -1 ENOENT (No such file or directory)
> getcwd("/home/kamini/STADEN", 4097) = 20
> lstat64(0xffb47040, 0xffb46ddc) = 0
> lstat64(0xffb47040, 0xffb46ddc) = 0
> lstat64(0xffb47070, 0xffb46e0c) = 0
> lstat64(0xffb47070, 0xffb46e0c) = 0
> lstat64(0xffb47070, 0xffb46e0c) = 0
> open("/home/kamini/STADEN/libgap.so", O_RDONLY) = -1 ENOENT (No such file or directory)
> open("/usr/local/lib/libgap.so", O_RDONLY) = -1 ENOENT (No such file or directory)
> open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libgap.so", O_RDONLY) = 4
> read(4, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0\300\271"..., 512) = 512
> fstat64(0x4, 0xffb47a50) = 0
> mmap2(NULL, 2489824, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 4, 0) = 0xfffffffff7841000
> mmap2(0xf791d000, 24576, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 4, 0xdb) = 0xfffffffff791d000
> mmap2(0xf7923000, 1564128, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_ANONYMOUS, -1, 0) = 0xfffffffff7923000
> close(4) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libseq_utils.so", O_RDONLY) = 4
> read(4, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0\220@\0"..., 512) = 512
> fstat64(0x4, 0xffb47838) = 0
> mmap2(NULL, 208800, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 4, 0) = 0xfffffffff780e000
> mmap2(0xf782c000, 12288, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 4, 0x1d) = 0xfffffffff782c000
> mmap2(0xf782f000, 73632, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_ANONYMOUS, -1, 0) = 0xfffffffff782f000
> close(4) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libg.so", O_RDONLY) = 4
> read(4, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0\0\36\0"..., 512) = 512
> fstat64(0x4, 0xffb47790) = 0
> mmap2(NULL, 43824, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 4, 0) = 0xfffffffff7803000
> mmap2(0xf780d000, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 4, 0x9) = 0xfffffffff780d000
> close(4) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libmutlib.so", O_RDONLY) = 4
> read(4, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0P\272\0"..., 512) = 512
> fstat64(0x4, 0xffb47774) = 0
> mmap2(NULL, 169568, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 4, 0) = 0xfffffffff77d9000
> mmap2(0xf7800000, 8192, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 4, 0x26) = 0xfffffffff7800000
> mmap2(0xf7802000, 1632, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_ANONYMOUS, -1, 0) = 0xfffffffff7802000
> close(4) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libprimer3.so", O_RDONLY) = 4
> read(4, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0\320\25"..., 512) = 512
> fstat64(0x4, 0xffb4773c) = 0
> mmap2(NULL, 120136, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 4, 0) = 0xfffffffff77bb000
> mmap2(0xf77d3000, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 4, 0x18) = 0xfffffffff77d3000
> mmap2(0xf77d4000, 17736, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_ANONYMOUS, -1, 0) = 0xfffffffff77d4000
> close(4) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libg2c.so.0", O_RDONLY) = -1 ENOENT (No such file or directory)
> open("/etc/ld.so.cache", O_RDONLY) = 4
> fstat64(0x4, 0xffb476bc) = 0
> mmap2(NULL, 183737, PROT_READ, MAP_PRIVATE, 4, 0) = 0xfffffffff778e000
> close(4) = 0
> open("/lib/i686/libg2c.so.0", O_RDONLY) = -1 ENOENT (No such file or directory)
> open("/lib/libg2c.so.0", O_RDONLY) = -1 ENOENT (No such file or directory)
> open("/usr/lib/sse2/libg2c.so.0", O_RDONLY) = -1 ENOENT (No such file or directory)
> open("/usr/lib/libg2c.so.0", O_RDONLY) = -1 ENOENT (No such file or directory)
> munmap(0xf778e000, 183737) = 0
> munmap(0xf7841000, 2489824) = 0
> munmap(0xf780e000, 208800) = 0
> munmap(0xf7803000, 43824) = 0
> munmap(0xf77d9000, 169568) = 0
> munmap(0xf77bb000, 120136) = 0
> brk(0x822b000) = 0x822b000
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/haplo/tclIndex", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb47e98) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "# Tcl autoload index file, versi"..., 4096) = 359
> read(4, "", 4096) = 0
> close(4) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/phrap/tclIndex", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb47e98) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "# Tcl autoload index file, versi"..., 4096) = 364
> read(4, "", 4096) = 0
> close(4) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/fak2/tclIndex", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb47e98) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "# Tcl autoload index file, versi"..., 4096) = 380
> read(4, "", 4096) = 0
> close(4) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/fak2/tclIndex", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb47e98) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "# Tcl autoload index file, versi"..., 4096) = 380
> read(4, "", 4096) = 0
> close(4) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/cap3/tclIndex", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb47e98) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "# Tcl autoload index file, versi"..., 4096) = 329
> read(4, "", 4096) = 0
> close(4) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/cap3/tclIndex", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb47e98) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "# Tcl autoload index file, versi"..., 4096) = 329
> read(4, "", 4096) = 0
> close(4) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/cap2/tclIndex", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb47e98) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "# Tcl autoload index file, versi"..., 4096) = 325
> read(4, "", 4096) = 0
> close(4) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/cap2/tclIndex", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb47e98) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "# Tcl autoload index file, versi"..., 4096) = 325
> read(4, "", 4096) = 0
> close(4) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/iwidgets/scripts/tclIndex", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb47e98) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "# Tcl autoload index file, versi"..., 4096) = 4096
> read(4, "index(::iwidgets::Calendar::days"..., 4096) = 4096
> read(4, "ir canvasprintbox.itk]]\nset auto"..., 4096) = 4096
> read(4, "k]]\nset auto_index(::iwidgets::C"..., 4096) = 4096
> read(4, "o_index(::iwidgets::Combobox::_b"..., 4096) = 4096
> read(4, "e join $dir dialogshell.itk]]\nse"..., 4096) = 4096
> read(4, "_index(::iwidgets::Entryfield::c"..., 4096) = 4096
> read(4, "ileselectionbox::filetype) [list"..., 4096) = 4096
> read(4, "ack.itk]]\nset auto_index(::iwidg"..., 4096) = 4096
> read(4, "t source [file join $dir filesel"..., 4096) = 4096
> read(4, " [file join $dir hierarchy.itk]]"..., 4096) = 4096
> read(4, "et auto_index(::iwidgets::Hierar"..., 4096) = 4096
> read(4, "ource [file join $dir labeledwid"..., 4096) = 4096
> read(4, "ngth) [list source [file join $d"..., 4096) = 4096
> read(4, "\nset auto_index(tkMenuFind) [lis"..., 4096) = 4096
> read(4, "Page::command) [list source [fil"..., 4096) = 4096
> read(4, "ile join $dir panedwindow.itk]]\n"..., 4096) = 4096
> read(4, "auto_index(::iwidgets::Pushbutto"..., 4096) = 4096
> mmap2(NULL, 139264, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_ANONYMOUS, -1, 0) = 0xfffffffff7a7f000
> read(4, "dgets::Regexpfield::index) [list"..., 4096) = 4096
> read(4, "gets::Scrolledcanvas::type) [lis"..., 4096) = 4096
> read(4, "dhtml::_entity_a) [list source ["..., 4096) = 4096
> read(4, "ex(::iwidgets::Scrolledhtml::_en"..., 4096) = 4096
> read(4, "set auto_index(::iwidgets::Scrol"..., 4096) = 4096
> read(4, "urce [file join $dir scrolledlis"..., 4096) = 4096
> read(4, "o_index(::iwidgets::Scrolledwidg"..., 4096) = 4096
> read(4, "le join $dir selectiondialog.itk"..., 4096) = 4096
> read(4, " [file join $dir spinner.itk]]\ns"..., 4096) = 4096
> read(4, "t source [file join $dir tabnote"..., 4096) = 4096
> read(4, "in $dir tabset.itk]]\nset auto_in"..., 4096) = 4096
> read(4, "ate) [list source [file join $di"..., 4096) = 4096
> read(4, ":_popup) [list source [file join"..., 4096) = 4096
> read(4, " toolbar.itk]]\nset auto_index(::"..., 4096) = 3945
> read(4, "", 4096) = 0
> brk(0x824c000) = 0x824c000
> brk(0x826d000) = 0x826d000
> munmap(0xf7a7f000, 139264) = 0
> close(4) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = -1 ENOENT (No such file or directory)
> access("/usr", F_OK) = 0
> access("/usr/local", F_OK) = 0
> access("/usr/local/staden-linux-x86-1-7-0", F_OK) = 0
> access("/usr/local/staden-linux-x86-1-7-0/lib", F_OK) = 0
> access("/usr/local/staden-linux-x86-1-7-0/lib/iwidgets", F_OK) = 0
> access("/usr/local/staden-linux-x86-1-7-0/lib/iwidgets/generic", F_OK) = -1 ENOENT (No such file or directory)
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/iwidgets/generic/tclIndex", O_RDONLY|O_LARGEFILE) = -1 ENOENT (No such file or directory)
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/iwidgets/tclIndex", O_RDONLY|O_LARGEFILE) = -1 ENOENT (No such file or directory)
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/iwidgets/tclIndex", O_RDONLY|O_LARGEFILE) = -1 ENOENT (No such file or directory)
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/itk3.3/tclIndex", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb47e98) = -1 ENOTTY (Inappropriate ioctl for device)
> brk(0x828e000) = 0x828e000
> read(4, "# Tcl autoload index file, versi"..., 4096) = 578
> read(4, "", 4096) = 0
> close(4) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/itk3.3/tclIndex", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb47e98) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "# Tcl autoload index file, versi"..., 4096) = 578
> read(4, "", 4096) = 0
> close(4) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/itcl3.3/tclIndex", O_RDONLY|O_LARGEFILE) = -1 ENOENT (No such file or directory)
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/iwidgets/tclIndex", O_RDONLY|O_LARGEFILE) = -1 ENOENT (No such file or directory)
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/tk_utils/tclIndex", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb47e98) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "# Tcl autoload index file, versi"..., 4096) = 4096
> read(4, "_def) [list source [file join $d"..., 4096) = 4096
> read(4, "ndex(CheckFloatRange) [list sour"..., 4096) = 4096
> read(4, "ist source [file join $dir html_"..., 4096) = 4096
> read(4, "its) [list source [file join $di"..., 4096) = 4096
> read(4, " [list source [file join $dir ca"..., 4096) = 4096
> read(4, "yme_map.tcl]]\nset auto_index(Sel"..., 4096) = 4096
> read(4, "set auto_index(spBiolimsDialog_I"..., 4096) = 4096
> read(4, "index(::Widget::Xmclistbox::_bin"..., 4096) = 4096
> read(4, "extract_element_name) [list sour"..., 4096) = 4096
> read(4, "_element_different) [list source"..., 4096) = 1259
> read(4, "", 4096) = 0
> close(4) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/copy_reads/tclIndex", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb47e98) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "# Tcl autoload index file, versi"..., 4096) = 1457
> read(4, "", 4096) = 0
> close(4) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/tk_utils/tclIndex", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb47e98) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "# Tcl autoload index file, versi"..., 4096) = 4096
> read(4, "_def) [list source [file join $d"..., 4096) = 4096
> read(4, "ndex(CheckFloatRange) [list sour"..., 4096) = 4096
> read(4, "ist source [file join $dir html_"..., 4096) = 4096
> read(4, "its) [list source [file join $di"..., 4096) = 4096
> read(4, " [list source [file join $dir ca"..., 4096) = 4096
> read(4, "yme_map.tcl]]\nset auto_index(Sel"..., 4096) = 4096
> read(4, "set auto_index(spBiolimsDialog_I"..., 4096) = 4096
> read(4, "index(::Widget::Xmclistbox::_bin"..., 4096) = 4096
> read(4, "extract_element_name) [list sour"..., 4096) = 4096
> read(4, "_element_different) [list source"..., 4096) = 1259
> read(4, "", 4096) = 0
> close(4) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/gap/tclIndex", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb47e98) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "# Tcl autoload index file, versi"..., 4096) = 4096
> read(4, "dex(popup_cs_contig_3) [list sou"..., 4096) = 4096
> read(4, "e join $dir list_proc.tcl]]\nset "..., 4096) = 4096
> read(4, "rce [file join $dir tag_editor.t"..., 4096) = 3803
> read(4, "", 4096) = 0
> close(4) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/tclIndex", O_RDONLY|O_LARGEFILE) = -1 ENOENT (No such file or directory)
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/tk_utils/tclIndex", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb47e98) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "# Tcl autoload index file, versi"..., 4096) = 4096
> read(4, "_def) [list source [file join $d"..., 4096) = 4096
> read(4, "ndex(CheckFloatRange) [list sour"..., 4096) = 4096
> read(4, "ist source [file join $dir html_"..., 4096) = 4096
> read(4, "its) [list source [file join $di"..., 4096) = 4096
> read(4, " [list source [file join $dir ca"..., 4096) = 4096
> read(4, "yme_map.tcl]]\nset auto_index(Sel"..., 4096) = 4096
> read(4, "set auto_index(spBiolimsDialog_I"..., 4096) = 4096
> read(4, "index(::Widget::Xmclistbox::_bin"..., 4096) = 4096
> read(4, "extract_element_name) [list sour"..., 4096) = 4096
> read(4, "_element_different) [list source"..., 4096) = 1259
> read(4, "", 4096) = 0
> close(4) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/tk_utils/tclIndex", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb47e98) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "# Tcl autoload index file, versi"..., 4096) = 4096
> read(4, "_def) [list source [file join $d"..., 4096) = 4096
> read(4, "ndex(CheckFloatRange) [list sour"..., 4096) = 4096
> read(4, "ist source [file join $dir html_"..., 4096) = 4096
> read(4, "its) [list source [file join $di"..., 4096) = 4096
> read(4, " [list source [file join $dir ca"..., 4096) = 4096
> read(4, "yme_map.tcl]]\nset auto_index(Sel"..., 4096) = 4096
> read(4, "set auto_index(spBiolimsDialog_I"..., 4096) = 4096
> read(4, "index(::Widget::Xmclistbox::_bin"..., 4096) = 4096
> read(4, "extract_element_name) [list sour"..., 4096) = 4096
> read(4, "_element_different) [list source"..., 4096) = 1259
> read(4, "", 4096) = 0
> close(4) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/tk/tclIndex", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb47e98) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "# Tcl autoload index file, versi"..., 4096) = 4096
> read(4, "]]\nset auto_index(::tk::FocusGro"..., 4096) = 4096
> read(4, "::tk::MenuDownArrow) [list sourc"..., 4096) = 4096
> read(4, " [list source [file join $dir sp"..., 4096) = 4096
> read(4, "\nset auto_index(::tk::IconList_A"..., 4096) = 4096
> read(4, "_InterpFilter) [list source [fil"..., 4096) = 1730
> read(4, "", 4096) = 0
> close(4) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/tk_utils/tclIndex", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb47e98) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "# Tcl autoload index file, versi"..., 4096) = 4096
> read(4, "_def) [list source [file join $d"..., 4096) = 4096
> read(4, "ndex(CheckFloatRange) [list sour"..., 4096) = 4096
> read(4, "ist source [file join $dir html_"..., 4096) = 4096
> read(4, "its) [list source [file join $di"..., 4096) = 4096
> read(4, " [list source [file join $dir ca"..., 4096) = 4096
> read(4, "yme_map.tcl]]\nset auto_index(Sel"..., 4096) = 4096
> read(4, "set auto_index(spBiolimsDialog_I"..., 4096) = 4096
> read(4, "index(::Widget::Xmclistbox::_bin"..., 4096) = 4096
> read(4, "extract_element_name) [list sour"..., 4096) = 4096
> read(4, "_element_different) [list source"..., 4096) = 1259
> read(4, "", 4096) = 0
> close(4) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> open("/usr/local/lib/tclIndex", O_RDONLY|O_LARGEFILE) = -1 ENOENT (No such file or directory)
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/tclIndex", O_RDONLY|O_LARGEFILE) = -1 ENOENT (No such file or directory)
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> lstat64(0xffb46ec0, 0xffb46c5c) = 0
> open("/usr/local/staden-linux-x86-1-7-0/lib/tcl/tclIndex", O_RDONLY|O_LARGEFILE) = 4
> fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
> ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb47e98) = -1 ENOTTY (Inappropriate ioctl for device)
> read(4, "# Tcl autoload index file, versi"..., 4096) = 4096
> read(4, ") [list source [file join $dir s"..., 4096) = 1913
> read(4, "", 4096) = 0
> close(4) = 0
> write(2, "invalid command name \"load_align"..., 211) = 211
> write(2, "\r\n", 2) = 2
> write(3, "\1\30\r\0\16\0\0\3\26\0\0\3\0\0\0\0\1\0\1\0\0\0\1\0\"\0"..., 224) = 224
> read(3, "\1\10i\0\4\0\0\0\37\0\0\0\0\0\0\0\20\0\0\0\0\0\0\0\263"..., 32) = 32
> readv(3, [{"3000001 gap.tcl\0", 16}, {"", 0}], 2) = 16
> write(3, "\22\0\6\0?\0\0\0\201\1\0\0\37\0\0\0\10\0\1\0\0\0\0\0%\0"..., 28) = 28
> write(3, "\22\0\6\0\1\0\0\3\202\1\0\0\37\0\0\0\10\0\1\0\0\0\0\0\4"..., 36) = 36
> read(3, "\34\0l\0\1\0\0\3\202\1\0\0\267\373\313\257\0\0\0\0\0\0"..., 32) = 32
> read(3, "\34\33m\0\1\0\0\3\202\1\0\0\267\373\313\257\1\0\0\0\0\0"..., 32) = 32
> read(3, "\1\2n\0\0\0\0\0\37\0\300\2\0\0\0\0\0\0\0\0\0\0\0\0 ?\0"..., 32) = 32
> write(3, "<\0\2\0\0\0\0\3+\1\1\0", 12) = 12
> read(3, "\1\2p\0\0\0\0\0\37\0\300\2\0\0\0\0\0\0\0\0\0\0\0\0 ?\0"..., 32) = 32
> shutdown(3, 2 /* send and receive */) = 0
> close(3) = 0
> fcntl64(2, F_GETFL) = 0x8002 (flags O_RDWR|O_LARGEFILE)
> fcntl64(2, F_SETFL, O_RDWR|O_LARGEFILE) = 0
> fcntl64(2, F_GETFL) = 0x8002 (flags O_RDWR|O_LARGEFILE)
> fcntl64(1, F_GETFL) = 0x8002 (flags O_RDWR|O_LARGEFILE)
> fcntl64(1, F_SETFL, O_RDWR|O_LARGEFILE) = 0
> fcntl64(1, F_GETFL) = 0x8002 (flags O_RDWR|O_LARGEFILE)
> fcntl64(0, F_GETFL) = 0x8002 (flags O_RDWR|O_LARGEFILE)
> fcntl64(0, F_SETFL, O_RDWR|O_LARGEFILE) = 0
> fcntl64(0, F_GETFL) = 0x8002 (flags O_RDWR|O_LARGEFILE)
> exit_group(1) = ?

> _______________________________________________
> Staden mailing list
> Staden@...
> http://www.bio.net/biomail/listinfo/staden

_______________________________________________
Staden mailing list
Staden@...
http://www.bio.net/biomail/listinfo/staden

Re: gap4 running problem load_alignment_matrix gap.tcl

2007-12-07T00:52:37Z

Hi
I have installed staden on one of my 64 bit machines with Centos5.
After some pain, it runs beautifully. Attempting installation on a
second machine (actually just copying the appropriate dierctory
containing the staden packege to the new machine) which is (supposed to
be) similar to the first one I get.

invalid command name "load_alignment_matrix"
while executing
"load_alignment_matrix [keylget gap_defs ALIGNMENT.MATRIX_FILE]"
(file "/usr/local/staden-linux-x86-1-7-0//lib/gap/gap.tcl" line
683)
Running in debug mode some libraries are identified as not loading but
they are there. Have followed the advice given in various forum pages,
including http://www.bio.net/bionet/mm/staden/2006-January/001358.html
doing strace -o output.txt gap4 as suggested, and looking at the
resulting file does not make sense to me. The file is attached. Can you
look at it and help, please. DerekLDerek Litthauer (PhD)
BioPAD Metagenomics Platform
Department of Microbial, Biochemical and Food Biotechnology
Faculty of Natural and Agricultural Sciences
Internal Postbox 61
University of the Free State
PO Box 339
Bloemfontein
SOUTH AFRICA
Tel: +27 51 4012122
Fax: +27 51 4443219
http://www.uovs.ac.za/biotech

_____________________________________________________________________

University of the Free State: This message and its contents are subject to a disclaimer.
Please refer to http://www.ufs.ac.za/disclaimer for full details.

Universiteit van die Vrystaat:
Hierdie boodskap en sy inhoud is aan 'n vrywaringsklousule onderhewig.
Volledige besonderhede is by http://www.ufs.ac.za/vrywaring beskikbaar.
_____________________________________________________________________

execve("/usr/local/staden-linux-x86-1-7-0//linux-bin/gap4", ["gap4"], [/* 53 vars */]) = 0
brk(0) = 0x1935a000
mmap(NULL, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_ANONYMOUS, -1, 0) = 0x2aaaaaaab000
uname({sys="Linux", node="mkbpc86", ...}) = 0
access("/etc/ld.so.preload", R_OK) = -1 ENOENT (No such file or directory)
open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/tls/x86_64/libtermcap.so.2", O_RDONLY) = -1 ENOENT (No such file or directory)
stat("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/tls/x86_64", 0x7fffdf82eec0) = -1 ENOENT (No such file or directory)
open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/tls/libtermcap.so.2", O_RDONLY) = -1 ENOENT (No such file or directory)
stat("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/tls", 0x7fffdf82eec0) = -1 ENOENT (No such file or directory)
open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/x86_64/libtermcap.so.2", O_RDONLY) = -1 ENOENT (No such file or directory)
stat("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/x86_64", 0x7fffdf82eec0) = -1 ENOENT (No such file or directory)
open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libtermcap.so.2", O_RDONLY) = -1 ENOENT (No such file or directory)
stat("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries", {st_mode=S_IFDIR|0775, st_size=4096, ...}) = 0
open("/etc/ld.so.cache", O_RDONLY) = 3
fstat(3, {st_mode=S_IFREG|0644, st_size=183737, ...}) = 0
mmap(NULL, 183737, PROT_READ, MAP_PRIVATE, 3, 0) = 0x2aaaaaaac000
close(3) = 0
open("/lib64/libtermcap.so.2", O_RDONLY) = 3
read(3, "\177ELF\2\1\1\0\0\0\0\0\0\0\0\0\3\0>\0\1\0\0\0@\17\340"..., 832) = 832
fstat(3, {st_mode=S_IFREG|0755, st_size=15584, ...}) = 0
mmap(NULL, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_ANONYMOUS, -1, 0) = 0x2aaaaaad9000
mmap(0x35c3e00000, 2108688, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 3, 0) = 0x35c3e00000
mprotect(0x35c3e03000, 2093056, PROT_NONE) = 0
mmap(0x35c4002000, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 3, 0x2000) = 0x35c4002000
close(3) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libdl.so.2", O_RDONLY) = -1 ENOENT (No such file or directory)
open("/lib64/libdl.so.2", O_RDONLY) = 3
read(3, "\177ELF\2\1\1\0\0\0\0\0\0\0\0\0\3\0>\0\1\0\0\0 \16\340"..., 832) = 832
fstat(3, {st_mode=S_IFREG|0755, st_size=23520, ...}) = 0
mmap(0x35bee00000, 2109728, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 3, 0) = 0x35bee00000
mprotect(0x35bee02000, 2097152, PROT_NONE) = 0
mmap(0x35bf002000, 8192, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 3, 0x2000) = 0x35bf002000
close(3) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libc.so.6", O_RDONLY) = -1 ENOENT (No such file or directory)
open("/lib64/libc.so.6", O_RDONLY) = 3
read(3, "\177ELF\2\1\1\0\0\0\0\0\0\0\0\0\3\0>\0\1\0\0\0\240\331"..., 832) = 832
fstat(3, {st_mode=S_IFREG|0755, st_size=1678480, ...}) = 0
mmap(0x35be600000, 3461272, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 3, 0) = 0x35be600000
mprotect(0x35be744000, 2097152, PROT_NONE) = 0
mmap(0x35be944000, 20480, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 3, 0x144000) = 0x35be944000
mmap(0x35be949000, 16536, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_ANONYMOUS, -1, 0) = 0x35be949000
close(3) = 0
mmap(NULL, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_ANONYMOUS, -1, 0) = 0x2aaaaaada000
mmap(NULL, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_ANONYMOUS, -1, 0) = 0x2aaaaaadb000
arch_prctl(ARCH_SET_FS, 0x2aaaaaadadb0) = 0
mprotect(0x35bf002000, 4096, PROT_READ) = 0
mprotect(0x35be944000, 16384, PROT_READ) = 0
mprotect(0x35bd819000, 4096, PROT_READ) = 0
munmap(0x2aaaaaaac000, 183737) = 0
rt_sigprocmask(SIG_BLOCK, NULL, [], 8) = 0
open("/dev/tty", O_RDWR|O_NONBLOCK) = 3
close(3) = 0
brk(0) = 0x1935a000
brk(0x1937b000) = 0x1937b000
open("/usr/lib/locale/locale-archive", O_RDONLY) = 3
fstat(3, {st_mode=S_IFREG|0644, st_size=55574016, ...}) = 0
mmap(NULL, 55574016, PROT_READ, MAP_PRIVATE, 3, 0) = 0x2aaaaaadc000
close(3) = 0
getuid() = 500
getgid() = 500
geteuid() = 500
getegid() = 500
rt_sigprocmask(SIG_BLOCK, NULL, [], 8) = 0
time(NULL) = 1196950288
open("/proc/meminfo", O_RDONLY) = 3
fstat(3, {st_mode=S_IFREG|0444, st_size=0, ...}) = 0
mmap(NULL, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_ANONYMOUS, -1, 0) = 0x2aaaadfdc000
read(3, "MemTotal: 1926312 kB\nMemFre"..., 4096) = 682
close(3) = 0
munmap(0x2aaaadfdc000, 4096) = 0
rt_sigaction(SIGCHLD, {SIG_DFL}, {SIG_DFL}, 8) = 0
rt_sigaction(SIGCHLD, {SIG_DFL}, {SIG_DFL}, 8) = 0
rt_sigaction(SIGINT, {SIG_DFL}, {SIG_DFL}, 8) = 0
rt_sigaction(SIGINT, {SIG_DFL}, {SIG_DFL}, 8) = 0
rt_sigaction(SIGQUIT, {SIG_DFL}, {SIG_DFL}, 8) = 0
rt_sigaction(SIGQUIT, {SIG_DFL}, {SIG_DFL}, 8) = 0
rt_sigprocmask(SIG_BLOCK, NULL, [], 8) = 0
rt_sigaction(SIGQUIT, {SIG_IGN}, {SIG_DFL}, 8) = 0
uname({sys="Linux", node="mkbpc86", ...}) = 0
stat("/home/kamini/STADEN", {st_mode=S_IFDIR|0777, st_size=4096, ...}) = 0
stat(".", {st_mode=S_IFDIR|0777, st_size=4096, ...}) = 0
getpid() = 3541
open("/usr/lib64/gconv/gconv-modules.cache", O_RDONLY) = 3
fstat(3, {st_mode=S_IFREG|0644, st_size=25462, ...}) = 0
mmap(NULL, 25462, PROT_READ, MAP_SHARED, 3, 0) = 0x2aaaadfdc000
close(3) = 0
getppid() = 3540
getpgrp() = 3540
rt_sigaction(SIGCHLD, {0x4352d0, [], SA_RESTORER, 0x35be630070}, {SIG_DFL}, 8) = 0
rt_sigprocmask(SIG_BLOCK, NULL, [], 8) = 0
open("/usr/local/staden-linux-x86-1-7-0//linux-bin/gap4", O_RDONLY) = 3
ioctl(3, SNDCTL_TMR_TIMEBASE or TCGETS, 0x7fffdf82f6d0) = -1 ENOTTY (Inappropriate ioctl for device)
lseek(3, 0, SEEK_CUR) = 0
read(3, "#!/bin/sh\n\n# Finds the directory"..., 80) = 80
lseek(3, 0, SEEK_SET) = 0
getrlimit(RLIMIT_NOFILE, {rlim_cur=1024, rlim_max=1024}) = 0
dup2(3, 255) = 255
close(3) = 0
fcntl(255, F_SETFD, FD_CLOEXEC) = 0
fcntl(255, F_GETFL) = 0x8000 (flags O_RDONLY|O_LARGEFILE)
fstat(255, {st_mode=S_IFREG|0755, st_size=1751, ...}) = 0
lseek(255, 0, SEEK_CUR) = 0
rt_sigprocmask(SIG_BLOCK, NULL, [], 8) = 0
read(255, "#!/bin/sh\n\n# Finds the directory"..., 1751) = 1751
rt_sigprocmask(SIG_BLOCK, NULL, [], 8) = 0
rt_sigprocmask(SIG_BLOCK, NULL, [], 8) = 0
rt_sigprocmask(SIG_BLOCK, NULL, [], 8) = 0
rt_sigprocmask(SIG_BLOCK, NULL, [], 8) = 0
rt_sigprocmask(SIG_BLOCK, NULL, [], 8) = 0
rt_sigprocmask(SIG_BLOCK, NULL, [], 8) = 0
rt_sigprocmask(SIG_BLOCK, NULL, [], 8) = 0
rt_sigprocmask(SIG_BLOCK, NULL, [], 8) = 0
rt_sigprocmask(SIG_BLOCK, NULL, [], 8) = 0
rt_sigprocmask(SIG_SETMASK, [], NULL, 8) = 0
rt_sigprocmask(SIG_BLOCK, NULL, [], 8) = 0
rt_sigprocmask(SIG_BLOCK, NULL, [], 8) = 0
rt_sigprocmask(SIG_BLOCK, NULL, [], 8) = 0
rt_sigprocmask(SIG_BLOCK, NULL, [], 8) = 0
rt_sigprocmask(SIG_BLOCK, NULL, [], 8) = 0
stat(".", {st_mode=S_IFDIR|0777, st_size=4096, ...}) = 0
stat("/usr/local/staden-linux-x86-1-7-0//linux-bin/stash", {st_mode=S_IFREG|0755, st_size=199395, ...}) = 0
access("/usr/local/staden-linux-x86-1-7-0//linux-bin/stash", X_OK) = 0
access("/usr/local/staden-linux-x86-1-7-0//linux-bin/stash", R_OK) = 0
stat("/usr/local/staden-linux-x86-1-7-0//linux-bin/stash", {st_mode=S_IFREG|0755, st_size=199395, ...}) = 0
access("/usr/local/staden-linux-x86-1-7-0//linux-bin/stash", X_OK) = 0
access("/usr/local/staden-linux-x86-1-7-0//linux-bin/stash", R_OK) = 0
rt_sigaction(SIGINT, {SIG_DFL}, {SIG_DFL}, 8) = 0
rt_sigaction(SIGQUIT, {SIG_DFL}, {SIG_IGN}, 8) = 0
rt_sigaction(SIGCHLD, {SIG_DFL}, {0x4352d0, [], SA_RESTORER, 0x35be630070}, 8) = 0
execve("/usr/local/staden-linux-x86-1-7-0//linux-bin/stash", ["stash", "/usr/local/staden-linux-x86-1-7-"...], [/* 51 vars */]) = 0
brk(0) = 0x804a000
mmap2(NULL, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_ANONYMOUS, -1, 0) = 0xfffffffff7ffd000
access("/etc/ld.so.preload", R_OK) = -1 ENOENT (No such file or directory)
open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/tls/i686/sse2/libtk_utils.so", O_RDONLY) = -1 ENOENT (No such file or directory)
stat64(0xffb48da0, 0xffb48e28) = -1 ENOENT (No such file or directory)
open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/tls/i686/libtk_utils.so", O_RDONLY) = -1 ENOENT (No such file or directory)
stat64(0xffb48da0, 0xffb48e28) = -1 ENOENT (No such file or directory)
open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/tls/sse2/libtk_utils.so", O_RDONLY) = -1 ENOENT (No such file or directory)
stat64(0xffb48da0, 0xffb48e28) = -1 ENOENT (No such file or directory)
open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/tls/libtk_utils.so", O_RDONLY) = -1 ENOENT (No such file or directory)
stat64(0xffb48da0, 0xffb48e28) = -1 ENOENT (No such file or directory)
open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/i686/sse2/libtk_utils.so", O_RDONLY) = -1 ENOENT (No such file or directory)
stat64(0xffb48da0, 0xffb48e28) = -1 ENOENT (No such file or directory)
open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/i686/libtk_utils.so", O_RDONLY) = -1 ENOENT (No such file or directory)
stat64(0xffb48da0, 0xffb48e28) = -1 ENOENT (No such file or directory)
open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/sse2/libtk_utils.so", O_RDONLY) = -1 ENOENT (No such file or directory)
stat64(0xffb48da0, 0xffb48e28) = -1 ENOENT (No such file or directory)
open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libtk_utils.so", O_RDONLY) = 3
read(3, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0P\243\0"..., 512) = 512
fstat64(0x3, 0xffb48e18) = 0
mmap2(NULL, 262008, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 3, 0) = 0xfffffffff7fbd000
mmap2(0xf7ff4000, 12288, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 3, 0x36) = 0xfffffffff7ff4000
mmap2(0xf7ff7000, 24440, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_ANONYMOUS, -1, 0) = 0xfffffffff7ff7000
close(3) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libtk8.4.so", O_RDONLY) = 3
read(3, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0P]\1\000"..., 512) = 512
fstat64(0x3, 0xffb48dfc) = 0
mmap2(NULL, 844948, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 3, 0) = 0xfffffffff7eee000
mmap2(0xf7fb0000, 49152, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 3, 0xc1) = 0xfffffffff7fb0000
mmap2(0xf7fbc000, 1172, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_ANONYMOUS, -1, 0) = 0xfffffffff7fbc000
close(3) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libtcl8.4.so", O_RDONLY) = 3
read(3, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0\340:\1"..., 512) = 512
fstat64(0x3, 0xffb48de0) = 0
mmap2(NULL, 666228, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 3, 0) = 0xfffffffff7e4b000
mmap2(0xf7ee3000, 40960, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 3, 0x97) = 0xfffffffff7ee3000
mmap2(0xf7eed000, 2676, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_ANONYMOUS, -1, 0) = 0xfffffffff7eed000
close(3) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libm.so.6", O_RDONLY) = -1 ENOENT (No such file or directory)
open("/etc/ld.so.cache", O_RDONLY) = 3
fstat64(0x3, 0xffb48d60) = 0
mmap2(NULL, 183737, PROT_READ, MAP_PRIVATE, 3, 0) = 0xfffffffff7e1e000
close(3) = 0
open("/lib/libm.so.6", O_RDONLY) = 3
read(3, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0\20\24\263"..., 512) = 512
fstat64(0x3, 0xffb48dc4) = 0
mmap2(0xb2e000, 155776, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 3, 0) = 0xb2e000
mmap2(0xb53000, 8192, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 3, 0x24) = 0xb53000
close(3) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libX11.so.6", O_RDONLY) = -1 ENOENT (No such file or directory)
open("/usr/lib/libX11.so.6", O_RDONLY) = 3
read(3, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0pO\270\000"..., 512) = 512
fstat64(0x3, 0xffb48da8) = 0
mmap2(NULL, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_ANONYMOUS, -1, 0) = 0xfffffffff7e1d000
mmap2(0xb70000, 1060732, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 3, 0) = 0xb70000
mmap2(0xc6f000, 16384, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 3, 0xfe) = 0xc6f000
close(3) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libdl.so.2", O_RDONLY) = -1 ENOENT (No such file or directory)
open("/lib/libdl.so.2", O_RDONLY) = 3
read(3, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0PZ\307\000"..., 512) = 512
fstat64(0x3, 0xffb48d8c) = 0
mmap2(0xc75000, 12408, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 3, 0) = 0xc75000
mmap2(0xc77000, 8192, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 3, 0x1) = 0xc77000
close(3) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libc.so.6", O_RDONLY) = -1 ENOENT (No such file or directory)
open("/lib/libc.so.6", O_RDONLY) = 3
read(3, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0000O\240"..., 512) = 512
fstat64(0x3, 0xffb48d70) = 0
mmap2(0x9ef000, 1295780, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 3, 0) = 0x9ef000
mmap2(0xb26000, 12288, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 3, 0x137) = 0xb26000
mmap2(0xb29000, 9636, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_ANONYMOUS, -1, 0) = 0xb29000
close(3) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libread.so", O_RDONLY) = 3
read(3, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0 _\0\000"..., 512) = 512
fstat64(0x3, 0xffb48cc8) = 0
mmap2(NULL, 461472, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 3, 0) = 0xfffffffff7dac000
mmap2(0xf7dda000, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 3, 0x2e) = 0xfffffffff7dda000
mmap2(0xf7ddb000, 268960, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_ANONYMOUS, -1, 0) = 0xfffffffff7ddb000
close(3) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libmisc.so", O_RDONLY) = 3
read(3, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0`\'\0\000"..., 512) = 512
fstat64(0x3, 0xffb48cac) = 0
mmap2(NULL, 39940, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 3, 0) = 0xfffffffff7da2000
mmap2(0xf7da9000, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 3, 0x7) = 0xfffffffff7da9000
mmap2(0xf7daa000, 7172, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_ANONYMOUS, -1, 0) = 0xfffffffff7daa000
close(3) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libpng12.so.0", O_RDONLY) = 3
read(3, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0\220[\0"..., 512) = 512
fstat64(0x3, 0xffb48c90) = 0
mmap2(NULL, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_ANONYMOUS, -1, 0) = 0xfffffffff7da1000
mmap2(NULL, 199188, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 3, 0) = 0xfffffffff7d70000
mmap2(0xf7da0000, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 3, 0x2f) = 0xfffffffff7da0000
close(3) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libXau.so.6", O_RDONLY) = -1 ENOENT (No such file or directory)
open("/usr/lib/libXau.so.6", O_RDONLY) = 3
read(3, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0Pi\315\000"..., 512) = 512
fstat64(0x3, 0xffb48a58) = 0
mmap2(0xcd6000, 10788, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 3, 0) = 0xcd6000
mmap2(0xcd8000, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 3, 0x1) = 0xcd8000
close(3) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libXdmcp.so.6", O_RDONLY) = -1 ENOENT (No such file or directory)
open("/usr/lib/libXdmcp.so.6", O_RDONLY) = 3
read(3, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0000\276"..., 512) = 512
fstat64(0x3, 0xffb48a3c) = 0
mmap2(0xcdb000, 21460, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 3, 0) = 0xcdb000
mmap2(0xce0000, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 3, 0x4) = 0xce0000
close(3) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libcurl.so.3", O_RDONLY) = -1 ENOENT (No such file or directory)
open("/usr/lib/libcurl.so.3", O_RDONLY) = 3
read(3, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0\300x\0"..., 512) = 512
fstat64(0x3, 0xffb4887c) = 0
mmap2(NULL, 245372, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 3, 0) = 0xfffffffff7d34000
mmap2(0xf7d6f000, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 3, 0x3b) = 0xfffffffff7d6f000
close(3) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libidn.so.11", O_RDONLY) = -1 ENOENT (No such file or directory)
open("/usr/lib/libidn.so.11", O_RDONLY) = 3
read(3, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0\240,\\"..., 512) = 512
fstat64(0x3, 0xffb48860) = 0
mmap2(0x5c1000, 199952, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 3, 0) = 0x5c1000
mmap2(0x5f1000, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 3, 0x2f) = 0x5f1000
close(3) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libssl.so.0.9.7", O_RDONLY) = -1 ENOENT (No such file or directory)
open("/lib/tls/i686/sse2/libssl.so.0.9.7", O_RDONLY) = -1 ENOENT (No such file or directory)
stat64(0xffb487d0, 0xffb48854) = -1 ENOENT (No such file or directory)
open("/lib/tls/i686/libssl.so.0.9.7", O_RDONLY) = -1 ENOENT (No such file or directory)
stat64(0xffb487d0, 0xffb48854) = -1 ENOENT (No such file or directory)
open("/lib/tls/sse2/libssl.so.0.9.7", O_RDONLY) = -1 ENOENT (No such file or directory)
stat64(0xffb487d0, 0xffb48854) = -1 ENOENT (No such file or directory)
open("/lib/tls/libssl.so.0.9.7", O_RDONLY) = -1 ENOENT (No such file or directory)
stat64(0xffb487d0, 0xffb48854) = -1 ENOENT (No such file or directory)
open("/lib/i686/sse2/libssl.so.0.9.7", O_RDONLY) = -1 ENOENT (No such file or directory)
stat64(0xffb487d0, 0xffb48854) = -1 ENOENT (No such file or directory)
open("/lib/i686/libssl.so.0.9.7", O_RDONLY) = -1 ENOENT (No such file or directory)
stat64(0xffb487d0, 0xffb48854) = 0
open("/lib/sse2/libssl.so.0.9.7", O_RDONLY) = -1 ENOENT (No such file or directory)
stat64(0xffb487d0, 0xffb48854) = -1 ENOENT (No such file or directory)
open("/lib/libssl.so.0.9.7", O_RDONLY) = -1 ENOENT (No such file or directory)
stat64(0xffb487d0, 0xffb48854) = 0
open("/usr/lib/tls/i686/sse2/libssl.so.0.9.7", O_RDONLY) = -1 ENOENT (No such file or directory)
stat64(0xffb487d0, 0xffb48854) = -1 ENOENT (No such file or directory)
open("/usr/lib/tls/i686/libssl.so.0.9.7", O_RDONLY) = -1 ENOENT (No such file or directory)
stat64(0xffb487d0, 0xffb48854) = -1 ENOENT (No such file or directory)
open("/usr/lib/tls/sse2/libssl.so.0.9.7", O_RDONLY) = -1 ENOENT (No such file or directory)
stat64(0xffb487d0, 0xffb48854) = -1 ENOENT (No such file or directory)
open("/usr/lib/tls/libssl.so.0.9.7", O_RDONLY) = -1 ENOENT (No such file or directory)
stat64(0xffb487d0, 0xffb48854) = -1 ENOENT (No such file or directory)
open("/usr/lib/i686/sse2/libssl.so.0.9.7", O_RDONLY) = -1 ENOENT (No such file or directory)
stat64(0xffb487d0, 0xffb48854) = -1 ENOENT (No such file or directory)
open("/usr/lib/i686/libssl.so.0.9.7", O_RDONLY) = -1 ENOENT (No such file or directory)
stat64(0xffb487d0, 0xffb48854) = -1 ENOENT (No such file or directory)
open("/usr/lib/sse2/libssl.so.0.9.7", O_RDONLY) = -1 ENOENT (No such file or directory)
stat64(0xffb487d0, 0xffb48854) = 0
open("/usr/lib/libssl.so.0.9.7", O_RDONLY) = 3
read(3, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0\20\262"..., 512) = 512
fstat64(0x3, 0xffb48844) = 0
mmap2(NULL, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_ANONYMOUS, -1, 0) = 0xfffffffff7d33000
mmap2(0x1b0000, 281660, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 3, 0) = 0x1b0000
mmap2(0x1f1000, 16384, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 3, 0x40) = 0x1f1000
close(3) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libcrypto.so.0.9.7", O_RDONLY) = -1 ENOENT (No such file or directory)
open("/lib/i686/libcrypto.so.0.9.7", O_RDONLY) = -1 ENOENT (No such file or directory)
open("/lib/libcrypto.so.0.9.7", O_RDONLY) = -1 ENOENT (No such file or directory)
open("/usr/lib/sse2/libcrypto.so.0.9.7", O_RDONLY) = -1 ENOENT (No such file or directory)
open("/usr/lib/libcrypto.so.0.9.7", O_RDONLY) = 3
read(3, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0\300\300"..., 512) = 512
fstat64(0x3, 0xffb48828) = 0
mmap2(0x734b000, 1250008, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 3, 0) = 0x734b000
mmap2(0x7467000, 73728, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 3, 0x11c) = 0x7467000
mmap2(0x7479000, 13016, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_ANONYMOUS, -1, 0) = 0x7479000
close(3) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libgssapi_krb5.so.2", O_RDONLY) = -1 ENOENT (No such file or directory)
open("/usr/lib/libgssapi_krb5.so.2", O_RDONLY) = 3
read(3, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0\360\314"..., 512) = 512
fstat64(0x3, 0xffb485a0) = 0
mmap2(0x939000, 175772, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 3, 0) = 0x939000
mmap2(0x963000, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 3, 0x29) = 0x963000
close(3) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libkrb5.so.3", O_RDONLY) = -1 ENOENT (No such file or directory)
open("/usr/lib/libkrb5.so.3", O_RDONLY) = 3
read(3, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0000j.\007"..., 512) = 512
fstat64(0x3, 0xffb48584) = 0
mmap2(0x72d7000, 556612, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 3, 0) = 0xfffffffff7cab000
mmap2(0xf7d31000, 8192, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 3, 0x86) = 0xfffffffff7d31000
close(3) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libk5crypto.so.3", O_RDONLY) = -1 ENOENT (No such file or directory)
open("/usr/lib/libk5crypto.so.3", O_RDONLY) = 3
read(3, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0\220\225"..., 512) = 512
fstat64(0x3, 0xffb48568) = 0
mmap2(0x7186000, 155040, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 3, 0) = 0x7186000
mmap2(0x71ab000, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 3, 0x25) = 0x71ab000
close(3) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libcom_err.so.2", O_RDONLY) = -1 ENOENT (No such file or directory)
open("/lib/libcom_err.so.2", O_RDONLY) = 3
read(3, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0\360\247"..., 512) = 512
fstat64(0x3, 0xffb4854c) = 0
mmap2(NULL, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_ANONYMOUS, -1, 0) = 0xfffffffff7caa000
mmap2(0xdea000, 9132, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 3, 0) = 0xdea000
mmap2(0xdec000, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 3, 0x1) = 0xdec000
close(3) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libresolv.so.2", O_RDONLY) = -1 ENOENT (No such file or directory)
open("/lib/libresolv.so.2", O_RDONLY) = 3
read(3, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0\320 \321"..., 512) = 512
fstat64(0x3, 0xffb48530) = 0
mmap2(0xd10000, 75976, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 3, 0) = 0xd10000
mmap2(0xd1f000, 8192, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 3, 0xe) = 0xd1f000
mmap2(0xd21000, 6344, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_ANONYMOUS, -1, 0) = 0xd21000
close(3) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libz.so.1", O_RDONLY) = -1 ENOENT (No such file or directory)
open("/usr/lib/libz.so.1", O_RDONLY) = 3
read(3, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0\300E\316"..., 512) = 512
fstat64(0x3, 0xffb48514) = 0
mmap2(0xce3000, 76400, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 3, 0) = 0xce3000
mmap2(0xcf5000, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 3, 0x11) = 0xcf5000
close(3) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libkrb5support.so.0", O_RDONLY) = -1 ENOENT (No such file or directory)
open("/usr/lib/libkrb5support.so.0", O_RDONLY) = 3
read(3, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0000\364"..., 512) = 512
fstat64(0x3, 0xffb482d8) = 0
mmap2(0x753e000, 31848, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 3, 0) = 0x753e000
mmap2(0x7545000, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 3, 0x6) = 0x7545000
close(3) = 0
mmap2(NULL, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_ANONYMOUS, -1, 0) = 0xfffffffff7ca9000
mmap2(NULL, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_ANONYMOUS, -1, 0) = 0xfffffffff7ca8000
set_thread_area(0xffb49300) = 0
mprotect(0xd1f000, 4096, PROT_READ) = 0
mprotect(0xf7dac000, 188416, PROT_READ|PROT_WRITE) = 0
mprotect(0xf7dac000, 188416, PROT_READ|PROT_EXEC) = 0
mprotect(0xb26000, 8192, PROT_READ) = 0
mprotect(0xc77000, 4096, PROT_READ) = 0
mprotect(0xb53000, 4096, PROT_READ) = 0
mprotect(0x9eb000, 4096, PROT_READ) = 0
munmap(0xf7e1e000, 183737) = 0
_llseek(0, 0, 0xffb49310, SEEK_CUR) = -1 ESPIPE (Illegal seek)
_llseek(1, 0, 0xffb49310, SEEK_CUR) = -1 ESPIPE (Illegal seek)
_llseek(2, 0, 0xffb49310, SEEK_CUR) = -1 ESPIPE (Illegal seek)
rt_sigaction(SIGPIPE, {0x1000000000000001, [], SA_RESTORER|SA_STACK|SA_RESTART|SA_INTERRUPT|SA_NOMASK|SA_ONESHOT|SA_SIGINFO|0x3b491a8, (nil)}, {SIG_DFL}, 8) = 0
brk(0) = 0x804a000
brk(0x806b000) = 0x806b000
access("/usr/local/staden-linux-x86-1-7-0//linux-bin/stash", X_OK) = 0
stat64(0xffb4921c, 0xffb492f0) = 0
open("/usr/lib/locale/locale-archive", O_RDONLY|O_LARGEFILE) = 3
fstat64(0x3, 0xb28aa0) = 0
mmap2(NULL, 2097152, PROT_READ, MAP_PRIVATE, 3, 0) = 0xfffffffff7aa8000
close(3) = 0
lstat64(0xffb47be0, 0xffb4797c) = 0
lstat64(0xffb47be0, 0xffb4797c) = 0
lstat64(0xffb47be0, 0xffb4797c) = 0
lstat64(0xffb47be0, 0xffb4797c) = 0
lstat64(0xffb47be0, 0xffb4797c) = 0
lstat64(0xffb47be0, 0xffb4797c) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/tcl/encoding/iso8859-1.enc", O_RDONLY|O_LARGEFILE) = 3
fcntl64(3, F_SETFD, FD_CLOEXEC) = 0
ioctl(3, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb48bb8) = -1 ENOTTY (Inappropriate ioctl for device)
read(3, "# Encoding file: iso8859-1, sing"..., 4096) = 1094
read(3, "", 4096) = 0
close(3) = 0
uname({sys="Linux", node="mkbpc86", ...}) = 0
ioctl(0, SNDCTL_TMR_TIMEBASE or TCGETS, {B38400 opost isig icanon echo ...}) = 0
lstat64(0xffb47660, 0xffb473fc) = 0
lstat64(0xffb47660, 0xffb473fc) = 0
lstat64(0xffb47660, 0xffb473fc) = 0
lstat64(0xffb47660, 0xffb473fc) = 0
lstat64(0xffb47660, 0xffb473fc) = 0
access("/usr/local/staden-linux-x86-1-7-0/lib/tcl/init.tcl", F_OK) = 0
stat64(0x80552a0, 0xffb489d0) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/tcl/init.tcl", O_RDONLY|O_LARGEFILE) = 3
fcntl64(3, F_SETFD, FD_CLOEXEC) = 0
ioctl(3, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb48778) = -1 ENOTTY (Inappropriate ioctl for device)
read(3, "# init.tcl --\n#\n# Default system"..., 4096) = 4096
read(3, "nts onto the end and evaluate it"..., 4096) = 4096
read(3, "} {\n\t\tset errorCode $savedErrorC"..., 4096) = 4096
read(3, "ex file, version 2.0\"]} {\n\t\t "..., 4096) = 4096
read(3, "he Path or PATH environment vari"..., 4096) = 4096
read(3, "dest\\\": file already exists\"\n\t} "..., 4096) = 1617
read(3, "", 4096) = 0
close(3) = 0
lstat64(0xffb48300, 0xffb4809c) = 0
lstat64(0xffb48300, 0xffb4809c) = 0
lstat64(0xffb48300, 0xffb4809c) = 0
lstat64(0xffb48300, 0xffb4809c) = 0
lstat64(0xffb48300, 0xffb4809c) = 0
stat64(0x80551a8, 0xffb494f0) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/gap/gap.tcl", O_RDONLY|O_LARGEFILE) = 3
fcntl64(3, F_SETFD, FD_CLOEXEC) = 0
ioctl(3, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb49298) = -1 ENOTTY (Inappropriate ioctl for device)
read(3, "#\n# Copyright (c) Medical Resear"..., 4096) = 4096
read(3, "g %15.2f\\"..., 4096) = 4096
read(3, "]\n}\n############################"..., 4096) = 4096
read(3, "o\n }\n}\n######################"..., 4096) = 4096
read(3, "\n v \t\t{append GAP_VERSION \" ("..., 4096) = 4096
read(3, "reateMain\n\n#display contig selec"..., 4096) = 1292
read(3, "", 4096) = 0
close(3) = 0
uname({sys="Linux", node="mkbpc86", ...}) = 0
socket(PF_FILE, SOCK_STREAM, 0) = 3
uname({sys="Linux", node="mkbpc86", ...}) = 0
uname({sys="Linux", node="mkbpc86", ...}) = 0
connect(3, {sa_family=AF_FILE, path="/tmp/.X11-unix/X0"}, 19) = 0
uname({sys="Linux", node="mkbpc86", ...}) = 0
fcntl64(3, F_SETFD, FD_CLOEXEC) = 0
access("/tmp/.gdmSU412T", R_OK) = 0
open("/tmp/.gdmSU412T", O_RDONLY) = 4
fstat64(0x4, 0xffb4779c) = 0
mmap2(NULL, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_ANONYMOUS, -1, 0) = 0xfffffffff7e4a000
read(4, "\1\0\0\7mkbpc86\0\0010\0\22MIT-MAGIC-COOKIE"..., 4096) = 118
read(4, "", 4096) = 0
close(4) = 0
munmap(0xf7e4a000, 4096) = 0
writev(3, [{"l\0\v\0\0\0\22\0\20\0\0\0", 12}, {"MIT-MAGIC-COOKIE-1", 18}, {"\0\0", 2}, {"\370\277\252\212\236\364\216\334\3207\210x\241N\362\265"..., 16}], 4) = 48
fcntl64(3, F_GETFL) = 0x2 (flags O_RDWR)
fcntl64(3, F_SETFL, O_RDWR|O_NONBLOCK) = 0
read(3, "\1\0\v\0\0\0Q\0", 8) = 8
read(3, "\10\250-\4\0\0\0\3\377\377\37\0\0\1\0\0\24\0\377\377\1"..., 324) = 324
write(3, "7\0\5\0\0\0\0\3?\0\0\0\10\0\0\0\377\377\377\0b\0\5\0\f"..., 64) = 64
read(3, "\1e\2\0\0\0\0\0\1\202\0\0\0\0\0\0\0\0\0\0\0\0\0\0l>\0\0"..., 32) = 32
read(3, "\1\10\3\0\241\6\0\0\37\0\0\0\0\0\0\0\204\32\0\0\0\0\0\0"..., 32) = 32
readv(3, [{"*Box.background:\t#ede9e3\n*Box.fo"..., 6788}, {"", 0}], 2) = 6788
write(3, "\202\0\1\0", 4) = 4
read(3, "\1e\4\0\0\0\0\0\377\377?\0\0\0\0\0\0\0\0\0\0\0\0\0l>\0"..., 32) = 32
writev(3, [{"b\0\5\0\t\0\0\3", 8}, {"XKEYBOARD", 9}, {"\0\0\0", 3}], 3) = 20
read(3, "\1e\5\0\0\0\0\0\1\224n\256\0\0\0\0\0\0\0\0\0\0\0\0l>\0"..., 32) = 32
write(3, "\224\0\2\0\1\0\0\0", 8) = 8
read(3, "\1\1\6\0\0\0\0\0\1\0\0\0\0\0\0\0\360e\356\261\377\177\0"..., 32) = 32
brk(0x808d000) = 0x808d000
open("/usr/share/X11/locale/locale.alias", O_RDONLY) = 4
fstat64(0x4, 0xffb43558) = 0
mmap2(NULL, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_ANONYMOUS, -1, 0) = 0xfffffffff7e4a000
read(4, "#\t$XdotOrg: lib/X11/nls/locale.a"..., 4096) = 4096
read(4, "br_FR.iso88591\t\t\t\t\tbr_FR.ISO8859"..., 4096) = 4096
read(4, "iso88597\t\t\t\t\tel_GR.ISO8859-7\nel_"..., 4096) = 4096
read(4, "1.en\t\t\t\t\tes_ES.ISO8859-1\nes_ES.i"..., 4096) = 4096
read(4, "\nfr_CA.iso88591\t\t\t\t\tfr_CA.ISO885"..., 4096) = 4096
read(4, "5\t\t\t\tit_CH.ISO8859-15\nit_CH.utf8"..., 4096) = 4096
read(4, "\tnl_BE.ISO8859-1\nnl_BE.88591\t\t\t\t"..., 4096) = 4096
read(4, "RW.ISO8859-1\nrw_RW.iso8859-1 "..., 4096) = 4096
read(4, "\ntn_ZA.utf8\t\t\t\ttn_ZA.UTF-8\ntr\t\t\t"..., 4096) = 4096
read(4, "\t\tfr_CH.ISO8859-1\ngalego\t\t\t\t\t\tgl"..., 4096) = 4096
read(4, "r_OM:\t\t\t\t\t\tar_OM.ISO8859-6\nar_OM"..., 4096) = 4096
read(4, "59-15\nde_AT.UTF-8@euro:\t\t\t\tde_AT"..., 4096) = 4096
read(4, "n_US.ISO8859-15@euro:\t\t\t\ten_US.I"..., 4096) = 4096
read(4, "onian local standards, ISO8859-4"..., 4096) = 4096
read(4, "59-14:\t\t\t\tgd_GB.ISO8859-14\ngd_GB"..., 4096) = 4096
read(4, "R\nko_KR:\t\t\t\t\t\tko_KR.eucKR\nKO_KR:"..., 4096) = 4096
read(4, ".iso885915:\t\t\t\tny_NO.ISO8859-15\n"..., 4096) = 4096
read(4, ".ISO-8859-2:\t\t\t\tsr_CS.ISO8859-2\n"..., 4096) = 4096
read(4, "8\nVI_VN.UTF-8:\t\t\t\t\tvi_VN.UTF-8\nw"..., 4096) = 4096
read(4, "is and SunOS have iso_8859_1 and"..., 4096) = 298
read(4, "", 4096) = 0
close(4) = 0
munmap(0xf7e4a000, 4096) = 0
open("/usr/share/X11/locale/locale.alias", O_RDONLY) = 4
fstat64(0x4, 0xffb43558) = 0
mmap2(NULL, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_ANONYMOUS, -1, 0) = 0xfffffffff7e4a000
read(4, "#\t$XdotOrg: lib/X11/nls/locale.a"..., 4096) = 4096
read(4, "br_FR.iso88591\t\t\t\t\tbr_FR.ISO8859"..., 4096) = 4096
read(4, "iso88597\t\t\t\t\tel_GR.ISO8859-7\nel_"..., 4096) = 4096
read(4, "1.en\t\t\t\t\tes_ES.ISO8859-1\nes_ES.i"..., 4096) = 4096
read(4, "\nfr_CA.iso88591\t\t\t\t\tfr_CA.ISO885"..., 4096) = 4096
read(4, "5\t\t\t\tit_CH.ISO8859-15\nit_CH.utf8"..., 4096) = 4096
read(4, "\tnl_BE.ISO8859-1\nnl_BE.88591\t\t\t\t"..., 4096) = 4096
read(4, "RW.ISO8859-1\nrw_RW.iso8859-1 "..., 4096) = 4096
read(4, "\ntn_ZA.utf8\t\t\t\ttn_ZA.UTF-8\ntr\t\t\t"..., 4096) = 4096
read(4, "\t\tfr_CH.ISO8859-1\ngalego\t\t\t\t\t\tgl"..., 4096) = 4096
read(4, "r_OM:\t\t\t\t\t\tar_OM.ISO8859-6\nar_OM"..., 4096) = 4096
read(4, "59-15\nde_AT.UTF-8@euro:\t\t\t\tde_AT"..., 4096) = 4096
read(4, "n_US.ISO8859-15@euro:\t\t\t\ten_US.I"..., 4096) = 4096
close(4) = 0
munmap(0xf7e4a000, 4096) = 0
open("/usr/share/X11/locale/locale.dir", O_RDONLY) = 4
fstat64(0x4, 0xffb43ad8) = 0
mmap2(NULL, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_ANONYMOUS, -1, 0) = 0xfffffffff7e4a000
read(4, "#\t$XdotOrg: lib/X11/nls/locale.d"..., 4096) = 4096
read(4, "so8859-1/XLC_LOCALE\t\t\tes_US.ISO8"..., 4096) = 4096
read(4, "CALE\t\t\tsr_CS.ISO8859-5\niso8859-2"..., 4096) = 4096
read(4, "UTF-8/XLC_LOCALE\t\t\tes_MX.UTF-8\ne"..., 4096) = 4096
read(4, ",v 1.3 2000/08/17 19:46:48 cpqbl"..., 4096) = 4096
read(4, "9-1/XLC_LOCALE:\t\t\tes_US.ISO8859-"..., 4096) = 4096
read(4, "\niso8859-2/XLC_LOCALE: \t\t\tsq_AL."..., 4096) = 4096
close(4) = 0
munmap(0xf7e4a000, 4096) = 0
access("/usr/share/X11/locale/en_US.UTF-8/XLC_LOCALE", R_OK) = 0
open("/usr/share/X11/locale/en_US.UTF-8/XLC_LOCALE", O_RDONLY) = 4
fstat64(0x4, 0xffb44f78) = 0
mmap2(NULL, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_ANONYMOUS, -1, 0) = 0xfffffffff7e4a000
read(4, "# $XFree86: xc/nls/XLC_LOCALE/e"..., 4096) = 2036
read(4, "", 4096) = 0
close(4) = 0
munmap(0xf7e4a000, 4096) = 0
geteuid32() = 500
getegid32() = 500
open("/home/kamini/.XCompose", O_RDONLY) = -1 ENOENT (No such file or directory)
open("/usr/share/X11/locale/compose.dir", O_RDONLY) = 4
fstat64(0x4, 0xffb46798) = 0
mmap2(NULL, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_ANONYMOUS, -1, 0) = 0xfffffffff7e4a000
read(4, "# $Xorg: compose.dir,v 1.3 2000/"..., 4096) = 4096
read(4, "859-14\niso8859-15/Compose\t\tgd_GB"..., 4096) = 4096
read(4, ".Big5\nzh_TW/Compose\t\t\tzh_TW.eucT"..., 4096) = 4096
read(4, "F-8\nen_US.UTF-8/Compose\t\trw_RW.U"..., 4096) = 4096
read(4, "\niso8859-1/Compose:\t\tes_PY.ISO88"..., 4096) = 4096
read(4, "o8859-5/Compose:\t\tsr_CS.ISO8859-"..., 4096) = 4096
close(4) = 0
munmap(0xf7e4a000, 4096) = 0
access("/usr/share/X11/locale/en_US.UTF-8/Compose", R_OK) = 0
getuid32() = 500
getgid32() = 500
stat64(0x8071520, 0xffb47c20) = 0
stat64(0xc59780, 0xffb47c20) = -1 ENOENT (No such file or directory)
getuid32() = 500
getgid32() = 500
stat64(0x8071520, 0xffb47c20) = 0
stat64(0x8071550, 0xffb47c20) = -1 ENOENT (No such file or directory)
open("/usr/share/X11/locale/en_US.UTF-8/Compose", O_RDONLY) = 4
fstat64(0x4, 0xffb45840) = 0
mmap2(NULL, 565248, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_ANONYMOUS, -1, 0) = 0xfffffffff7a1e000
fstat64(0x4, 0xffb45770) = 0
mmap2(NULL, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_ANONYMOUS, -1, 0) = 0xfffffffff7a1d000
read(4, "# UTF-8 (Unicode) compose sequen"..., 4096) = 4096
open("/usr/share/X11/XKeysymDB", O_RDONLY) = 5
fstat64(0x5, 0xffb456e0) = 0
read(5, "! $Xorg: XKeysymDB,v 1.3 2000/08"..., 8298) = 8298
close(5) = 0
read(4, "sciitilde # TILDE\n<Multi_key> <s"..., 4096) = 4096
read(4, " \t: \"\342\202\245\" U20a5 # MILL SIGN\n<"..., 4096) = 4096
read(4, " RIEUL-MIEUM-KIYEOK\n<Multi_key> "..., 4096) = 4096
read(4, " <U10001100> \t: \"\341\205\201\" U1141 # "..., 4096) = 4096
read(4, "NGUL JUNGSEONG YU-A\n<Multi_key> "..., 4096) = 4096
read(4, "d # HANGUL JONGSEONG MIEUM-SIOS\n"..., 4096) = 4096
read(4, "i_key> <U10001107> <U10001132> \t"..., 4096) = 4096
read(4, "> <A> \t: \"\303\201\" U00C1 #"..., 4096) = 4096
read(4, "ITAL LETTER O WITH CIRCUMFLEX\n<M"..., 4096) = 4096
read(4, " WITH ACUTE\n<Multi_key> <apostro"..., 4096) = 4096
read(4, "AERESIS\n<Multi_key> <quotedbl> <"..., 4096) = 4096
read(4, "slash> <D> \t: \"\304\220\" U0"..., 4096) = 4096
read(4, "RCUMFLEX\n<dead_circumflex> <h> "..., 4096) = 4096
read(4, "cute> <l> \t: \"\304\272\" U"..., 4096) = 4096
read(4, " U0154 # LATIN CAPITAL LETTER "..., 4096) = 4096
read(4, " CAPITAL LETTER U WITH TILDE\n<co"..., 4096) = 4096
read(4, "ey> <period> <Z> \t: \"\305\273\""..., 4096) = 4096
read(4, " DIAERESIS AND MACRON\n<Multi_key"..., 4096) = 4096
read(4, "CAPITAL LETTER U WITH DIAERESIS "..., 4096) = 4096
read(4, "LL LETTER A WITH DIAERESIS AND M"..., 4096) = 4096
read(4, "<U100001EA> \t: \"\307\254\" U01EC # LA"..., 4096) = 4096
read(4, "y> <apostrophe> <dead_abovering>"..., 4096) = 4096
read(4, "apostrophe> <slash> <o> \t: \"\307\277\" "..., 4096) = 4096
read(4, "L LETTER E WITH CEDILLA\n<dead_ce"..., 4096) = 4096
read(4, " <asciitilde> <o> \t: \"\310\255\" U022"..., 4096) = 4096
read(4, "mflex> <Multi_key> <underbar> <U"..., 4096) = 4096
read(4, "IFIER LETTER SMALL X\n<dead_circu"..., 4096) = 4096
read(4, "ETTER IOTA WITH DIALYTIKA AND TO"..., 4096) = 4096
read(4, " U03B0 # GREEK SMALL LETTER UPS"..., 4096) = 4096
read(4, " \t: \"\320\271\" U0439 # CYRILLIC SMA"..., 4096) = 4096
read(4, "lic_a> \t: \"\323\221\" U04D1 # CYR"..., 4096) = 4096
read(4, "U04ED # CYRILLIC SMALL LETTER E "..., 4096) = 4096
read(4, "0009BC> <U100009AF> \t: \"\340\247\237\" U"..., 4096) = 4096
read(4, " \t: \"\341\270\202\" U1E02 # LATIN C"..., 4096) = 4096
read(4, "d> \t: \"\341\270\215\" U1E0D"..., 4096) = 4096
read(4, "on> <E> \t: \"\341\270\226\" U1E16 # LATIN"..., 4096) = 4096
brk(0x80be000) = 0x80be000
read(4, "1E1D # LATIN SMALL LETTER E WITH"..., 4096) = 4096
read(4, "ti_key> <apostrophe> <dead_diaer"..., 4096) = 4096
read(4, " AND MACRON\n<dead_macron> <Multi"..., 4096) = 4096
read(4, "_abovedot> <N> \t: \""..., 4096) = 4096
read(4, " \t: \"\341\271\215\" U1E4D # LATIN SMAL"..., 4096) = 4096
read(4, "TIN SMALL LETTER O WITH MACRON A"..., 4096) = 4096
read(4, "key> <apostrophe> <p> \t: \"\341\271"..., 4096) = 4096
read(4, "LATIN SMALL LETTER R WITH LINE B"..., 4096) = 4096
read(4, "BOVE\n<Multi_key> <period> <c> <s"..., 4096) = 4096
read(4, " U1E78 # LATIN CAPITAL LETTER U "..., 4096) = 4096
read(4, "IN SMALL LETTER U WITH MACRON AN"..., 4096) = 4096
read(4, " DOT ABOVE\n<Multi_key> <period> "..., 4096) = 4096
read(4, "ircumflex> <A> \t: \"\341\272\244\" U1EA4 "..., 4096) = 4096
read(4, "R A WITH CIRCUMFLEX AND GRAVE\n<d"..., 4096) = 4096
read(4, "0> \t: \"\341\272\254\" U1EAC # LATIN CAPI"..., 4096) = 4096
read(4, "i_key> <acute> <U> <a> \t: \""..., 4096) = 4096
read(4, "ning_hook> <dead_breve> <A> \t: \""..., 4096) = 4096
read(4, "TAL LETTER A WITH BREVE AND DOT "..., 4096) = 4096
read(4, ": \"\341\272\276\" U1EBE # LATIN CAPITAL "..., 4096) = 4096
read(4, "AVE\n<combining_grave> <dead_circ"..., 4096) = 4096
read(4, "1EC5 # LATIN SMALL LETTER E WITH"..., 4096) = 4096
read(4, "TTER O WITH HOOK ABOVE\n<combinin"..., 4096) = 4096
read(4, "# LATIN SMALL LETTER O WITH CIRC"..., 4096) = 4096
read(4, " <ocircumflex> \t: \"\341\273\227\" U1ED7"..., 4096) = 4096
read(4, "MALL LETTER O WITH HORN AND ACUT"..., 4096) = 4096
read(4, "ER O WITH HORN AND HOOK ABOVE\n<M"..., 4096) = 4096
read(4, "o> \t: \"\341\273\243\" U1EE3 # LATIN SMA"..., 4096) = 4096
read(4, " CAPITAL LETTER U WITH HORN AND "..., 4096) = 4096
read(4, " U1EEE # LATIN CAPITAL LETTER "..., 4096) = 4096
read(4, "ALL LETTER Y WITH GRAVE\n<dead_be"..., 4096) = 4096
read(4, "XIA\n<Multi_key> <apostrophe> <U1"..., 4096) = 4096
read(4, "<parenleft> <Greek_alpha> \t: \"\341\274"..., 4096) = 4096
read(4, "A\n<Multi_key> <acute> <U10001F09"..., 4096) = 4096
read(4, "VARIA\n<Multi_key> <grave> <U1000"..., 4096) = 4096
read(4, "IA AND OXIA\n<combining_acute> <M"..., 4096) = 4096
read(4, "IA AND OXIA\n<Multi_key> <apostro"..., 4096) = 4096
read(4, "OXIA\n<Multi_key> <apostrophe> <U"..., 4096) = 4096
read(4, "F29 # GREEK CAPITAL LETTER ETA W"..., 4096) = 4096
read(4, "enleft> <Greek_ETA> \t: \"\341\274\255\" U"..., 4096) = 4096
read(4, "U1F33 # GREEK SMALL LETTER IOTA "..., 4096) = 4096
read(4, "EK SMALL LETTER IOTA WITH PSILI "..., 4096) = 4096
read(4, "IA\n<Multi_key> <apostrophe> <U10"..., 4096) = 4096
read(4, "10000314> <Greek_omicron> \t"..., 4096) = 4096
read(4, " U1F45 # GREEK SMALL LETTER OMI"..., 4096) = 4096
read(4, "MICRON> \t: \"\341\275\214\" U1F4C # GREEK"..., 4096) = 4096
read(4, "K SMALL LETTER UPSILON WITH DASI"..., 4096) = 4096
read(4, "0000314> <Greek_upsilon> \t: \"\341\275\227"..., 4096) = 4096
read(4, "> <asciitilde> <U10000314> <Gree"..., 4096) = 4096
read(4, "L LETTER OMEGA WITH DASIA AND OX"..., 4096) = 4096
read(4, "A\n<combining_grave> <U10001F68> "..., 4096) = 4096
read(4, " U1F6E # GREEK CAPITAL LETTER "..., 4096) = 4096
read(4, "ER ALPHA WITH PSILI AND YPOGEGRA"..., 4096) = 4096
read(4, "d_iota> <dead_grave> <U10001F01>"..., 4096) = 4096
read(4, "e> <U10000313> <Greek_alpha> \t: "..., 4096) = 4096
read(4, " OXIA AND YPOGEGRAMMENI\n<Multi_k"..., 4096) = 4096
read(4, "L LETTER ALPHA WITH PSILI AND PE"..., 4096) = 4096
read(4, "H DASIA AND PROSGEGRAMMENI\n<dead"..., 4096) = 4096
read(4, "D PROSGEGRAMMENI\n<dead_iota> <de"..., 4096) = 4096
read(4, " PROSGEGRAMMENI\n<Multi_key> <Gre"..., 4096) = 4096
read(4, "MENI\n<Multi_key> <Greek_iota> <a"..., 4096) = 4096
read(4, "10001F0F> \t: \"\341\276\217\" U1F8F # GRE"..., 4096) = 4096
read(4, " DASIA AND YPOGEGRAMMENI\n<dead_i"..., 4096) = 4096
read(4, "ASIA AND VARIA AND YPOGEGRAMMENI"..., 4096) = 4096
read(4, "mbining_acute> <U10001F20> \t: \"\341"..., 4096) = 4096
read(4, "U1F95 # GREEK SMALL LETTER ETA W"..., 4096) = 4096
read(4, "> \t: \"\341\276\227\" U1F97 # GREEK SMALL"..., 4096) = 4096
read(4, "ND VARIA AND PROSGEGRAMMENI\n<dea"..., 4096) = 4096
read(4, "ek_ETA> \t: \"\341\276\233\" U1F9B # GREEK"..., 4096) = 4096
read(4, "1F9D # GREEK CAPITAL LETTER ETA "..., 4096) = 4096
read(4, "10001F28> \t: \"\341\276\236\" U1F9E # GRE"..., 4096) = 4096
read(4, " PERISPOMENI AND PROSGEGRAMMENI\n"..., 4096) = 4096
read(4, "ing_grave> <U10001F60> \t: \"\341\276\242\" "..., 4096) = 4096
read(4, " <U10001F60> \t: \"\341\276\244\" U1FA4 # "..., 4096) = 4096
read(4, " <Greek_omega> \t: \"\341\276\245\" U1FA5 "..., 4096) = 4096
read(4, "GREEK SMALL LETTER OMEGA WITH PS"..., 4096) = 4096
read(4, "R OMEGA WITH DASIA AND PERISPOME"..., 4096) = 4096
read(4, "A WITH PSILI AND VARIA AND PROSG"..., 4096) = 4096
read(4, "EEK CAPITAL LETTER OMEGA WITH PS"..., 4096) = 4096
read(4, "L LETTER OMEGA WITH DASIA AND OX"..., 4096) = 4096
read(4, "y> <Greek_iota> <U10000342> <U10"..., 4096) = 4096
read(4, "A WITH VRACHY\n<dead_macron> <Gre"..., 4096) = 4096
read(4, " \t: \"\341\276\270\" U1FB8 # GREEK CAP"..., 4096) = 4096
read(4, "de> <Greek_eta> \t: \"\341\277\207\" U1FC7"..., 4096) = 4096
read(4, "resis> \t: \"\341\277\227\" U1FD7 # GREEK "..., 4096) = 4096
read(4, " GREEK SMALL LETTER RHO WITH PSI"..., 4096) = 4096
read(4, "LETTER OMEGA WITH YPOGEGRAMMENI\n"..., 4096) = 4096
read(4, "SUPERSCRIPT FOUR\n<Multi_key> <as"..., 4096) = 4096
read(4, "rbar> <KP_3> \t: \"\342\202\203\" U2083"..., 4096) = 4096
read(4, "Y NOR ACTUALLY EQUAL TO\n<Multi_k"..., 4096) = 4096
read(4, "LED DIGIT EIGHT\n<Multi_key> <par"..., 4096) = 4096
read(4, " \"\342\221\263\" U2473 # CIRCLED NUMBER "..., 4096) = 4096
read(4, "MALL LETTER N\n<Multi_key> <paren"..., 4096) = 4096
read(4, "ER DI\n<dead_voiced_sound> <kana_"..., 4096) = 4096
read(4, "CIRCLED NUMBER TWENTY ONE\n<Multi"..., 4096) = 4096
read(4, "> <parenright> \t: \"\343\211\230\" U3258 "..., 4096) = 4096
read(4, "i_key> <parenleft> <U10001109> <"..., 4096) = 4096
read(4, "renleft> <U10007279> <parenright"..., 4096) = 4096
read(4, "MBER THIRTY NINE\n<Multi_key> <pa"..., 4096) = 4096
brk(0x80e0000) = 0x80e0000
read(4, " <parenleft> <KP_5> <0> <parenri"..., 4096) = 4096
read(4, "FD # CIRCLED KATAKANA WE\n<Multi_"..., 4096) = 4096
read(4, "> \t: \"\357\255\215\" UFB4D # HEBREW LETT"..., 4096) = 2146
read(4, "", 4096) = 0
munmap(0xf7a1e000, 565248) = 0
close(4) = 0
munmap(0xf7a1d000, 4096) = 0
write(3, "\1\30\r\0\1\0\0\3?\0\0\0\0\0\0\0\1\0\1\0\0\0\1\0\"\0\0"..., 64) = 64
read(3, "\1e\10\0\0\0\0\0\200\1\0\0\0\0\0\0\0\0\0\0\0\0\0\0\200"..., 32) = 32
write(3, "\20\0\6\0\16\0\0\3InterpRegistry\1\0", 24) = 24
read(3, "\1e\t\0\0\0\0\0\201\1\0\0\0\0\0\0\0\0\0\0\0\0\0\0\200>"..., 32) = 32
write(3, "\20\0\6\0\16\0\0\3TK_APPLICATION\1\0", 24) = 24
read(3, "\1e\n\0\0\0\0\0\202\1\0\0\0\0\0\0\0\0\0\0\0\0\0\0\200>"..., 32) = 32
write(3, "$\0\1\0\24\0\6\0?\0\0\0\201\1\0\0\37\0\0\0\0\0\0\0\240"..., 28) = 28
read(3, "\1\0\f\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0"..., 32) = 32
write(3, "\22\0\n\0?\0\0\0\201\1\0\0\37\0\0\0\10\0\0\0\20\0\0\000"..., 44) = 44
uname({sys="Linux", node="mkbpc86", ...}) = 0
write(3, "\22\0\10\0\1\0\0\3\202\1\0\0\37\0\0\0\10\0\0\0\7\0\0\0"..., 56) = 56
read(3, "\34\0\17\0\1\0\0\3\202\1\0\0\304\370\313\257\0\0\0\0\0"..., 32) = 32
read(3, "\1\10\20\0\241\6\0\0\37\0\0\0\0\0\0\0\204\32\0\0\0\0\0"..., 32) = 32
readv(3, [{"*Box.background:\t#ede9e3\n*Box.fo"..., 6788}, {"", 0}], 2) = 6788
write(3, "T\0\4\0 \0\0\0\0\355\0\351\0\343\0\0", 16) = 16
read(3, "\1\0\21\0\0\0\0\0\355\355\351\351\343\343\0\0\343\351\355"..., 32) = 32
write(3, "7\0\5\0\2\0\0\3?\0\0\0\4\0\0\0\343\351\355\0T\0\4\0 \0"..., 36) = 36
read(3, "\1\0\23\0\0\0\0\0\331\331\331\331\331\331\0\0\331\331\331"..., 32) = 32
write(3, "\20\1\t\0\33\0\0\3XDCCC_LINEAR_RGB_CORRECT"..., 36) = 36
read(3, "\1e\24\0\0\0\0\0i\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\200>\0"..., 32) = 32
write(3, "\20\1\t\0\31\0\0\3XDCCC_LINEAR_RGB_MATRICE"..., 36) = 36
read(3, "\1e\25\0\0\0\0\0j\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\200>\0"..., 32) = 32
write(3, "\24\0\6\0?\0\0\0j\0\0\0\23\0\0\0\0\0\0\0t\31\0\0", 24) = 24
read(3, "\1\0\26\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0"..., 32) = 32
stat64(0xc5acbc, 0xffb47670) = -1 ENOENT (No such file or directory)
writev(3, [{"U\0\5\0 \0\0\0\5\0\0\0", 12}, {"Black", 5}, {"\0\0\0", 3}], 3) = 20
read(3, "\1\254\27\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\304"..., 32) = 32
lstat64(0xffb45580, 0xffb4531c) = 0
lstat64(0xffb45580, 0xffb4531c) = 0
lstat64(0xffb45580, 0xffb4531c) = 0
lstat64(0xffb45580, 0xffb4531c) = 0
lstat64(0xffb45580, 0xffb4531c) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/tk_utils/tclIndex", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb46558) = -1 ENOTTY (Inappropriate ioctl for device)
_llseek(0, 0, 0xffb465d0, SEEK_CUR) = -1 ESPIPE (Illegal seek)
ioctl(0, SNDCTL_TMR_TIMEBASE or TCGETS, {B38400 opost isig icanon echo ...}) = 0
ioctl(0, SNDCTL_TMR_TIMEBASE or TCGETS, {B38400 opost isig icanon echo ...}) = 0
_llseek(1, 0, 0xffb465d0, SEEK_CUR) = -1 ESPIPE (Illegal seek)
ioctl(1, SNDCTL_TMR_TIMEBASE or TCGETS, {B38400 opost isig icanon echo ...}) = 0
ioctl(1, SNDCTL_TMR_TIMEBASE or TCGETS, {B38400 opost isig icanon echo ...}) = 0
_llseek(2, 0, 0xffb465d0, SEEK_CUR) = -1 ESPIPE (Illegal seek)
ioctl(2, SNDCTL_TMR_TIMEBASE or TCGETS, {B38400 opost isig icanon echo ...}) = 0
ioctl(2, SNDCTL_TMR_TIMEBASE or TCGETS, {B38400 opost isig icanon echo ...}) = 0
read(4, "# Tcl autoload index file, versi"..., 4096) = 4096
read(4, "_def) [list source [file join $d"..., 4096) = 4096
read(4, "ndex(CheckFloatRange) [list sour"..., 4096) = 4096
read(4, "ist source [file join $dir html_"..., 4096) = 4096
read(4, "its) [list source [file join $di"..., 4096) = 4096
read(4, " [list source [file join $dir ca"..., 4096) = 4096
read(4, "yme_map.tcl]]\nset auto_index(Sel"..., 4096) = 4096
read(4, "set auto_index(spBiolimsDialog_I"..., 4096) = 4096
read(4, "index(::Widget::Xmclistbox::_bin"..., 4096) = 4096
read(4, "extract_element_name) [list sour"..., 4096) = 4096
read(4, "_element_different) [list source"..., 4096) = 1259
read(4, "", 4096) = 0
brk(0x8101000) = 0x8101000
close(4) = 0
lstat64(0xffb45580, 0xffb4531c) = 0
lstat64(0xffb45580, 0xffb4531c) = 0
lstat64(0xffb45580, 0xffb4531c) = 0
open("/usr/local/lib/tclIndex", O_RDONLY|O_LARGEFILE) = -1 ENOENT (No such file or directory)
open("/usr/lib/gconv/gconv-modules.cache", O_RDONLY) = 4
fstat64(0x4, 0xffb45b94) = 0
mmap2(NULL, 25460, PROT_READ, MAP_SHARED, 4, 0) = 0xfffffffff7aa1000
close(4) = 0
lstat64(0xffb45580, 0xffb4531c) = 0
lstat64(0xffb45580, 0xffb4531c) = 0
lstat64(0xffb45580, 0xffb4531c) = 0
lstat64(0xffb45580, 0xffb4531c) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/tclIndex", O_RDONLY|O_LARGEFILE) = -1 ENOENT (No such file or directory)
lstat64(0xffb45580, 0xffb4531c) = 0
lstat64(0xffb45580, 0xffb4531c) = 0
lstat64(0xffb45580, 0xffb4531c) = 0
lstat64(0xffb45580, 0xffb4531c) = 0
lstat64(0xffb45580, 0xffb4531c) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/tcl/tclIndex", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb46558) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "# Tcl autoload index file, versi"..., 4096) = 4096
read(4, ") [list source [file join $dir s"..., 4096) = 1913
read(4, "", 4096) = 0
close(4) = 0
lstat64(0xffb457b0, 0xffb4554c) = 0
lstat64(0xffb457b0, 0xffb4554c) = 0
lstat64(0xffb457b0, 0xffb4554c) = 0
lstat64(0xffb457b0, 0xffb4554c) = 0
lstat64(0xffb457b0, 0xffb4554c) = 0
stat64(0x80c64c0, 0xffb469a0) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/tcl/auto.tcl", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb46748) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "# auto.tcl --\n#\n# utility procs "..., 4096) = 4096
read(4, "pend errors \"$file: $msg\\n$error"..., 4096) = 4096
read(4, "d $oldDir\n } msg]\n if {$er"..., 4096) = 4096
read(4, " command. When you execute them"..., 4096) = 4096
read(4, "source\" call to handle platform\n"..., 4096) = 3054
read(4, "", 4096) = 0
close(4) = 0
lstat64(0xffb453f0, 0xffb4518c) = 0
lstat64(0xffb453f0, 0xffb4518c) = 0
lstat64(0xffb453f0, 0xffb4518c) = 0
lstat64(0xffb453f0, 0xffb4518c) = 0
lstat64(0xffb453f0, 0xffb4518c) = 0
access("/usr/local/staden-linux-x86-1-7-0/lib/tk/tk.tcl", F_OK) = 0
stat64(0x80c7f50, 0xffb46760) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/tk/tk.tcl", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb46508) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "# tk.tcl --\n#\n# Initialization s"..., 4096) = 4096
read(4, "dowingsystem] eq \"macintosh\" \\\n\t"..., 4096) = 4096
read(4, "herwise, if someone references i"..., 4096) = 4096
read(4, "rm(platform) \"macintosh\"]} {\n\tpr"..., 4096) = 4096
read(4, "r label which has appropriate un"..., 4096) = 704
brk(0x8127000) = 0x8127000
read(4, "", 4096) = 0
close(4) = 0
lstat64(0xffb435c0, 0xffb4335c) = 0
lstat64(0xffb435c0, 0xffb4335c) = 0
lstat64(0xffb435c0, 0xffb4335c) = 0
lstat64(0xffb435c0, 0xffb4335c) = 0
lstat64(0xffb435c0, 0xffb4335c) = 0
stat64(0x80cf938, 0xffb447b0) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/tcl/package.tcl", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb44558) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "# package.tcl --\n#\n# utility pro"..., 4096) = 4096
read(4, "dx]\n set patternList [lrange "..., 4096) = 4096
read(4, "each ::tcl::x [package names] {\n"..., 4096) = 4096
read(4, "e of this file\'s directory.\\n\"\n\n"..., 4096) = 4096
read(4, "ing package index file $file: $m"..., 4096) = 4096
read(4, "st $lazyFileList]\\]\"\n }\n a"..., 4096) = 91
read(4, "", 4096) = 0
close(4) = 0
lstat64(0xffb430f0, 0xffb42e8c) = 0
lstat64(0xffb430f0, 0xffb42e8c) = 0
lstat64(0xffb430f0, 0xffb42e8c) = 0
lstat64(0xffb430f0, 0xffb42e8c) = 0
stat64(0xffb440cc, 0xffb441a0) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/tk_utils/", O_RDONLY|O_NONBLOCK|O_LARGEFILE|O_DIRECTORY) = 4
fstat64(0x4, 0xffb43e4c) = 0
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
getdents(4, /* 1 entries */, 4096) = 1392
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
getdents(4, /* 0 entries */, 4096) = 0
close(4) = 0
lstat64(0xffb43200, 0xffb42f9c) = 0
lstat64(0xffb43200, 0xffb42f9c) = 0
lstat64(0xffb43200, 0xffb42f9c) = 0
lstat64(0xffb43200, 0xffb42f9c) = 0
lstat64(0xffb43200, 0xffb42f9c) = 0
access("/usr/local/staden-linux-x86-1-7-0/lib/tk_utils/pkgIndex.tcl", R_OK) = -1 ENOENT (No such file or directory)
lstat64(0xffb430f0, 0xffb42e8c) = 0
lstat64(0xffb430f0, 0xffb42e8c) = 0
stat64(0xffb440cc, 0xffb441a0) = 0
open("/usr/local/lib/", O_RDONLY|O_NONBLOCK|O_LARGEFILE|O_DIRECTORY) = 4
fstat64(0x4, 0xffb43e4c) = 0
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
getdents(4, /* 1 entries */, 4096) = 56
stat64(0xffb440cc, 0xffb43e40) = 0
getdents(4, /* 0 entries */, 4096) = 0
close(4) = 0
lstat64(0xffb43200, 0xffb42f9c) = 0
lstat64(0xffb43200, 0xffb42f9c) = 0
lstat64(0xffb43200, 0xffb42f9c) = 0
access("/usr/local/lib/pkgIndex.tcl", R_OK) = -1 ENOENT (No such file or directory)
lstat64(0xffb430f0, 0xffb42e8c) = 0
lstat64(0xffb430f0, 0xffb42e8c) = 0
lstat64(0xffb430f0, 0xffb42e8c) = 0
stat64(0xffb440cc, 0xffb441a0) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/", O_RDONLY|O_NONBLOCK|O_LARGEFILE|O_DIRECTORY) = 4
fstat64(0x4, 0xffb43e4c) = 0
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
getdents(4, /* 1 entries */, 4096) = 484
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
getdents(4, /* 0 entries */, 4096) = 0
close(4) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0x8106a10, 0xffb43be0) = -1 ENOENT (No such file or directory)
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0x8106a10, 0xffb43be0) = -1 ENOENT (No such file or directory)
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0x8106880, 0xffb43be0) = -1 ENOENT (No such file or directory)
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0x8106980, 0xffb43be0) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0x8107bf0, 0xffb43be0) = -1 ENOENT (No such file or directory)
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0x8107b18, 0xffb43be0) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0x8107df8, 0xffb43be0) = -1 ENOENT (No such file or directory)
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0x8107da0, 0xffb43be0) = -1 ENOENT (No such file or directory)
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0x8108010, 0xffb43be0) = -1 ENOENT (No such file or directory)
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0x8108010, 0xffb43be0) = -1 ENOENT (No such file or directory)
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0x81080e8, 0xffb43be0) = -1 ENOENT (No such file or directory)
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0x8107fc8, 0xffb43be0) = -1 ENOENT (No such file or directory)
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0x8107de0, 0xffb43be0) = -1 ENOENT (No such file or directory)
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0x8107da0, 0xffb43be0) = -1 ENOENT (No such file or directory)
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0x81080e8, 0xffb43be0) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0x8108440, 0xffb43be0) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0x8108608, 0xffb43be0) = -1 ENOENT (No such file or directory)
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0x8108590, 0xffb43be0) = -1 ENOENT (No such file or directory)
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0x8108550, 0xffb43be0) = -1 ENOENT (No such file or directory)
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0x8108510, 0xffb43be0) = -1 ENOENT (No such file or directory)
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0x8108510, 0xffb43be0) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0x8108870, 0xffb43be0) = -1 ENOENT (No such file or directory)
access("/usr/local/staden-linux-x86-1-7-0/lib/itk3.3/pkgIndex.tcl", R_OK) = 0
stat64(0x8106980, 0xffb447b0) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/itk3.3/pkgIndex.tcl", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb44558) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "# Tcl package index file, versio"..., 4096) = 245
read(4, "", 4096) = 0
close(4) = 0
access("/usr/local/staden-linux-x86-1-7-0/lib/tablelist3.4/pkgIndex.tcl", R_OK) = 0
stat64(0x8107b18, 0xffb447b0) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/tablelist3.4/pkgIndex.tcl", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb44558) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "#==============================="..., 4096) = 707
read(4, "", 4096) = 0
close(4) = 0
access("/usr/local/staden-linux-x86-1-7-0/lib/itcl3.3/pkgIndex.tcl", R_OK) = 0
stat64(0x81080e8, 0xffb447b0) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/itcl3.3/pkgIndex.tcl", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb44558) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "# Tcl package index file, versio"..., 4096) = 252
read(4, "", 4096) = 0
close(4) = 0
access("/usr/local/staden-linux-x86-1-7-0/lib/tk/pkgIndex.tcl", R_OK) = 0
stat64(0x8108440, 0xffb447b0) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/tk/pkgIndex.tcl", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb44558) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "if {[package vcompare [package p"..., 4096) = 281
read(4, "", 4096) = 0
close(4) = 0
access("/usr/local/staden-linux-x86-1-7-0/lib/iwidgets/pkgIndex.tcl", R_OK) = 0
stat64(0x8108510, 0xffb447b0) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/iwidgets/pkgIndex.tcl", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb44558) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "# Tcl package index file, versio"..., 4096) = 115
read(4, "", 4096) = 0
close(4) = 0
lstat64(0xffb43200, 0xffb42f9c) = 0
lstat64(0xffb43200, 0xffb42f9c) = 0
lstat64(0xffb43200, 0xffb42f9c) = 0
lstat64(0xffb43200, 0xffb42f9c) = 0
access("/usr/local/staden-linux-x86-1-7-0/lib/pkgIndex.tcl", R_OK) = -1 ENOENT (No such file or directory)
lstat64(0xffb430f0, 0xffb42e8c) = 0
lstat64(0xffb430f0, 0xffb42e8c) = 0
lstat64(0xffb430f0, 0xffb42e8c) = 0
lstat64(0xffb430f0, 0xffb42e8c) = 0
stat64(0xffb440cc, 0xffb441a0) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/tcl/", O_RDONLY|O_NONBLOCK|O_LARGEFILE|O_DIRECTORY) = 4
fstat64(0x4, 0xffb43e4c) = 0
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
getdents(4, /* 1 entries */, 4096) = 488
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
stat64(0xffb440cc, 0xffb43e40) = 0
getdents(4, /* 0 entries */, 4096) = 0
close(4) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0x81064d0, 0xffb43be0) = -1 ENOENT (No such file or directory)
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0x8107f08, 0xffb43be0) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0x81086f0, 0xffb43be0) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0x8108930, 0xffb43be0) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0x8108b68, 0xffb43be0) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0xffb42e90, 0xffb42c2c) = 0
lstat64(0x8108dd0, 0xffb43be0) = 0
access("/usr/local/staden-linux-x86-1-7-0/lib/tcl/http1.0/pkgIndex.tcl", R_OK) = 0
stat64(0x8107f08, 0xffb447b0) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/tcl/http1.0/pkgIndex.tcl", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb44558) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "# Tcl package index file, versio"..., 4096) = 735
read(4, "", 4096) = 0
close(4) = 0
access("/usr/local/staden-linux-x86-1-7-0/lib/tcl/msgcat1.3/pkgIndex.tcl", R_OK) = 0
stat64(0x81086f0, 0xffb447b0) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/tcl/msgcat1.3/pkgIndex.tcl", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb44558) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "if {![package vsatisfies [packag"..., 4096) = 132
read(4, "", 4096) = 0
close(4) = 0
access("/usr/local/staden-linux-x86-1-7-0/lib/tcl/http2.4/pkgIndex.tcl", R_OK) = 0
stat64(0x8108930, 0xffb447b0) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/tcl/http2.4/pkgIndex.tcl", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb44558) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "# Tcl package index file, versio"..., 4096) = 726
read(4, "", 4096) = 0
close(4) = 0
access("/usr/local/staden-linux-x86-1-7-0/lib/tcl/opt0.4/pkgIndex.tcl", R_OK) = 0
stat64(0x8108b68, 0xffb447b0) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/tcl/opt0.4/pkgIndex.tcl", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb44558) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "# Tcl package index file, versio"..., 4096) = 605
read(4, "", 4096) = 0
close(4) = 0
access("/usr/local/staden-linux-x86-1-7-0/lib/tcl/tcltest2.2/pkgIndex.tcl", R_OK) = 0
stat64(0x8108dd0, 0xffb447b0) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/tcl/tcltest2.2/pkgIndex.tcl", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb44558) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "# Tcl package index file, versio"..., 4096) = 608
read(4, "", 4096) = 0
close(4) = 0
lstat64(0xffb43200, 0xffb42f9c) = 0
lstat64(0xffb43200, 0xffb42f9c) = 0
lstat64(0xffb43200, 0xffb42f9c) = 0
lstat64(0xffb43200, 0xffb42f9c) = 0
lstat64(0xffb43200, 0xffb42f9c) = 0
access("/usr/local/staden-linux-x86-1-7-0/lib/tcl/pkgIndex.tcl", R_OK) = -1 ENOENT (No such file or directory)
lstat64(0xffb44390, 0xffb4412c) = 0
lstat64(0xffb44390, 0xffb4412c) = 0
lstat64(0xffb44390, 0xffb4412c) = 0
lstat64(0xffb44390, 0xffb4412c) = 0
lstat64(0xffb44390, 0xffb4412c) = 0
lstat64(0xffb44390, 0xffb4412c) = 0
stat64(0x80d6010, 0xffb45580) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/tcl/msgcat1.3/msgcat.tcl", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb45328) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "# msgcat.tcl --\n#\n#\tThis file de"..., 4096) = 4096
read(4, "a_IN\n 50 mn\n 51 bo"..., 4096) = 4096
read(4, " $src\n }\n\n set ns [uplevel"..., 4096) = 4096
read(4, "re translations to the WinRegToI"..., 4096) = 396
read(4, "", 4096) = 0
close(4) = 0
brk(0x8148000) = 0x8148000
lstat64(0xffb43ef0, 0xffb43c8c) = 0
lstat64(0xffb43ef0, 0xffb43c8c) = 0
lstat64(0xffb43ef0, 0xffb43c8c) = 0
lstat64(0xffb43ef0, 0xffb43c8c) = 0
lstat64(0xffb43ef0, 0xffb43c8c) = 0
lstat64(0xffb43ef0, 0xffb43c8c) = 0
access("/usr/local/staden-linux-x86-1-7-0/lib/tk/msgs/en_us.msg", F_OK) = -1 ENOENT (No such file or directory)
lstat64(0xffb43ef0, 0xffb43c8c) = 0
lstat64(0xffb43ef0, 0xffb43c8c) = 0
lstat64(0xffb43ef0, 0xffb43c8c) = 0
lstat64(0xffb43ef0, 0xffb43c8c) = 0
lstat64(0xffb43ef0, 0xffb43c8c) = 0
lstat64(0xffb43ef0, 0xffb43c8c) = 0
access("/usr/local/staden-linux-x86-1-7-0/lib/tk/msgs/en.msg", F_OK) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/tk/msgs/en.msg", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb453b8) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "namespace eval ::tk {\n ::msgc"..., 4096) = 2540
read(4, "", 4096) = 0
close(4) = 0
lstat64(0xffb43fc0, 0xffb43d5c) = 0
lstat64(0xffb43fc0, 0xffb43d5c) = 0
lstat64(0xffb43fc0, 0xffb43d5c) = 0
lstat64(0xffb43fc0, 0xffb43d5c) = 0
lstat64(0xffb43fc0, 0xffb43d5c) = 0
stat64(0x811f9b0, 0xffb451b0) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/tk/button.tcl", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb44f58) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "# button.tcl --\n#\n# This file de"..., 4096) = 4096
read(4, "k::Priv\n if {[$w cget -state]"..., 4096) = 4096
read(4, "on is disabled.\n#\n# Arguments:\n#"..., 4096) = 4096
read(4, " $w configure -state active\n\t} "..., 4096) = 4096
read(4, "ked\n# through the keyboard. It "..., 4096) = 318
read(4, "", 4096) = 0
close(4) = 0
lstat64(0xffb43fc0, 0xffb43d5c) = 0
lstat64(0xffb43fc0, 0xffb43d5c) = 0
lstat64(0xffb43fc0, 0xffb43d5c) = 0
lstat64(0xffb43fc0, 0xffb43d5c) = 0
lstat64(0xffb43fc0, 0xffb43d5c) = 0
stat64(0x8110798, 0xffb451b0) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/tk/entry.tcl", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb44f58) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "# entry.tcl --\n#\n# This file def"..., 4096) = 4096
read(4, "etCursor %W 0\n}\nbind Entry <Shif"..., 4096) = 4096
read(4, " the button press.\n\nproc ::tk::E"..., 4096) = 4096
read(4, "\n EntrySeeInsert $w\n}\n\n# ::tk"..., 4096) = 4096
read(4, ")]} { set ::tk::Priv(x) $x }\n "..., 4096) = 641
read(4, "", 4096) = 0
close(4) = 0
lstat64(0xffb43fc0, 0xffb43d5c) = 0
lstat64(0xffb43fc0, 0xffb43d5c) = 0
lstat64(0xffb43fc0, 0xffb43d5c) = 0
lstat64(0xffb43fc0, 0xffb43d5c) = 0
lstat64(0xffb43fc0, 0xffb43d5c) = 0
stat64(0x810a180, 0xffb451b0) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/tk/listbox.tcl", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb44f58) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "# listbox.tcl --\n#\n# This file d"..., 4096) = 4096
read(4, "[%W index active]\n}\nbind Listbox"..., 4096) = 4096
read(4, " set $i\n\t\t}\n\t\tincr i -1\n\t }\n\t"..., 4096) = 4096
read(4, "oxMotion $w [$w index active]\n}\n"..., 4096) = 2110
read(4, "", 4096) = 0
close(4) = 0
lstat64(0xffb43fc0, 0xffb43d5c) = 0
lstat64(0xffb43fc0, 0xffb43d5c) = 0
lstat64(0xffb43fc0, 0xffb43d5c) = 0
lstat64(0xffb43fc0, 0xffb43d5c) = 0
lstat64(0xffb43fc0, 0xffb43d5c) = 0
stat64(0x810d0f8, 0xffb451b0) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/tk/menu.tcl", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb44f58) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "# menu.tcl --\n#\n# This file defi"..., 4096) = 4096
read(4, " tk::MbMotion %W up %X %Y\n}\nbind"..., 4096) = 4096
read(4, "rateMenuSelect $menu\n\n # If t"..., 4096) = 4096
read(4, "etely).\n\n catch {focus $Priv("..., 4096) = 4096
read(4, "l $menu $Priv(window)]} {\n\tif {["..., 4096) = 4096
read(4, "a cascade; this prevents\n\t# the "..., 4096) = 4096
read(4, "ndex last] \"none\"]} {\n\t break"..., 4096) = 4096
read(4, "oks for a menubutton with that c"..., 4096) = 4096
read(4, "\"\"]} {\n\t\t $menu postcascade $"..., 4096) = 4096
read(4, " menu entry to center over (x,y)"..., 4096) = 500
read(4, "", 4096) = 0
close(4) = 0
lstat64(0xffb43fc0, 0xffb43d5c) = 0
lstat64(0xffb43fc0, 0xffb43d5c) = 0
lstat64(0xffb43fc0, 0xffb43d5c) = 0
lstat64(0xffb43fc0, 0xffb43d5c) = 0
lstat64(0xffb43fc0, 0xffb43d5c) = 0
stat64(0x810a0f0, 0xffb451b0) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/tk/panedwindow.tcl", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb44f58) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "# panedwindow.tcl --\n#\n# This fi"..., 4096) = 4096
read(4, "# Arguments:\n# w\t\tthe widget\n#"..., 4096) = 945
read(4, "", 4096) = 0
close(4) = 0
lstat64(0xffb43fc0, 0xffb43d5c) = 0
lstat64(0xffb43fc0, 0xffb43d5c) = 0
lstat64(0xffb43fc0, 0xffb43d5c) = 0
lstat64(0xffb43fc0, 0xffb43d5c) = 0
lstat64(0xffb43fc0, 0xffb43d5c) = 0
stat64(0x8129fe8, 0xffb451b0) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/tk/scale.tcl", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb44f58) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "# scale.tcl --\n#\n# This file def"..., 4096) = 4096
read(4, "oords 0]}]\n\tset Priv(deltaY) [ex"..., 4096) = 3767
read(4, "", 4096) = 0
close(4) = 0
lstat64(0xffb43fc0, 0xffb43d5c) = 0
lstat64(0xffb43fc0, 0xffb43d5c) = 0
lstat64(0xffb43fc0, 0xffb43d5c) = 0
lstat64(0xffb43fc0, 0xffb43d5c) = 0
lstat64(0xffb43fc0, 0xffb43d5c) = 0
stat64(0x812beb8, 0xffb451b0) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/tk/scrlbar.tcl", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb44f58) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "# scrlbar.tcl --\n#\n# This file d"..., 4096) = 4096
read(4, " tk::ScrollButtonDown {w x y} {\n"..., 4096) = 4096
read(4, "position at the end of the drag "..., 4096) = 4064
read(4, "", 4096) = 0
close(4) = 0
lstat64(0xffb43fc0, 0xffb43d5c) = 0
lstat64(0xffb43fc0, 0xffb43d5c) = 0
lstat64(0xffb43fc0, 0xffb43d5c) = 0
lstat64(0xffb43fc0, 0xffb43d5c) = 0
lstat64(0xffb43fc0, 0xffb43d5c) = 0
stat64(0x812be78, 0xffb451b0) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/tk/spinbox.tcl", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb44f58) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "# spinbox.tcl --\n#\n# This file d"..., 4096) = 4096
read(4, "box <Control-Right> {\n ::tk::"..., 4096) = 4096
read(4, " set delay [$w cget -repeatint"..., 4096) = 4096
read(4, "dBreakAfter [$w get] [expr {$anc"..., 4096) = 2873
read(4, "", 4096) = 0
close(4) = 0
lstat64(0xffb43fc0, 0xffb43d5c) = 0
lstat64(0xffb43fc0, 0xffb43d5c) = 0
lstat64(0xffb43fc0, 0xffb43d5c) = 0
lstat64(0xffb43fc0, 0xffb43d5c) = 0
lstat64(0xffb43fc0, 0xffb43d5c) = 0
stat64(0x812ffc0, 0xffb451b0) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/tk/text.tcl", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb44f58) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "# text.tcl --\n#\n# This file defi"..., 4096) = 4096
read(4, "rt]\n}\nbind Text <Prior> {\n tk"..., 4096) = 4096
read(4, "extSetCursor %W [tk::TextUpDownL"..., 4096) = 4096
read(4, " Text <5> {\n\tif {!$tk_strictMoti"..., 4096) = 4096
read(4, "\n $w tag remove sel $last end"..., 4096) = 4096
brk(0x816a000) = 0x816a000
read(4, "ex $index]\n set b [$w index s"..., 4096) = 4096
read(4, "et pos [$w index \"$pos + 1 line\""..., 4096) = 4096
read(4, "ext position.\n\nproc ::tk::TextNe"..., 4096) = 2699
read(4, "", 4096) = 0
close(4) = 0
lstat64(0xffb46be0, 0xffb4697c) = 0
lstat64(0xffb46be0, 0xffb4697c) = 0
lstat64(0xffb46be0, 0xffb4697c) = 0
lstat64(0xffb46be0, 0xffb4697c) = 0
lstat64(0xffb46be0, 0xffb4697c) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/tk/tclIndex", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb47bb8) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "# Tcl autoload index file, versi"..., 4096) = 4096
read(4, "]]\nset auto_index(::tk::FocusGro"..., 4096) = 4096
read(4, "::tk::MenuDownArrow) [list sourc"..., 4096) = 4096
read(4, " [list source [file join $dir sp"..., 4096) = 4096
read(4, "\nset auto_index(::tk::IconList_A"..., 4096) = 4096
read(4, "_InterpFilter) [list source [fil"..., 4096) = 1730
read(4, "", 4096) = 0
close(4) = 0
lstat64(0xffb46be0, 0xffb4697c) = 0
lstat64(0xffb46be0, 0xffb4697c) = 0
lstat64(0xffb46be0, 0xffb4697c) = 0
lstat64(0xffb46be0, 0xffb4697c) = 0
lstat64(0xffb46be0, 0xffb4697c) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/tk_utils/tclIndex", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb47bb8) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "# Tcl autoload index file, versi"..., 4096) = 4096
read(4, "_def) [list source [file join $d"..., 4096) = 4096
read(4, "ndex(CheckFloatRange) [list sour"..., 4096) = 4096
read(4, "ist source [file join $dir html_"..., 4096) = 4096
read(4, "its) [list source [file join $di"..., 4096) = 4096
read(4, " [list source [file join $dir ca"..., 4096) = 4096
read(4, "yme_map.tcl]]\nset auto_index(Sel"..., 4096) = 4096
read(4, "set auto_index(spBiolimsDialog_I"..., 4096) = 4096
read(4, "index(::Widget::Xmclistbox::_bin"..., 4096) = 4096
read(4, "extract_element_name) [list sour"..., 4096) = 4096
read(4, "_element_different) [list source"..., 4096) = 1259
read(4, "", 4096) = 0
close(4) = 0
lstat64(0xffb46be0, 0xffb4697c) = 0
lstat64(0xffb46be0, 0xffb4697c) = 0
lstat64(0xffb46be0, 0xffb4697c) = 0
open("/usr/local/lib/tclIndex", O_RDONLY|O_LARGEFILE) = -1 ENOENT (No such file or directory)
lstat64(0xffb46be0, 0xffb4697c) = 0
lstat64(0xffb46be0, 0xffb4697c) = 0
lstat64(0xffb46be0, 0xffb4697c) = 0
lstat64(0xffb46be0, 0xffb4697c) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/tclIndex", O_RDONLY|O_LARGEFILE) = -1 ENOENT (No such file or directory)
lstat64(0xffb46be0, 0xffb4697c) = 0
lstat64(0xffb46be0, 0xffb4697c) = 0
lstat64(0xffb46be0, 0xffb4697c) = 0
lstat64(0xffb46be0, 0xffb4697c) = 0
lstat64(0xffb46be0, 0xffb4697c) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/tcl/tclIndex", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb47bb8) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "# Tcl autoload index file, versi"..., 4096) = 4096
read(4, ") [list source [file join $dir s"..., 4096) = 1913
read(4, "", 4096) = 0
close(4) = 0
lstat64(0xffb47ec0, 0xffb47c5c) = 0
lstat64(0xffb47ec0, 0xffb47c5c) = 0
lstat64(0xffb47ec0, 0xffb47c5c) = 0
lstat64(0xffb47ec0, 0xffb47c5c) = 0
stat64(0x80bffc8, 0xffb490b0) = 0
open("/usr/local/staden-linux-x86-1-7-0/tables/shlib.conf", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb48e58) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "switch -glob \"$env(MACHINE)\" {\n "..., 4096) = 839
read(4, "", 4096) = 0
close(4) = 0
lstat64(0xffb47bb0, 0xffb4794c) = 0
lstat64(0xffb47bb0, 0xffb4794c) = 0
lstat64(0xffb47bb0, 0xffb4794c) = 0
lstat64(0xffb47bb0, 0xffb4794c) = 0
lstat64(0xffb47bb0, 0xffb4794c) = 0
lstat64(0xffb470f0, 0xffb46e8c) = 0
lstat64(0xffb470f0, 0xffb46e8c) = 0
lstat64(0xffb470f0, 0xffb46e8c) = 0
lstat64(0xffb470f0, 0xffb46e8c) = 0
lstat64(0xffb470f0, 0xffb46e8c) = 0
stat64(0x8145b08, 0xffb482e0) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/tk_utils/user_defaults.tcl", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb48088) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "#\n# Copyright (c) Medical Resear"..., 4096) = 4096
read(4, "${lib_prefix}${name}${lib_suffix"..., 4096) = 3321
read(4, "", 4096) = 0
close(4) = 0
lstat64(0xffb46cb0, 0xffb46a4c) = 0
lstat64(0xffb46cb0, 0xffb46a4c) = 0
lstat64(0xffb46cb0, 0xffb46a4c) = 0
lstat64(0xffb46cb0, 0xffb46a4c) = 0
stat64(0x8145d10, 0xffb47ea0) = 0
open("/usr/local/staden-linux-x86-1-7-0/tables/shlib.conf", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb47c48) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "switch -glob \"$env(MACHINE)\" {\n "..., 4096) = 839
read(4, "", 4096) = 0
close(4) = 0
lstat64(0xffb461f0, 0xffb45f8c) = 0
lstat64(0xffb461f0, 0xffb45f8c) = 0
access("/home/kamini/.tk_utilsrc", F_OK) = -1 ENOENT (No such file or directory)
getcwd("/home/kamini/STADEN", 4097) = 20
lstat64(0xffb461c0, 0xffb45f5c) = 0
lstat64(0xffb461c0, 0xffb45f5c) = 0
lstat64(0xffb461f0, 0xffb45f8c) = 0
lstat64(0xffb461f0, 0xffb45f8c) = 0
lstat64(0xffb461f0, 0xffb45f8c) = 0
access("/home/kamini/STADEN/.tk_utilsrc", F_OK) = -1 ENOENT (No such file or directory)
lstat64(0xffb461f0, 0xffb45f8c) = 0
lstat64(0xffb461f0, 0xffb45f8c) = 0
lstat64(0xffb461f0, 0xffb45f8c) = 0
lstat64(0xffb461f0, 0xffb45f8c) = 0
access("/usr/local/staden-linux-x86-1-7-0/tables/tk_utilsrc", F_OK) = 0
stat64(0x81585f8, 0xffb47560) = 0
open("/usr/local/staden-linux-x86-1-7-0/tables/tk_utilsrc", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb47308) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "#global auto_path\n#lappend auto_"..., 4096) = 4096
read(4, "\nset_def R_ENZ.E_FILE.3 "..., 4096) = 4096
read(4, "\t.scale_y\nset_def RASTER.SCALEX."..., 4096) = 2816
read(4, "", 4096) = 0
close(4) = 0
lstat64(0xffb45160, 0xffb44efc) = 0
lstat64(0xffb45160, 0xffb44efc) = 0
lstat64(0xffb45160, 0xffb44efc) = 0
lstat64(0xffb45160, 0xffb44efc) = 0
lstat64(0xffb45160, 0xffb44efc) = 0
stat64(0x815f260, 0xffb46350) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/tk_utils/menu.tcl", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb460f8) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "#\n# Copyright (c) Medical Resear"..., 4096) = 4096
read(4, "\"\" && \\\n\t\t\t[lsearch -exact [lind"..., 4096) = 4096
read(4, "\t\t\t-state [lindex {disabled norm"..., 4096) = 4096
read(4, "tore {menu menu_name state {firs"..., 4096) = 2188
read(4, "", 4096) = 0
close(4) = 0
lstat64(0xffb461f0, 0xffb45f8c) = 0
lstat64(0xffb461f0, 0xffb45f8c) = 0
lstat64(0xffb461f0, 0xffb45f8c) = 0
lstat64(0xffb461f0, 0xffb45f8c) = 0
access("/usr/local/staden-linux-x86-1-7-0/tables/tk_utilsrc.local", F_OK) = -1 ENOENT (No such file or directory)
lstat64(0xffb461f0, 0xffb45f8c) = 0
lstat64(0xffb461f0, 0xffb45f8c) = 0
access("/home/kamini/.tk_utilsrc", F_OK) = -1 ENOENT (No such file or directory)
lstat64(0xffb461f0, 0xffb45f8c) = 0
lstat64(0xffb461f0, 0xffb45f8c) = 0
access("/home/kamini/.tk_utilsrc.local", F_OK) = -1 ENOENT (No such file or directory)
lstat64(0xffb46120, 0xffb45ebc) = 0
lstat64(0xffb46120, 0xffb45ebc) = 0
getcwd("/home/kamini/STADEN", 4097) = 20
lstat64(0xffb461c0, 0xffb45f5c) = 0
lstat64(0xffb461c0, 0xffb45f5c) = 0
lstat64(0xffb461f0, 0xffb45f8c) = 0
lstat64(0xffb461f0, 0xffb45f8c) = 0
lstat64(0xffb461f0, 0xffb45f8c) = 0
access("/home/kamini/STADEN/.tk_utilsrc", F_OK) = -1 ENOENT (No such file or directory)
getcwd("/home/kamini/STADEN", 4097) = 20
lstat64(0xffb461c0, 0xffb45f5c) = 0
lstat64(0xffb461c0, 0xffb45f5c) = 0
lstat64(0xffb461f0, 0xffb45f8c) = 0
lstat64(0xffb461f0, 0xffb45f8c) = 0
lstat64(0xffb461f0, 0xffb45f8c) = 0
access("/home/kamini/STADEN/.tk_utilsrc.local", F_OK) = -1 ENOENT (No such file or directory)
lstat64(0xffb470f0, 0xffb46e8c) = 0
lstat64(0xffb470f0, 0xffb46e8c) = 0
lstat64(0xffb470f0, 0xffb46e8c) = 0
lstat64(0xffb470f0, 0xffb46e8c) = 0
lstat64(0xffb470f0, 0xffb46e8c) = 0
stat64(0x8169748, 0xffb482e0) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/tk_utils/init.tcl", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb48088) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "#\n# Copyright (c) Medical Resear"..., 4096) = 4096
read(4, "t>\n event add <<paste>>\t\t\t<Co"..., 4096) = 4096
read(4, "l userDefault\n\toption add *Text."..., 4096) = 1407
brk(0x818e000) = 0x818e000
read(4, "", 4096) = 0
close(4) = 0
lstat64(0xffb45bf0, 0xffb4598c) = 0
lstat64(0xffb45bf0, 0xffb4598c) = 0
lstat64(0xffb45bf0, 0xffb4598c) = 0
lstat64(0xffb45bf0, 0xffb4598c) = 0
lstat64(0xffb45bf0, 0xffb4598c) = 0
stat64(0x816fb28, 0xffb46de0) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/tk/palette.tcl", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb46b88) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "# palette.tcl --\n#\n# This file c"..., 4096) = 4096
read(4, "n database changes that need to "..., 4096) = 4096
read(4, " None.\n\nproc ::tk_bisque {} {\n "..., 4096) = 356
read(4, "", 4096) = 0
close(4) = 0
write(3, "\20\0\4\0\10\0\0\0MULTIPLE", 16) = 16
read(3, "\1e\30\0\0\0\0\0\23\1\0\0\0\0\0\0\0\0\0\0\0\0\0\0\224>"..., 32) = 32
write(3, "\20\0\3\0\4\0\0\0INCR", 12) = 12
read(3, "\1e\31\0\0\0\0\0\20\1\0\0\0\0\0\0\0\0\0\0\0\0\0\0\224>"..., 32) = 32
write(3, "\20\0\4\0\7\0\0\0TARGETSE", 16) = 16
read(3, "\1e\32\0\0\0\0\0\26\1\0\0\0\0\0\0\0\0\0\0\0\0\0\0\224>"..., 32) = 32
write(3, "\20\0\5\0\t\0\0\0TIMESTAMP\0\0\0", 20) = 20
read(3, "\1e\33\0\0\0\0\0\27\1\0\0\0\0\0\0\0\0\0\0\0\0\0\0\224>"..., 32) = 32
write(3, "\20\0\3\0\4\0\0\0TEXT", 12) = 12
read(3, "\1e\34\0\0\0\0\0\203\1\0\0\0\0\0\0\0\0\0\0\0\0\0\0\224"..., 32) = 32
write(3, "\20\0\6\0\r\0\0\0COMPOUND_TEXT\31\0\0", 24) = 24
read(3, "\1e\35\0\0\0\0\0\5\1\0\0\0\0\0\0\0\0\0\0\0\0\0\0\224>\0"..., 32) = 32
write(3, "\20\0\5\0\t\0\0\0TK_WINDOWTEX", 20) = 20
read(3, "\1e\36\0\0\0\0\0\204\1\0\0\0\0\0\0\0\0\0\0\0\0\0\0\224"..., 32) = 32
write(3, "\20\0\5\0\t\0\0\0CLIPBOARDTEX", 20) = 20
read(3, "\1e\37\0\0\0\0\0\16\1\0\0\0\0\0\0\0\0\0\0\0\0\0\0\224>"..., 32) = 32
write(3, "\20\0\5\0\v\0\0\0UTF8_STRINGX", 20) = 20
read(3, "\1e \0\0\0\0\0\347\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\224>\0"..., 32) = 32
open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libXcursor.so.1", O_RDONLY) = -1 ENOENT (No such file or directory)
open("/etc/ld.so.cache", O_RDONLY) = 4
fstat64(0x4, 0xffb4795c) = 0
mmap2(NULL, 183737, PROT_READ, MAP_PRIVATE, 4, 0) = 0xfffffffff7a74000
close(4) = 0
open("/usr/lib/libXcursor.so.1", O_RDONLY) = 4
read(4, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0\300\0\311"..., 512) = 512
fstat64(0x4, 0xffb479c0) = 0
mmap2(0xc8e000, 39660, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 4, 0) = 0xc8e000
mmap2(0xc97000, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 4, 0x8) = 0xc97000
close(4) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libXrender.so.1", O_RDONLY) = -1 ENOENT (No such file or directory)
open("/usr/lib/libXrender.so.1", O_RDONLY) = 4
read(4, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0p\302\314"..., 512) = 512
fstat64(0x4, 0xffb477c4) = 0
mmap2(0xccb000, 33960, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 4, 0) = 0xccb000
mmap2(0xcd3000, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 4, 0x7) = 0xcd3000
close(4) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libXfixes.so.3", O_RDONLY) = -1 ENOENT (No such file or directory)
open("/usr/lib/libXfixes.so.3", O_RDONLY) = 4
read(4, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0 \36\20"..., 512) = 512
fstat64(0x4, 0xffb477a8) = 0
mmap2(0x101000, 18744, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 4, 0) = 0x101000
mmap2(0x105000, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 4, 0x3) = 0x105000
close(4) = 0
munmap(0xf7a74000, 183737) = 0
writev(3, [{"-\0\5\0\3\0\0\3\6\0F8cursorGXb\31\4\0\6\0AT", 28}, {"RENDER", 6}, {"\0\0", 2}], 3) = 36
read(3, "\1e\"\0\0\0\0\0\1\231\0\263\0\0\0\0\0\0\0\0\0\0\0\0\250"..., 32) = 32
write(3, "\231\0\3\0\0\0\0\0\n\0\0\0\231\1\1\0", 16) = 16
read(3, "\1e#\0\0\0\0\0\0\0\0\0\n\0\0\0\0\0\0\0\0\0\0\0\250>\0\0"..., 32) = 32
read(3, "\1\237$\0\265\0\0\0\26\0\0\0\1\0\0\0\7\0\0\0\5\0\0\0\1"..., 32) = 32
read(3, "&\0\0\0\1\1\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\1\0\0\0\0\0"..., 724) = 724
uname({sys="Linux", node="mkbpc86", ...}) = 0
open("/home/kamini/.Xdefaults-mkbpc86", O_RDONLY) = -1 ENOENT (No such file or directory)
writev(3, [{"b\0\6\0\17\0\0\0", 8}, {"XFree86-Bigfont", 15}, {"\0", 1}], 3) = 24
read(3, "\1e%\0\0\0\0\0\1\230\0\0\0\0\0\0\0\0\0\0\0\0\0\0\250>\0"..., 32) = 32
write(3, "\230\0\1\0", 4) = 4
read(3, "\1\1&\0\0\0\0\0\1\0\1\0\0\0\0\0\0\0\0\0a+9\233\250>\0\0"..., 32) = 32
write(3, "\230\1\3\0\3\0\0\3\1\0\0\0", 12) = 12
read(3, "\1\0\'\0\263\1\0\0\361\377\0\0\n\0\377\377\0\0\0\0*\0*"..., 32) = 32
read(3, "\20\0\0\0*\0*\0\0\0\231\0\0\0\t\0\0\0\0\1\20\0\21\0\232"..., 40) = 40
read(3, "=\0\0\0\335\0\0\0;\0\0\0006\1\0\0\22\0\0\0\336\0\0\0:\0"..., 72) = 72
read(3, "\372\377\10\0\21\0\6\0\10\0\0\0\371\377\t\0\21\0\7\0\t"..., 1628) = 1628
write(3, "\20\0\4\0\6\0\0\3cursor\1\0", 16) = 16
read(3, "\1e(\0\0\0\0\0\336\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\250>\0"..., 32) = 32
open("/home/kamini/.icons/Bluecurve/cursors/xterm", O_RDONLY) = -1 ENOENT (No such file or directory)
open("/home/kamini/.icons/Bluecurve/index.theme", O_RDONLY) = -1 ENOENT (No such file or directory)
open("/usr/share/icons/Bluecurve/cursors/xterm", O_RDONLY) = 4
fstat64(0x4, 0xffb47d7c) = 0
mmap2(NULL, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_ANONYMOUS, -1, 0) = 0xfffffffff7aa0000
read(4, "Xcur\20\0\0\0\0\0\1\0\3\0\0\0\2\0\375\377\30\0\0\0004\0"..., 4096) = 4096
_llseek(4, 0, [0], SEEK_SET) = 0
read(4, "Xcur\20\0\0\0\0\0\1\0\3\0\0\0\2\0\375\377\30\0\0\0004\0"..., 4096) = 4096
close(4) = 0
munmap(0xf7aa0000, 4096) = 0
writev(3, [{"5 \4\0\4\0\0\3?\0\0\0\f\0\30\0007r\4\0\5\0\0\3\4\0\0\3"..., 1276}, {"XFIXES", 6}, {"\0\0", 2}], 3) = 1284
read(3, "\1e1\0\0\0\0\0\1\227p\262\0\0\0\0\0\0\0\0\0\0\0\0\250>"..., 32) = 32
write(3, "\227\0\3\0\4\0\0\0\0\0\0\0", 12) = 12
read(3, "\1e2\0\0\0\0\0\4\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\250>\0\0"..., 32) = 32
write(3, "\227\27\5\0\7\0\0\3\5\0\0\0xtermr\4\0007\0\5\0\10\0\0\3"..., 56) = 56
read(3, "\1\0005\0\0\0\0\0\243\243\243\243\243\243\0\0\243\243\243"..., 32) = 32
writev(3, [{"1\27\v\0\20\'\"\0", 8}, {"-*-Courier-*-*-*-*-*-*-*-*-*-*-*"..., 34}, {"\0\0", 2}], 3) = 44
read(3, 0xffb47e4c, 32) = -1 EAGAIN (Resource temporarily unavailable)
poll([{fd=3, events=POLLIN, revents=POLLIN}], 1, 4294967295) = 1
read(3, "\1\0006\0H\10\0\0\220\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0"..., 32) = 32
readv(3, [{"7-adobe-courier-bold-o-normal--8"..., 8480}, {"", 0}], 2) = 8480
write(3, "-\27\22\0\t\0\0\3;\0\0\0-adobe-courier-mediu"..., 84) = 84
read(3, 0xffb47d74, 32) = -1 EAGAIN (Resource temporarily unavailable)
poll([{fd=3, events=POLLIN, revents=POLLIN}], 1, 4294967295) = 1
read(3, "\1\0008\0\225\1\0\0\0\0\1\0\7\0\376\377\371\377\0\0\377"..., 32) = 32
read(3, "\3\0\0\0\0\0\0\0\0\0\377\0\0\0\33\0\0\0\0\0\n\0\3\0\0\1"..., 40) = 40
read(3, "\275\0\0\0\205\1\0\0@\0\0\0\206\1\0\0\276\0\0\0\325\0\0"..., 216) = 216
read(3, "\0\0\7\0\7\0\7\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\1"..., 1364) = 1364
write(3, "\21\27\2\0\217\1\0\0", 8) = 8
read(3, "\1\0009\0\17\0\0\0;\0|\0\0\0\0\0\360e\356\261\377\177\0"..., 32) = 32
readv(3, [{"-Adobe-Courier-Medium-R-Normal--"..., 59}, {"\0", 1}], 2) = 60
write(3, "T\27\4\0 \0\0\0\0\0\0\0\0\0do", 16) = 16
read(3, "\1\0:\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\377\177\0\0\300"..., 32) = 32
write(3, "T\27\4\0 \0\0\0\0\377\0\377\0\377do", 16) = 16
read(3, "\1\0;\0\0\0\0\0\377\377\377\377\377\377\0\0\377\377\377"..., 32) = 32
write(3, "7\27\4\0\n\0\0\3?\0\0\0\0\0\0\0Te\4\0 \0\0\0\0U\0\230\0"..., 32) = 32
read(3, "\1\0=\0\0\0\0\0UU\230\230\327\327\0\0\327\230U\0\377\177"..., 32) = 32
writev(3, [{"7\27\5\0\v\0\0\3?\0\0\0\4\0\0\0\327\230U\0007\0\6\0\f\0"..., 96}, {"-*-Helvetica-*-*-*-*-*-*-*-*-*-*"..., 36}], 2) = 132
read(3, "\1\244B\0\337\5\0\0`\0x\6\0\0\0\0`\244x\6\0\0\0\0x\244"..., 32) = 32
readv(3, [{"9-adobe-helvetica-bold-o-normal-"..., 6012}, {"", 0}], 2) = 6012
write(3, "-\27\22\0\17\0\0\3;\0\0\0-adobe-helvetica-bol"..., 84) = 84
read(3, 0xffb47d54, 32) = -1 EAGAIN (Resource temporarily unavailable)
poll([{fd=3, events=POLLIN, revents=POLLIN}], 1, 4294967295) = 1
read(3, "\1\0D\0\335\1\0\0\377\377\1\0\3\0\376\377\370\377\0\0\0"..., 32) = 32
read(3, "\3\0\0\0\0\0\0\0\0\0\377\0\0\0\33\0\0\0\0\0\v\0\3\0\0\1"..., 40) = 40
read(3, "\275\0\0\0\205\1\0\0@\0\0\0\220\1\0\0\276\0\0\0\221\1\0"..., 216) = 216
read(3, "\1\0\10\0\t\0\t\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\1"..., 1652) = 1652
write(3, "\21\27\2\0\226\1\0\0", 8) = 8
read(3, "\1\0E\0\17\0\0\0;\0|\0\0\0\0\0\360e\356\261\377\177\0\0"..., 32) = 32
readv(3, [{"-Adobe-Helvetica-Bold-R-Normal--"..., 59}, {"\0", 1}], 2) = 60
uname({sys="Linux", node="mkbpc86", ...}) = 0
gettimeofday({1196950288, 828776}, {4294967176, 0}) = 0
write(3, "7\27\7\0\20\0\0\3?\0\0\0\10@\1\0\343\351\355\0\17\0\0\3"..., 432) = 432
read(3, "\1eX\0\0\0\0\0\351\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\274>\0"..., 32) = 32
lstat64(0xffb46a20, 0xffb467bc) = 0
lstat64(0xffb46a20, 0xffb467bc) = 0
access("/home/kamini/.gaprc", F_OK) = -1 ENOENT (No such file or directory)
getcwd("/home/kamini/STADEN", 4097) = 20
lstat64(0xffb469f0, 0xffb4678c) = 0
lstat64(0xffb469f0, 0xffb4678c) = 0
lstat64(0xffb46a20, 0xffb467bc) = 0
lstat64(0xffb46a20, 0xffb467bc) = 0
lstat64(0xffb46a20, 0xffb467bc) = 0
access("/home/kamini/STADEN/.gaprc", F_OK) = -1 ENOENT (No such file or directory)
lstat64(0xffb46a20, 0xffb467bc) = 0
lstat64(0xffb46a20, 0xffb467bc) = 0
lstat64(0xffb46a20, 0xffb467bc) = 0
lstat64(0xffb46a20, 0xffb467bc) = 0
access("/usr/local/staden-linux-x86-1-7-0/tables/gaprc", F_OK) = 0
stat64(0x80bf9f0, 0xffb47d90) = 0
open("/usr/local/staden-linux-x86-1-7-0/tables/gaprc", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb47b38) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "#-------------------------------"..., 4096) = 4096
read(4, "R.FONT_MB\t\t{-*-helvetica-*-r-*-*"..., 4096) = 4096
read(4, "R.STATUS_FRAME2P\t0\nset_def CONTI"..., 4096) = 4096
read(4, "set_def\tTEMPLATE.PLOT_HEIGHT\t\t40"..., 4096) = 4096
read(4, "s of failures\"\nset_defx defs_for"..., 4096) = 4096
read(4, "S.SAVENAME.NAME\t\"File name\"\nset_"..., 4096) = 4096
read(4, "f AUTO_ASSEMBLE.MISMATCH.MIN\t0.0"..., 4096) = 4096
read(4, "me\"\nset_def LOAD_LIST.LISTNAME\t\t"..., 4096) = 4096
read(4, "E.NAME\t\t\"Trace filename\"\nset_def"..., 4096) = 4096
brk(0x81b7000) = 0x81b7000
brk(0x81af000) = 0x81af000
read(4, "\n\nset_def FIND_PROBES.OLIGOSIZE."..., 4096) = 4096
read(4, "IDTH\t100\nset_def R_ENZ.PLOT_HEIG"..., 4096) = 4096
read(4, "verage\nset_def STRAND_COVERAGE.C"..., 4096) = 1945
read(4, "", 4096) = 0
close(4) = 0
lstat64(0xffb452c0, 0xffb4505c) = 0
lstat64(0xffb452c0, 0xffb4505c) = 0
access("/home/kamini/.copy_readsrc", F_OK) = -1 ENOENT (No such file or directory)
getcwd("/home/kamini/STADEN", 4097) = 20
lstat64(0xffb45290, 0xffb4502c) = 0
lstat64(0xffb45290, 0xffb4502c) = 0
lstat64(0xffb452c0, 0xffb4505c) = 0
lstat64(0xffb452c0, 0xffb4505c) = 0
lstat64(0xffb452c0, 0xffb4505c) = 0
access("/home/kamini/STADEN/.copy_readsrc", F_OK) = -1 ENOENT (No such file or directory)
lstat64(0xffb452c0, 0xffb4505c) = 0
lstat64(0xffb452c0, 0xffb4505c) = 0
lstat64(0xffb452c0, 0xffb4505c) = 0
lstat64(0xffb452c0, 0xffb4505c) = 0
access("/usr/local/staden-linux-x86-1-7-0/tables/copy_readsrc", F_OK) = 0
stat64(0x815c410, 0xffb46630) = 0
open("/usr/local/staden-linux-x86-1-7-0/tables/copy_readsrc", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb463d8) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "#-------------------------------"..., 4096) = 2570
read(4, "", 4096) = 0
close(4) = 0
lstat64(0xffb452c0, 0xffb4505c) = 0
lstat64(0xffb452c0, 0xffb4505c) = 0
lstat64(0xffb452c0, 0xffb4505c) = 0
lstat64(0xffb452c0, 0xffb4505c) = 0
access("/usr/local/staden-linux-x86-1-7-0/tables/copy_readsrc.local", F_OK) = -1 ENOENT (No such file or directory)
lstat64(0xffb452c0, 0xffb4505c) = 0
lstat64(0xffb452c0, 0xffb4505c) = 0
access("/home/kamini/.copy_readsrc", F_OK) = -1 ENOENT (No such file or directory)
lstat64(0xffb452c0, 0xffb4505c) = 0
lstat64(0xffb452c0, 0xffb4505c) = 0
access("/home/kamini/.copy_readsrc.local", F_OK) = -1 ENOENT (No such file or directory)
getcwd("/home/kamini/STADEN", 4097) = 20
lstat64(0xffb45290, 0xffb4502c) = 0
lstat64(0xffb45290, 0xffb4502c) = 0
lstat64(0xffb452c0, 0xffb4505c) = 0
lstat64(0xffb452c0, 0xffb4505c) = 0
lstat64(0xffb452c0, 0xffb4505c) = 0
access("/home/kamini/STADEN/.copy_readsrc", F_OK) = -1 ENOENT (No such file or directory)
getcwd("/home/kamini/STADEN", 4097) = 20
lstat64(0xffb45290, 0xffb4502c) = 0
lstat64(0xffb45290, 0xffb4502c) = 0
lstat64(0xffb452c0, 0xffb4505c) = 0
lstat64(0xffb452c0, 0xffb4505c) = 0
lstat64(0xffb452c0, 0xffb4505c) = 0
access("/home/kamini/STADEN/.copy_readsrc.local", F_OK) = -1 ENOENT (No such file or directory)
getcwd("/home/kamini/STADEN", 4097) = 20
lstat64(0xffb458e0, 0xffb4567c) = 0
lstat64(0xffb458e0, 0xffb4567c) = 0
lstat64(0xffb45910, 0xffb456ac) = 0
lstat64(0xffb45910, 0xffb456ac) = 0
lstat64(0xffb45910, 0xffb456ac) = 0
open("/home/kamini/STADEN/libcopy_reads.so", O_RDONLY) = -1 ENOENT (No such file or directory)
open("/usr/local/lib/tls/i686/sse2/libcopy_reads.so", O_RDONLY) = -1 ENOENT (No such file or directory)
stat64(0xffb46270, 0xffb46300) = -1 ENOENT (No such file or directory)
open("/usr/local/lib/tls/i686/libcopy_reads.so", O_RDONLY) = -1 ENOENT (No such file or directory)
stat64(0xffb46270, 0xffb46300) = -1 ENOENT (No such file or directory)
open("/usr/local/lib/tls/sse2/libcopy_reads.so", O_RDONLY) = -1 ENOENT (No such file or directory)
stat64(0xffb46270, 0xffb46300) = -1 ENOENT (No such file or directory)
open("/usr/local/lib/tls/libcopy_reads.so", O_RDONLY) = -1 ENOENT (No such file or directory)
stat64(0xffb46270, 0xffb46300) = -1 ENOENT (No such file or directory)
open("/usr/local/lib/i686/sse2/libcopy_reads.so", O_RDONLY) = -1 ENOENT (No such file or directory)
stat64(0xffb46270, 0xffb46300) = -1 ENOENT (No such file or directory)
open("/usr/local/lib/i686/libcopy_reads.so", O_RDONLY) = -1 ENOENT (No such file or directory)
stat64(0xffb46270, 0xffb46300) = -1 ENOENT (No such file or directory)
open("/usr/local/lib/sse2/libcopy_reads.so", O_RDONLY) = -1 ENOENT (No such file or directory)
stat64(0xffb46270, 0xffb46300) = -1 ENOENT (No such file or directory)
open("/usr/local/lib/libcopy_reads.so", O_RDONLY) = -1 ENOENT (No such file or directory)
stat64(0xffb46270, 0xffb46300) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libcopy_reads.so", O_RDONLY) = 4
read(4, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0P\33\0\000"..., 512) = 512
fstat64(0x4, 0xffb462f0) = 0
mmap2(NULL, 23076, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 4, 0) = 0xfffffffff7a9b000
mmap2(0xf7aa0000, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 4, 0x4) = 0xfffffffff7aa0000
close(4) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libseq_utils.so", O_RDONLY) = 4
read(4, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0\220@\0"..., 512) = 512
fstat64(0x4, 0xffb46068) = 0
mmap2(NULL, 208800, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 4, 0) = 0xfffffffff7a68000
mmap2(0xf7a86000, 12288, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 4, 0x1d) = 0xfffffffff7a86000
mmap2(0xf7a89000, 73632, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_ANONYMOUS, -1, 0) = 0xfffffffff7a89000
close(4) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libgap.so", O_RDONLY) = 4
read(4, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0\300\271"..., 512) = 512
fstat64(0x4, 0xffb46014) = 0
mmap2(NULL, 2489824, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 4, 0) = 0xfffffffff7808000
mmap2(0xf78e4000, 24576, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 4, 0xdb) = 0xfffffffff78e4000
mmap2(0xf78ea000, 1564128, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_ANONYMOUS, -1, 0) = 0xfffffffff78ea000
close(4) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libg2c.so.0", O_RDONLY) = -1 ENOENT (No such file or directory)
open("/etc/ld.so.cache", O_RDONLY) = 4
fstat64(0x4, 0xffb45f94) = 0
mmap2(NULL, 183737, PROT_READ, MAP_PRIVATE, 4, 0) = 0xfffffffff7e1e000
close(4) = 0
open("/lib/i686/libg2c.so.0", O_RDONLY) = -1 ENOENT (No such file or directory)
open("/lib/libg2c.so.0", O_RDONLY) = -1 ENOENT (No such file or directory)
open("/usr/lib/sse2/libg2c.so.0", O_RDONLY) = -1 ENOENT (No such file or directory)
open("/usr/lib/libg2c.so.0", O_RDONLY) = -1 ENOENT (No such file or directory)
munmap(0xf7e1e000, 183737) = 0
munmap(0xf7a9b000, 23076) = 0
munmap(0xf7a68000, 208800) = 0
munmap(0xf7808000, 2489824) = 0
lstat64(0xffb44fd0, 0xffb44d6c) = 0
lstat64(0xffb44fd0, 0xffb44d6c) = 0
access("/home/kamini/.iwidgetsrc", F_OK) = -1 ENOENT (No such file or directory)
getcwd("/home/kamini/STADEN", 4097) = 20
lstat64(0xffb44fa0, 0xffb44d3c) = 0
lstat64(0xffb44fa0, 0xffb44d3c) = 0
lstat64(0xffb44fd0, 0xffb44d6c) = 0
lstat64(0xffb44fd0, 0xffb44d6c) = 0
lstat64(0xffb44fd0, 0xffb44d6c) = 0
access("/home/kamini/STADEN/.iwidgetsrc", F_OK) = -1 ENOENT (No such file or directory)
lstat64(0xffb44fd0, 0xffb44d6c) = 0
lstat64(0xffb44fd0, 0xffb44d6c) = 0
lstat64(0xffb44fd0, 0xffb44d6c) = 0
lstat64(0xffb44fd0, 0xffb44d6c) = 0
access("/usr/local/staden-linux-x86-1-7-0/tables/iwidgetsrc", F_OK) = 0
stat64(0x817df30, 0xffb46340) = 0
open("/usr/local/staden-linux-x86-1-7-0/tables/iwidgetsrc", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb460e8) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "set tcl_pkgPath \"\"\nif {\"$tcl_pla"..., 4096) = 428
read(4, "", 4096) = 0
close(4) = 0
lstat64(0xffb43580, 0xffb4331c) = 0
lstat64(0xffb43580, 0xffb4331c) = 0
access("/home/kamini/.itcl3.3rc", F_OK) = -1 ENOENT (No such file or directory)
getcwd("/home/kamini/STADEN", 4097) = 20
lstat64(0xffb43550, 0xffb432ec) = 0
lstat64(0xffb43550, 0xffb432ec) = 0
lstat64(0xffb43580, 0xffb4331c) = 0
lstat64(0xffb43580, 0xffb4331c) = 0
lstat64(0xffb43580, 0xffb4331c) = 0
access("/home/kamini/STADEN/.itcl3.3rc", F_OK) = -1 ENOENT (No such file or directory)
lstat64(0xffb43580, 0xffb4331c) = 0
lstat64(0xffb43580, 0xffb4331c) = 0
lstat64(0xffb43580, 0xffb4331c) = 0
lstat64(0xffb43580, 0xffb4331c) = 0
access("/usr/local/staden-linux-x86-1-7-0/tables/itcl3.3rc", F_OK) = 0
stat64(0x8179bb8, 0xffb448f0) = 0
open("/usr/local/staden-linux-x86-1-7-0/tables/itcl3.3rc", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb44698) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "set env(ITCL_LIBRARY) $env(STADL"..., 4096) = 44
read(4, "", 4096) = 0
close(4) = 0
lstat64(0xffb43580, 0xffb4331c) = 0
lstat64(0xffb43580, 0xffb4331c) = 0
lstat64(0xffb43580, 0xffb4331c) = 0
lstat64(0xffb43580, 0xffb4331c) = 0
access("/usr/local/staden-linux-x86-1-7-0/tables/itcl3.3rc.local", F_OK) = -1 ENOENT (No such file or directory)
lstat64(0xffb43580, 0xffb4331c) = 0
lstat64(0xffb43580, 0xffb4331c) = 0
access("/home/kamini/.itcl3.3rc", F_OK) = -1 ENOENT (No such file or directory)
lstat64(0xffb43580, 0xffb4331c) = 0
lstat64(0xffb43580, 0xffb4331c) = 0
access("/home/kamini/.itcl3.3rc.local", F_OK) = -1 ENOENT (No such file or directory)
getcwd("/home/kamini/STADEN", 4097) = 20
lstat64(0xffb43550, 0xffb432ec) = 0
lstat64(0xffb43550, 0xffb432ec) = 0
lstat64(0xffb43580, 0xffb4331c) = 0
lstat64(0xffb43580, 0xffb4331c) = 0
lstat64(0xffb43580, 0xffb4331c) = 0
access("/home/kamini/STADEN/.itcl3.3rc", F_OK) = -1 ENOENT (No such file or directory)
getcwd("/home/kamini/STADEN", 4097) = 20
lstat64(0xffb43550, 0xffb432ec) = 0
lstat64(0xffb43550, 0xffb432ec) = 0
lstat64(0xffb43580, 0xffb4331c) = 0
lstat64(0xffb43580, 0xffb4331c) = 0
lstat64(0xffb43580, 0xffb4331c) = 0
access("/home/kamini/STADEN/.itcl3.3rc.local", F_OK) = -1 ENOENT (No such file or directory)
getcwd("/home/kamini/STADEN", 4097) = 20
lstat64(0xffb43ba0, 0xffb4393c) = 0
lstat64(0xffb43ba0, 0xffb4393c) = 0
lstat64(0xffb43bd0, 0xffb4396c) = 0
lstat64(0xffb43bd0, 0xffb4396c) = 0
lstat64(0xffb43bd0, 0xffb4396c) = 0
open("/home/kamini/STADEN/libitcl3.3.so", O_RDONLY) = -1 ENOENT (No such file or directory)
open("/usr/local/lib/libitcl3.3.so", O_RDONLY) = -1 ENOENT (No such file or directory)
open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libitcl3.3.so", O_RDONLY) = 4
read(4, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0\340/\0"..., 512) = 512
fstat64(0x4, 0xffb445b0) = 0
mmap2(NULL, 98208, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 4, 0) = 0xfffffffff7e33000
mmap2(0xf7e4a000, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 4, 0x17) = 0xfffffffff7e4a000
close(4) = 0
lstat64(0xffb42b90, 0xffb4292c) = 0
lstat64(0xffb42b90, 0xffb4292c) = 0
lstat64(0xffb42b90, 0xffb4292c) = 0
lstat64(0xffb42b90, 0xffb4292c) = 0
lstat64(0xffb42b90, 0xffb4292c) = 0
stat64(0x818f730, 0xffb43d80) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/itcl3.3/itcl.tcl", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb43b28) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "#\n# itcl.tcl\n# -----------------"..., 4096) = 4096
read(4, "--------------------------------"..., 4096) = 903
read(4, "", 4096) = 0
close(4) = 0
lstat64(0xffb43580, 0xffb4331c) = 0
lstat64(0xffb43580, 0xffb4331c) = 0
access("/home/kamini/.itk3.3rc", F_OK) = -1 ENOENT (No such file or directory)
getcwd("/home/kamini/STADEN", 4097) = 20
lstat64(0xffb43550, 0xffb432ec) = 0
lstat64(0xffb43550, 0xffb432ec) = 0
lstat64(0xffb43580, 0xffb4331c) = 0
lstat64(0xffb43580, 0xffb4331c) = 0
lstat64(0xffb43580, 0xffb4331c) = 0
access("/home/kamini/STADEN/.itk3.3rc", F_OK) = -1 ENOENT (No such file or directory)
lstat64(0xffb43580, 0xffb4331c) = 0
lstat64(0xffb43580, 0xffb4331c) = 0
lstat64(0xffb43580, 0xffb4331c) = 0
lstat64(0xffb43580, 0xffb4331c) = 0
access("/usr/local/staden-linux-x86-1-7-0/tables/itk3.3rc", F_OK) = 0
stat64(0x8190680, 0xffb448f0) = 0
open("/usr/local/staden-linux-x86-1-7-0/tables/itk3.3rc", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb44698) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "set env(ITK_LIBRARY) $env(STADLI"..., 4096) = 42
read(4, "", 4096) = 0
close(4) = 0
lstat64(0xffb43580, 0xffb4331c) = 0
lstat64(0xffb43580, 0xffb4331c) = 0
lstat64(0xffb43580, 0xffb4331c) = 0
lstat64(0xffb43580, 0xffb4331c) = 0
access("/usr/local/staden-linux-x86-1-7-0/tables/itk3.3rc.local", F_OK) = -1 ENOENT (No such file or directory)
lstat64(0xffb43580, 0xffb4331c) = 0
lstat64(0xffb43580, 0xffb4331c) = 0
access("/home/kamini/.itk3.3rc", F_OK) = -1 ENOENT (No such file or directory)
lstat64(0xffb43580, 0xffb4331c) = 0
lstat64(0xffb43580, 0xffb4331c) = 0
access("/home/kamini/.itk3.3rc.local", F_OK) = -1 ENOENT (No such file or directory)
getcwd("/home/kamini/STADEN", 4097) = 20
lstat64(0xffb43550, 0xffb432ec) = 0
lstat64(0xffb43550, 0xffb432ec) = 0
lstat64(0xffb43580, 0xffb4331c) = 0
lstat64(0xffb43580, 0xffb4331c) = 0
lstat64(0xffb43580, 0xffb4331c) = 0
access("/home/kamini/STADEN/.itk3.3rc", F_OK) = -1 ENOENT (No such file or directory)
getcwd("/home/kamini/STADEN", 4097) = 20
lstat64(0xffb43550, 0xffb432ec) = 0
lstat64(0xffb43550, 0xffb432ec) = 0
lstat64(0xffb43580, 0xffb4331c) = 0
lstat64(0xffb43580, 0xffb4331c) = 0
lstat64(0xffb43580, 0xffb4331c) = 0
access("/home/kamini/STADEN/.itk3.3rc.local", F_OK) = -1 ENOENT (No such file or directory)
getcwd("/home/kamini/STADEN", 4097) = 20
lstat64(0xffb43ba0, 0xffb4393c) = 0
lstat64(0xffb43ba0, 0xffb4393c) = 0
lstat64(0xffb43bd0, 0xffb4396c) = 0
lstat64(0xffb43bd0, 0xffb4396c) = 0
lstat64(0xffb43bd0, 0xffb4396c) = 0
open("/home/kamini/STADEN/libitk3.3.so", O_RDONLY) = -1 ENOENT (No such file or directory)
open("/usr/local/lib/libitk3.3.so", O_RDONLY) = -1 ENOENT (No such file or directory)
open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libitk3.3.so", O_RDONLY) = 4
read(4, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0\240\16"..., 512) = 512
fstat64(0x4, 0xffb445b0) = 0
mmap2(NULL, 43696, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 4, 0) = 0xfffffffff7e28000
mmap2(0xf7e32000, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 4, 0xa) = 0xfffffffff7e32000
close(4) = 0
lstat64(0xffb42b90, 0xffb4292c) = 0
lstat64(0xffb42b90, 0xffb4292c) = 0
lstat64(0xffb42b90, 0xffb4292c) = 0
lstat64(0xffb42b90, 0xffb4292c) = 0
lstat64(0xffb42b90, 0xffb4292c) = 0
stat64(0x8190ad8, 0xffb43d80) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/itk3.3/itk.tcl", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb43b28) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "#\n# itk.tcl\n# ------------------"..., 4096) = 4096
read(4, "lightcolor -highlightthickness\n "..., 4096) = 1206
read(4, "", 4096) = 0
close(4) = 0
getcwd("/home/kamini/STADEN", 4097) = 20
lstat64(0xffb43e90, 0xffb43c2c) = 0
lstat64(0xffb43e90, 0xffb43c2c) = 0
lstat64(0xffb43ec0, 0xffb43c5c) = 0
lstat64(0xffb43ec0, 0xffb43c5c) = 0
lstat64(0xffb43ec0, 0xffb43c5c) = 0
open("/home/kamini/STADEN/libiwidgets.so", O_RDONLY) = -1 ENOENT (No such file or directory)
open("/usr/local/lib/libiwidgets.so", O_RDONLY) = -1 ENOENT (No such file or directory)
open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libiwidgets.so", O_RDONLY) = -1 ENOENT (No such file or directory)
open("/etc/ld.so.cache", O_RDONLY) = 4
fstat64(0x4, 0xffb4483c) = 0
mmap2(NULL, 183737, PROT_READ, MAP_PRIVATE, 4, 0) = 0xfffffffff7a74000
close(4) = 0
open("/lib/i686/libiwidgets.so", O_RDONLY) = -1 ENOENT (No such file or directory)
open("/lib/libiwidgets.so", O_RDONLY) = -1 ENOENT (No such file or directory)
open("/usr/lib/sse2/libiwidgets.so", O_RDONLY) = -1 ENOENT (No such file or directory)
open("/usr/lib/libiwidgets.so", O_RDONLY) = -1 ENOENT (No such file or directory)
munmap(0xf7a74000, 183737) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/iwidgets/tclIndex", O_RDONLY|O_LARGEFILE) = -1 ENOENT (No such file or directory)
lstat64(0xffb44140, 0xffb43edc) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/itk3.3/tclIndex", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb45118) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "# Tcl autoload index file, versi"..., 4096) = 578
read(4, "", 4096) = 0
close(4) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/itk3.3/tclIndex", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb45118) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "# Tcl autoload index file, versi"..., 4096) = 578
read(4, "", 4096) = 0
close(4) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/itcl3.3/tclIndex", O_RDONLY|O_LARGEFILE) = -1 ENOENT (No such file or directory)
lstat64(0xffb44140, 0xffb43edc) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/iwidgets/tclIndex", O_RDONLY|O_LARGEFILE) = -1 ENOENT (No such file or directory)
lstat64(0xffb44140, 0xffb43edc) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/tk_utils/tclIndex", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb45118) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "# Tcl autoload index file, versi"..., 4096) = 4096
read(4, "_def) [list source [file join $d"..., 4096) = 4096
read(4, "ndex(CheckFloatRange) [list sour"..., 4096) = 4096
read(4, "ist source [file join $dir html_"..., 4096) = 4096
read(4, "its) [list source [file join $di"..., 4096) = 4096
read(4, " [list source [file join $dir ca"..., 4096) = 4096
read(4, "yme_map.tcl]]\nset auto_index(Sel"..., 4096) = 4096
read(4, "set auto_index(spBiolimsDialog_I"..., 4096) = 4096
read(4, "index(::Widget::Xmclistbox::_bin"..., 4096) = 4096
read(4, "extract_element_name) [list sour"..., 4096) = 4096
read(4, "_element_different) [list source"..., 4096) = 1259
read(4, "", 4096) = 0
close(4) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/copy_reads/tclIndex", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb45118) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "# Tcl autoload index file, versi"..., 4096) = 1457
read(4, "", 4096) = 0
close(4) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/tk_utils/tclIndex", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb45118) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "# Tcl autoload index file, versi"..., 4096) = 4096
read(4, "_def) [list source [file join $d"..., 4096) = 4096
read(4, "ndex(CheckFloatRange) [list sour"..., 4096) = 4096
read(4, "ist source [file join $dir html_"..., 4096) = 4096
read(4, "its) [list source [file join $di"..., 4096) = 4096
read(4, " [list source [file join $dir ca"..., 4096) = 4096
read(4, "yme_map.tcl]]\nset auto_index(Sel"..., 4096) = 4096
read(4, "set auto_index(spBiolimsDialog_I"..., 4096) = 4096
read(4, "index(::Widget::Xmclistbox::_bin"..., 4096) = 4096
read(4, "extract_element_name) [list sour"..., 4096) = 4096
read(4, "_element_different) [list source"..., 4096) = 1259
read(4, "", 4096) = 0
close(4) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/gap/tclIndex", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb45118) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "# Tcl autoload index file, versi"..., 4096) = 4096
read(4, "dex(popup_cs_contig_3) [list sou"..., 4096) = 4096
read(4, "e join $dir list_proc.tcl]]\nset "..., 4096) = 4096
read(4, "rce [file join $dir tag_editor.t"..., 4096) = 3803
read(4, "", 4096) = 0
close(4) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/tclIndex", O_RDONLY|O_LARGEFILE) = -1 ENOENT (No such file or directory)
lstat64(0xffb44140, 0xffb43edc) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/tk_utils/tclIndex", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb45118) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "# Tcl autoload index file, versi"..., 4096) = 4096
read(4, "_def) [list source [file join $d"..., 4096) = 4096
read(4, "ndex(CheckFloatRange) [list sour"..., 4096) = 4096
read(4, "ist source [file join $dir html_"..., 4096) = 4096
read(4, "its) [list source [file join $di"..., 4096) = 4096
read(4, " [list source [file join $dir ca"..., 4096) = 4096
read(4, "yme_map.tcl]]\nset auto_index(Sel"..., 4096) = 4096
read(4, "set auto_index(spBiolimsDialog_I"..., 4096) = 4096
read(4, "index(::Widget::Xmclistbox::_bin"..., 4096) = 4096
read(4, "extract_element_name) [list sour"..., 4096) = 4096
brk(0x81e1000) = 0x81e1000
brk(0x81d7000) = 0x81d7000
read(4, "_element_different) [list source"..., 4096) = 1259
read(4, "", 4096) = 0
brk(0x81c5000) = 0x81c5000
close(4) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/tk_utils/tclIndex", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb45118) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "# Tcl autoload index file, versi"..., 4096) = 4096
read(4, "_def) [list source [file join $d"..., 4096) = 4096
read(4, "ndex(CheckFloatRange) [list sour"..., 4096) = 4096
read(4, "ist source [file join $dir html_"..., 4096) = 4096
read(4, "its) [list source [file join $di"..., 4096) = 4096
read(4, " [list source [file join $dir ca"..., 4096) = 4096
read(4, "yme_map.tcl]]\nset auto_index(Sel"..., 4096) = 4096
read(4, "set auto_index(spBiolimsDialog_I"..., 4096) = 4096
read(4, "index(::Widget::Xmclistbox::_bin"..., 4096) = 4096
read(4, "extract_element_name) [list sour"..., 4096) = 4096
read(4, "_element_different) [list source"..., 4096) = 1259
read(4, "", 4096) = 0
close(4) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/tk/tclIndex", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb45118) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "# Tcl autoload index file, versi"..., 4096) = 4096
read(4, "]]\nset auto_index(::tk::FocusGro"..., 4096) = 4096
read(4, "::tk::MenuDownArrow) [list sourc"..., 4096) = 4096
read(4, " [list source [file join $dir sp"..., 4096) = 4096
read(4, "\nset auto_index(::tk::IconList_A"..., 4096) = 4096
read(4, "_InterpFilter) [list source [fil"..., 4096) = 1730
read(4, "", 4096) = 0
close(4) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/tk_utils/tclIndex", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb45118) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "# Tcl autoload index file, versi"..., 4096) = 4096
read(4, "_def) [list source [file join $d"..., 4096) = 4096
read(4, "ndex(CheckFloatRange) [list sour"..., 4096) = 4096
read(4, "ist source [file join $dir html_"..., 4096) = 4096
read(4, "its) [list source [file join $di"..., 4096) = 4096
read(4, " [list source [file join $dir ca"..., 4096) = 4096
read(4, "yme_map.tcl]]\nset auto_index(Sel"..., 4096) = 4096
read(4, "set auto_index(spBiolimsDialog_I"..., 4096) = 4096
read(4, "index(::Widget::Xmclistbox::_bin"..., 4096) = 4096
read(4, "extract_element_name) [list sour"..., 4096) = 4096
read(4, "_element_different) [list source"..., 4096) = 1259
read(4, "", 4096) = 0
close(4) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
open("/usr/local/lib/tclIndex", O_RDONLY|O_LARGEFILE) = -1 ENOENT (No such file or directory)
lstat64(0xffb44140, 0xffb43edc) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/tclIndex", O_RDONLY|O_LARGEFILE) = -1 ENOENT (No such file or directory)
lstat64(0xffb44140, 0xffb43edc) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
lstat64(0xffb44140, 0xffb43edc) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/tcl/tclIndex", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb45118) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "# Tcl autoload index file, versi"..., 4096) = 4096
read(4, ") [list source [file join $dir s"..., 4096) = 1913
read(4, "", 4096) = 0
close(4) = 0
lstat64(0xffb44d10, 0xffb44aac) = 0
lstat64(0xffb44d10, 0xffb44aac) = 0
lstat64(0xffb44d10, 0xffb44aac) = 0
lstat64(0xffb44d10, 0xffb44aac) = 0
lstat64(0xffb44d10, 0xffb44aac) = 0
stat64(0x816de28, 0xffb45f00) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/iwidgets/iwidgets.tcl", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb45ca8) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "#\n# iwidgets.tcl\n# -------------"..., 4096) = 1129
read(4, "", 4096) = 0
close(4) = 0
lstat64(0xffb44fd0, 0xffb44d6c) = 0
lstat64(0xffb44fd0, 0xffb44d6c) = 0
lstat64(0xffb44fd0, 0xffb44d6c) = 0
lstat64(0xffb44fd0, 0xffb44d6c) = 0
access("/usr/local/staden-linux-x86-1-7-0/tables/iwidgetsrc.local", F_OK) = -1 ENOENT (No such file or directory)
lstat64(0xffb44fd0, 0xffb44d6c) = 0
lstat64(0xffb44fd0, 0xffb44d6c) = 0
access("/home/kamini/.iwidgetsrc", F_OK) = -1 ENOENT (No such file or directory)
lstat64(0xffb44fd0, 0xffb44d6c) = 0
lstat64(0xffb44fd0, 0xffb44d6c) = 0
access("/home/kamini/.iwidgetsrc.local", F_OK) = -1 ENOENT (No such file or directory)
getcwd("/home/kamini/STADEN", 4097) = 20
lstat64(0xffb44fa0, 0xffb44d3c) = 0
lstat64(0xffb44fa0, 0xffb44d3c) = 0
lstat64(0xffb44fd0, 0xffb44d6c) = 0
lstat64(0xffb44fd0, 0xffb44d6c) = 0
lstat64(0xffb44fd0, 0xffb44d6c) = 0
access("/home/kamini/STADEN/.iwidgetsrc", F_OK) = -1 ENOENT (No such file or directory)
getcwd("/home/kamini/STADEN", 4097) = 20
lstat64(0xffb44fa0, 0xffb44d3c) = 0
lstat64(0xffb44fa0, 0xffb44d3c) = 0
lstat64(0xffb44fd0, 0xffb44d6c) = 0
lstat64(0xffb44fd0, 0xffb44d6c) = 0
lstat64(0xffb44fd0, 0xffb44d6c) = 0
access("/home/kamini/STADEN/.iwidgetsrc.local", F_OK) = -1 ENOENT (No such file or directory)
lstat64(0xffb45e00, 0xffb45b9c) = 0
lstat64(0xffb45e00, 0xffb45b9c) = 0
lstat64(0xffb45e00, 0xffb45b9c) = 0
lstat64(0xffb45e00, 0xffb45b9c) = 0
access("/usr/local/staden-linux-x86-1-7-0/tables/gaprc_menu_full", F_OK) = 0
stat64(0x81bd710, 0xffb47170) = 0
open("/usr/local/staden-linux-x86-1-7-0/tables/gaprc_menu_full", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb46f18) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "#-------------------------------"..., 4096) = 4096
read(4, "6 {NClip \\$io} e\nadd_command\t{Ed"..., 4096) = 4096
read(4, "Search template names} 12 6 {Sea"..., 4096) = 4096
read(4, "Commands.S4}\nadd_command\t{Comman"..., 4096) = 4096
read(4, "lay.Embed traces size 4} 1 0 \\\n\t"..., 4096) = 4096
brk(0x81ec000) = 0x81ec000
brk(0x81e8000) = 0x81e8000
read(4, " {Editor-Quality Values}}\nadd_co"..., 4096) = 4096
read(4, "StartShutdown $io $f}\nadd_comman"..., 4096) = 3075
read(4, "", 4096) = 0
close(4) = 0
brk(0x8209000) = 0x8209000
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
access("/home/kamini/.cap2rc", F_OK) = -1 ENOENT (No such file or directory)
getcwd("/home/kamini/STADEN", 4097) = 20
lstat64(0xffb45540, 0xffb452dc) = 0
lstat64(0xffb45540, 0xffb452dc) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
access("/home/kamini/STADEN/.cap2rc", F_OK) = -1 ENOENT (No such file or directory)
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
access("/usr/local/staden-linux-x86-1-7-0/lib/cap2/cap2rc", F_OK) = -1 ENOENT (No such file or directory)
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
access("/usr/local/staden-linux-x86-1-7-0/lib/cap2/cap2rc.local", F_OK) = -1 ENOENT (No such file or directory)
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
access("/usr/local/staden-linux-x86-1-7-0/tables/cap2rc", F_OK) = 0
stat64(0x81c0d18, 0xffb468e0) = 0
open("/usr/local/staden-linux-x86-1-7-0/tables/cap2rc", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb46688) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "load_package %L/cap2\t{}\tcap2\t0\n\n"..., 4096) = 2186
read(4, "", 4096) = 0
close(4) = 0
getcwd("/home/kamini/STADEN", 4097) = 20
lstat64(0xffb44920, 0xffb446bc) = 0
lstat64(0xffb44920, 0xffb446bc) = 0
lstat64(0xffb44950, 0xffb446ec) = 0
lstat64(0xffb44950, 0xffb446ec) = 0
lstat64(0xffb44950, 0xffb446ec) = 0
access("/home/kamini/STADEN/libcap2.so", F_OK) = -1 ENOENT (No such file or directory)
pipe([4, 5]) = 0
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
fcntl64(5, F_SETFD, FD_CLOEXEC) = 0
gettimeofday({1196950289, 111551}, NULL) = 0
getpid() = 3541
open("/tmp/tclIM1Muc", O_RDWR|O_CREAT|O_EXCL, 0600) = 6
fcntl64(6, F_SETFD, FD_CLOEXEC) = 0
unlink("/tmp/tclIM1Muc") = 0
pipe([7, 8]) = 0
fcntl64(7, F_SETFD, FD_CLOEXEC) = 0
fcntl64(8, F_SETFD, FD_CLOEXEC) = 0
clone(child_stack=0, flags=CLONE_CHILD_CLEARTID|CLONE_CHILD_SETTID|SIGCHLD, child_tidptr=0) = 3542
--- SIGCHLD (Child exited) @ 0 (0) ---
close(8) = 0
read(7, "2couldn\'t execute \"cap2_s\": ", 223) = 28
waitpid(3542, [{WIFEXITED(s) && WEXITSTATUS(s) == 1}], 0) = 3542
close(7) = 0
close(4) = 0
close(6) = 0
close(5) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
access("/usr/local/staden-linux-x86-1-7-0/tables/cap2rc.local", F_OK) = -1 ENOENT (No such file or directory)
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
access("/home/kamini/.cap2rc", F_OK) = -1 ENOENT (No such file or directory)
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
access("/home/kamini/.cap2rc.local", F_OK) = -1 ENOENT (No such file or directory)
getcwd("/home/kamini/STADEN", 4097) = 20
lstat64(0xffb45540, 0xffb452dc) = 0
lstat64(0xffb45540, 0xffb452dc) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
access("/home/kamini/STADEN/.cap2rc", F_OK) = -1 ENOENT (No such file or directory)
getcwd("/home/kamini/STADEN", 4097) = 20
lstat64(0xffb45540, 0xffb452dc) = 0
lstat64(0xffb45540, 0xffb452dc) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
access("/home/kamini/STADEN/.cap2rc.local", F_OK) = -1 ENOENT (No such file or directory)
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
access("/home/kamini/.cap3rc", F_OK) = -1 ENOENT (No such file or directory)
getcwd("/home/kamini/STADEN", 4097) = 20
lstat64(0xffb45540, 0xffb452dc) = 0
lstat64(0xffb45540, 0xffb452dc) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
access("/home/kamini/STADEN/.cap3rc", F_OK) = -1 ENOENT (No such file or directory)
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
access("/usr/local/staden-linux-x86-1-7-0/lib/cap3/cap3rc", F_OK) = -1 ENOENT (No such file or directory)
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
access("/usr/local/staden-linux-x86-1-7-0/lib/cap3/cap3rc.local", F_OK) = -1 ENOENT (No such file or directory)
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
access("/usr/local/staden-linux-x86-1-7-0/tables/cap3rc", F_OK) = 0
stat64(0x81c09c0, 0xffb468e0) = 0
open("/usr/local/staden-linux-x86-1-7-0/tables/cap3rc", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb46688) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "load_package %L/cap3\t{}\tcap3\t0\n\n"..., 4096) = 4096
read(4, "VALUE\t4\nset_def HUANG_ASSEMBLY.M"..., 4096) = 332
read(4, "", 4096) = 0
close(4) = 0
getcwd("/home/kamini/STADEN", 4097) = 20
lstat64(0xffb44920, 0xffb446bc) = 0
lstat64(0xffb44920, 0xffb446bc) = 0
lstat64(0xffb44950, 0xffb446ec) = 0
lstat64(0xffb44950, 0xffb446ec) = 0
lstat64(0xffb44950, 0xffb446ec) = 0
access("/home/kamini/STADEN/libcap3.so", F_OK) = -1 ENOENT (No such file or directory)
pipe([4, 5]) = 0
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
fcntl64(5, F_SETFD, FD_CLOEXEC) = 0
open("/tmp/tclkL51F5", O_RDWR|O_CREAT|O_EXCL, 0600) = 6
fcntl64(6, F_SETFD, FD_CLOEXEC) = 0
unlink("/tmp/tclkL51F5") = 0
pipe([7, 8]) = 0
fcntl64(7, F_SETFD, FD_CLOEXEC) = 0
fcntl64(8, F_SETFD, FD_CLOEXEC) = 0
clone(child_stack=0, flags=CLONE_CHILD_CLEARTID|CLONE_CHILD_SETTID|SIGCHLD, child_tidptr=0) = 3543
--- SIGCHLD (Child exited) @ 0 (0) ---
close(8) = 0
read(7, "2couldn\'t execute \"cap3_s\": ", 223) = 28
waitpid(3543, [{WIFEXITED(s) && WEXITSTATUS(s) == 1}], 0) = 3543
close(7) = 0
close(4) = 0
close(6) = 0
close(5) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
access("/usr/local/staden-linux-x86-1-7-0/tables/cap3rc.local", F_OK) = -1 ENOENT (No such file or directory)
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
access("/home/kamini/.cap3rc", F_OK) = -1 ENOENT (No such file or directory)
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
access("/home/kamini/.cap3rc.local", F_OK) = -1 ENOENT (No such file or directory)
getcwd("/home/kamini/STADEN", 4097) = 20
lstat64(0xffb45540, 0xffb452dc) = 0
lstat64(0xffb45540, 0xffb452dc) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
access("/home/kamini/STADEN/.cap3rc", F_OK) = -1 ENOENT (No such file or directory)
getcwd("/home/kamini/STADEN", 4097) = 20
lstat64(0xffb45540, 0xffb452dc) = 0
lstat64(0xffb45540, 0xffb452dc) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
access("/home/kamini/STADEN/.cap3rc.local", F_OK) = -1 ENOENT (No such file or directory)
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
access("/home/kamini/.fak2rc", F_OK) = -1 ENOENT (No such file or directory)
getcwd("/home/kamini/STADEN", 4097) = 20
lstat64(0xffb45540, 0xffb452dc) = 0
lstat64(0xffb45540, 0xffb452dc) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
access("/home/kamini/STADEN/.fak2rc", F_OK) = -1 ENOENT (No such file or directory)
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
access("/usr/local/staden-linux-x86-1-7-0/lib/fak2/fak2rc", F_OK) = -1 ENOENT (No such file or directory)
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
access("/usr/local/staden-linux-x86-1-7-0/lib/fak2/fak2rc.local", F_OK) = -1 ENOENT (No such file or directory)
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
access("/usr/local/staden-linux-x86-1-7-0/tables/fak2rc", F_OK) = 0
stat64(0x81c0be0, 0xffb468e0) = 0
open("/usr/local/staden-linux-x86-1-7-0/tables/fak2rc", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb46688) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "load_package %L/fak2\t{}\tfak2\t0\n\n"..., 4096) = 4096
read(4, "AK2_ASSEMBLY.IMPORT.C_NUM.VALUE\t"..., 4096) = 34
read(4, "", 4096) = 0
close(4) = 0
getcwd("/home/kamini/STADEN", 4097) = 20
lstat64(0xffb44920, 0xffb446bc) = 0
lstat64(0xffb44920, 0xffb446bc) = 0
lstat64(0xffb44950, 0xffb446ec) = 0
lstat64(0xffb44950, 0xffb446ec) = 0
lstat64(0xffb44950, 0xffb446ec) = 0
access("/home/kamini/STADEN/libfak2.so", F_OK) = -1 ENOENT (No such file or directory)
pipe([4, 5]) = 0
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
fcntl64(5, F_SETFD, FD_CLOEXEC) = 0
open("/tmp/tclajzASY", O_RDWR|O_CREAT|O_EXCL, 0600) = 6
fcntl64(6, F_SETFD, FD_CLOEXEC) = 0
unlink("/tmp/tclajzASY") = 0
pipe([7, 8]) = 0
fcntl64(7, F_SETFD, FD_CLOEXEC) = 0
fcntl64(8, F_SETFD, FD_CLOEXEC) = 0
clone(child_stack=0, flags=CLONE_CHILD_CLEARTID|CLONE_CHILD_SETTID|SIGCHLD, child_tidptr=0) = 3544
--- SIGCHLD (Child exited) @ 0 (0) ---
close(8) = 0
read(7, "2couldn\'t execute \"write_exp_fil"..., 223) = 36
waitpid(3544, [{WIFEXITED(s) && WEXITSTATUS(s) == 1}], 0) = 3544
close(7) = 0
close(4) = 0
close(6) = 0
close(5) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
access("/usr/local/staden-linux-x86-1-7-0/tables/fak2rc.local", F_OK) = -1 ENOENT (No such file or directory)
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
access("/home/kamini/.fak2rc", F_OK) = -1 ENOENT (No such file or directory)
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
access("/home/kamini/.fak2rc.local", F_OK) = -1 ENOENT (No such file or directory)
getcwd("/home/kamini/STADEN", 4097) = 20
lstat64(0xffb45540, 0xffb452dc) = 0
lstat64(0xffb45540, 0xffb452dc) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
access("/home/kamini/STADEN/.fak2rc", F_OK) = -1 ENOENT (No such file or directory)
getcwd("/home/kamini/STADEN", 4097) = 20
lstat64(0xffb45540, 0xffb452dc) = 0
lstat64(0xffb45540, 0xffb452dc) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
access("/home/kamini/STADEN/.fak2rc.local", F_OK) = -1 ENOENT (No such file or directory)
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
access("/home/kamini/.phraprc", F_OK) = -1 ENOENT (No such file or directory)
getcwd("/home/kamini/STADEN", 4097) = 20
lstat64(0xffb45540, 0xffb452dc) = 0
lstat64(0xffb45540, 0xffb452dc) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
access("/home/kamini/STADEN/.phraprc", F_OK) = -1 ENOENT (No such file or directory)
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
access("/usr/local/staden-linux-x86-1-7-0/lib/phrap/phraprc", F_OK) = -1 ENOENT (No such file or directory)
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
access("/usr/local/staden-linux-x86-1-7-0/lib/phrap/phraprc.local", F_OK) = -1 ENOENT (No such file or directory)
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
access("/usr/local/staden-linux-x86-1-7-0/tables/phraprc", F_OK) = 0
stat64(0x81c0968, 0xffb468e0) = 0
open("/usr/local/staden-linux-x86-1-7-0/tables/phraprc", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb46688) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "# Phrap Gap4 module\n\n# Menu spec"..., 4096) = 1145
read(4, "", 4096) = 0
close(4) = 0
pipe([4, 5]) = 0
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
fcntl64(5, F_SETFD, FD_CLOEXEC) = 0
open("/tmp/tclI4Rl6R", O_RDWR|O_CREAT|O_EXCL, 0600) = 6
fcntl64(6, F_SETFD, FD_CLOEXEC) = 0
unlink("/tmp/tclI4Rl6R") = 0
pipe([7, 8]) = 0
fcntl64(7, F_SETFD, FD_CLOEXEC) = 0
fcntl64(8, F_SETFD, FD_CLOEXEC) = 0
clone(child_stack=0, flags=CLONE_CHILD_CLEARTID|CLONE_CHILD_SETTID|SIGCHLD, child_tidptr=0) = 3545
--- SIGCHLD (Child exited) @ 0 (0) ---
close(8) = 0
read(7, "2couldn\'t execute \"gcphrap\": ", 223) = 29
waitpid(3545, [{WIFEXITED(s) && WEXITSTATUS(s) == 1}], 0) = 3545
close(7) = 0
close(4) = 0
close(6) = 0
close(5) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
access("/usr/local/staden-linux-x86-1-7-0/tables/phraprc.local", F_OK) = -1 ENOENT (No such file or directory)
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
access("/home/kamini/.phraprc", F_OK) = -1 ENOENT (No such file or directory)
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
access("/home/kamini/.phraprc.local", F_OK) = -1 ENOENT (No such file or directory)
getcwd("/home/kamini/STADEN", 4097) = 20
lstat64(0xffb45540, 0xffb452dc) = 0
lstat64(0xffb45540, 0xffb452dc) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
access("/home/kamini/STADEN/.phraprc", F_OK) = -1 ENOENT (No such file or directory)
getcwd("/home/kamini/STADEN", 4097) = 20
lstat64(0xffb45540, 0xffb452dc) = 0
lstat64(0xffb45540, 0xffb452dc) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
lstat64(0xffb45570, 0xffb4530c) = 0
access("/home/kamini/STADEN/.phraprc.local", F_OK) = -1 ENOENT (No such file or directory)
getcwd("/home/kamini/STADEN", 4097) = 20
lstat64(0xffb45ae0, 0xffb4587c) = 0
lstat64(0xffb45ae0, 0xffb4587c) = 0
lstat64(0xffb45b10, 0xffb458ac) = 0
lstat64(0xffb45b10, 0xffb458ac) = 0
lstat64(0xffb45b10, 0xffb458ac) = 0
access("/home/kamini/STADEN/libphrap.so", F_OK) = -1 ENOENT (No such file or directory)
lstat64(0xffb452c0, 0xffb4505c) = 0
lstat64(0xffb452c0, 0xffb4505c) = 0
access("/home/kamini/.haplorc", F_OK) = -1 ENOENT (No such file or directory)
getcwd("/home/kamini/STADEN", 4097) = 20
lstat64(0xffb45290, 0xffb4502c) = 0
lstat64(0xffb45290, 0xffb4502c) = 0
lstat64(0xffb452c0, 0xffb4505c) = 0
lstat64(0xffb452c0, 0xffb4505c) = 0
lstat64(0xffb452c0, 0xffb4505c) = 0
access("/home/kamini/STADEN/.haplorc", F_OK) = -1 ENOENT (No such file or directory)
lstat64(0xffb452c0, 0xffb4505c) = 0
lstat64(0xffb452c0, 0xffb4505c) = 0
lstat64(0xffb452c0, 0xffb4505c) = 0
lstat64(0xffb452c0, 0xffb4505c) = 0
access("/usr/local/staden-linux-x86-1-7-0/tables/haplorc", F_OK) = 0
stat64(0x81c09b0, 0xffb46630) = 0
open("/usr/local/staden-linux-x86-1-7-0/tables/haplorc", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb463d8) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "set_menu gap_menu\nadd_command {V"..., 4096) = 331
read(4, "", 4096) = 0
close(4) = 0
lstat64(0xffb452c0, 0xffb4505c) = 0
lstat64(0xffb452c0, 0xffb4505c) = 0
lstat64(0xffb452c0, 0xffb4505c) = 0
lstat64(0xffb452c0, 0xffb4505c) = 0
access("/usr/local/staden-linux-x86-1-7-0/tables/haplorc.local", F_OK) = -1 ENOENT (No such file or directory)
lstat64(0xffb452c0, 0xffb4505c) = 0
lstat64(0xffb452c0, 0xffb4505c) = 0
access("/home/kamini/.haplorc", F_OK) = -1 ENOENT (No such file or directory)
lstat64(0xffb452c0, 0xffb4505c) = 0
lstat64(0xffb452c0, 0xffb4505c) = 0
access("/home/kamini/.haplorc.local", F_OK) = -1 ENOENT (No such file or directory)
getcwd("/home/kamini/STADEN", 4097) = 20
lstat64(0xffb45290, 0xffb4502c) = 0
lstat64(0xffb45290, 0xffb4502c) = 0
lstat64(0xffb452c0, 0xffb4505c) = 0
lstat64(0xffb452c0, 0xffb4505c) = 0
lstat64(0xffb452c0, 0xffb4505c) = 0
access("/home/kamini/STADEN/.haplorc", F_OK) = -1 ENOENT (No such file or directory)
getcwd("/home/kamini/STADEN", 4097) = 20
lstat64(0xffb45290, 0xffb4502c) = 0
lstat64(0xffb45290, 0xffb4502c) = 0
lstat64(0xffb452c0, 0xffb4505c) = 0
lstat64(0xffb452c0, 0xffb4505c) = 0
lstat64(0xffb452c0, 0xffb4505c) = 0
access("/home/kamini/STADEN/.haplorc.local", F_OK) = -1 ENOENT (No such file or directory)
getcwd("/home/kamini/STADEN", 4097) = 20
lstat64(0xffb458e0, 0xffb4567c) = 0
lstat64(0xffb458e0, 0xffb4567c) = 0
lstat64(0xffb45910, 0xffb456ac) = 0
lstat64(0xffb45910, 0xffb456ac) = 0
lstat64(0xffb45910, 0xffb456ac) = 0
open("/home/kamini/STADEN/libhaplo.so", O_RDONLY) = -1 ENOENT (No such file or directory)
open("/usr/local/lib/libhaplo.so", O_RDONLY) = -1 ENOENT (No such file or directory)
open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libhaplo.so", O_RDONLY) = 4
read(4, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0\200 \0"..., 512) = 512
fstat64(0x4, 0xffb462f0) = 0
mmap2(NULL, 32472, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 4, 0) = 0xfffffffff7e20000
mmap2(0xf7e27000, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 4, 0x6) = 0xfffffffff7e27000
close(4) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libgap.so", O_RDONLY) = 4
read(4, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0\300\271"..., 512) = 512
fstat64(0x4, 0xffb4604c) = 0
mmap2(NULL, 2489824, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 4, 0) = 0xfffffffff7841000
mmap2(0xf791d000, 24576, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 4, 0xdb) = 0xfffffffff791d000
mmap2(0xf7923000, 1564128, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_ANONYMOUS, -1, 0) = 0xfffffffff7923000
close(4) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libseq_utils.so", O_RDONLY) = 4
read(4, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0\220@\0"..., 512) = 512
fstat64(0x4, 0xffb45ec8) = 0
mmap2(NULL, 208800, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 4, 0) = 0xfffffffff780e000
mmap2(0xf782c000, 12288, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 4, 0x1d) = 0xfffffffff782c000
mmap2(0xf782f000, 73632, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_ANONYMOUS, -1, 0) = 0xfffffffff782f000
close(4) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libg.so", O_RDONLY) = 4
read(4, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0\0\36\0"..., 512) = 512
fstat64(0x4, 0xffb45eac) = 0
mmap2(NULL, 43824, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 4, 0) = 0xfffffffff7803000
mmap2(0xf780d000, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 4, 0x9) = 0xfffffffff780d000
close(4) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libmutlib.so", O_RDONLY) = 4
read(4, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0P\272\0"..., 512) = 512
fstat64(0x4, 0xffb45e90) = 0
mmap2(NULL, 169568, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 4, 0) = 0xfffffffff77d9000
mmap2(0xf7800000, 8192, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 4, 0x26) = 0xfffffffff7800000
mmap2(0xf7802000, 1632, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_ANONYMOUS, -1, 0) = 0xfffffffff7802000
close(4) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libprimer3.so", O_RDONLY) = 4
read(4, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0\320\25"..., 512) = 512
fstat64(0x4, 0xffb45e74) = 0
mmap2(NULL, 120136, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 4, 0) = 0xfffffffff77bb000
mmap2(0xf77d3000, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 4, 0x18) = 0xfffffffff77d3000
mmap2(0xf77d4000, 17736, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_ANONYMOUS, -1, 0) = 0xfffffffff77d4000
close(4) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libg2c.so.0", O_RDONLY) = -1 ENOENT (No such file or directory)
open("/etc/ld.so.cache", O_RDONLY) = 4
fstat64(0x4, 0xffb45df4) = 0
mmap2(NULL, 183737, PROT_READ, MAP_PRIVATE, 4, 0) = 0xfffffffff778e000
close(4) = 0
open("/lib/i686/libg2c.so.0", O_RDONLY) = -1 ENOENT (No such file or directory)
open("/lib/libg2c.so.0", O_RDONLY) = -1 ENOENT (No such file or directory)
open("/usr/lib/sse2/libg2c.so.0", O_RDONLY) = -1 ENOENT (No such file or directory)
open("/usr/lib/libg2c.so.0", O_RDONLY) = -1 ENOENT (No such file or directory)
munmap(0xf778e000, 183737) = 0
munmap(0xf7e20000, 32472) = 0
munmap(0xf7841000, 2489824) = 0
munmap(0xf780e000, 208800) = 0
munmap(0xf7803000, 43824) = 0
munmap(0xf77d9000, 169568) = 0
munmap(0xf77bb000, 120136) = 0
lstat64(0xffb46a20, 0xffb467bc) = 0
lstat64(0xffb46a20, 0xffb467bc) = 0
lstat64(0xffb46a20, 0xffb467bc) = 0
lstat64(0xffb46a20, 0xffb467bc) = 0
access("/usr/local/staden-linux-x86-1-7-0/tables/gaprc.local", F_OK) = -1 ENOENT (No such file or directory)
lstat64(0xffb46a20, 0xffb467bc) = 0
lstat64(0xffb46a20, 0xffb467bc) = 0
access("/home/kamini/.gaprc", F_OK) = -1 ENOENT (No such file or directory)
lstat64(0xffb46a20, 0xffb467bc) = 0
lstat64(0xffb46a20, 0xffb467bc) = 0
access("/home/kamini/.gaprc.local", F_OK) = -1 ENOENT (No such file or directory)
getcwd("/home/kamini/STADEN", 4097) = 20
lstat64(0xffb469f0, 0xffb4678c) = 0
lstat64(0xffb469f0, 0xffb4678c) = 0
lstat64(0xffb46a20, 0xffb467bc) = 0
lstat64(0xffb46a20, 0xffb467bc) = 0
lstat64(0xffb46a20, 0xffb467bc) = 0
access("/home/kamini/STADEN/.gaprc", F_OK) = -1 ENOENT (No such file or directory)
getcwd("/home/kamini/STADEN", 4097) = 20
lstat64(0xffb469f0, 0xffb4678c) = 0
lstat64(0xffb469f0, 0xffb4678c) = 0
lstat64(0xffb46a20, 0xffb467bc) = 0
lstat64(0xffb46a20, 0xffb467bc) = 0
lstat64(0xffb46a20, 0xffb467bc) = 0
access("/home/kamini/STADEN/.gaprc.local", F_OK) = -1 ENOENT (No such file or directory)
getcwd("/home/kamini/STADEN", 4097) = 20
lstat64(0xffb47040, 0xffb46ddc) = 0
lstat64(0xffb47040, 0xffb46ddc) = 0
lstat64(0xffb47070, 0xffb46e0c) = 0
lstat64(0xffb47070, 0xffb46e0c) = 0
lstat64(0xffb47070, 0xffb46e0c) = 0
open("/home/kamini/STADEN/libgap.so", O_RDONLY) = -1 ENOENT (No such file or directory)
open("/usr/local/lib/libgap.so", O_RDONLY) = -1 ENOENT (No such file or directory)
open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libgap.so", O_RDONLY) = 4
read(4, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0\300\271"..., 512) = 512
fstat64(0x4, 0xffb47a50) = 0
mmap2(NULL, 2489824, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 4, 0) = 0xfffffffff7841000
mmap2(0xf791d000, 24576, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 4, 0xdb) = 0xfffffffff791d000
mmap2(0xf7923000, 1564128, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_ANONYMOUS, -1, 0) = 0xfffffffff7923000
close(4) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libseq_utils.so", O_RDONLY) = 4
read(4, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0\220@\0"..., 512) = 512
fstat64(0x4, 0xffb47838) = 0
mmap2(NULL, 208800, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 4, 0) = 0xfffffffff780e000
mmap2(0xf782c000, 12288, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 4, 0x1d) = 0xfffffffff782c000
mmap2(0xf782f000, 73632, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_ANONYMOUS, -1, 0) = 0xfffffffff782f000
close(4) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libg.so", O_RDONLY) = 4
read(4, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0\0\36\0"..., 512) = 512
fstat64(0x4, 0xffb47790) = 0
mmap2(NULL, 43824, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 4, 0) = 0xfffffffff7803000
mmap2(0xf780d000, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 4, 0x9) = 0xfffffffff780d000
close(4) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libmutlib.so", O_RDONLY) = 4
read(4, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0P\272\0"..., 512) = 512
fstat64(0x4, 0xffb47774) = 0
mmap2(NULL, 169568, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 4, 0) = 0xfffffffff77d9000
mmap2(0xf7800000, 8192, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 4, 0x26) = 0xfffffffff7800000
mmap2(0xf7802000, 1632, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_ANONYMOUS, -1, 0) = 0xfffffffff7802000
close(4) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libprimer3.so", O_RDONLY) = 4
read(4, "\177ELF\1\1\1\0\0\0\0\0\0\0\0\0\3\0\3\0\1\0\0\0\320\25"..., 512) = 512
fstat64(0x4, 0xffb4773c) = 0
mmap2(NULL, 120136, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 4, 0) = 0xfffffffff77bb000
mmap2(0xf77d3000, 4096, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 4, 0x18) = 0xfffffffff77d3000
mmap2(0xf77d4000, 17736, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_ANONYMOUS, -1, 0) = 0xfffffffff77d4000
close(4) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries/libg2c.so.0", O_RDONLY) = -1 ENOENT (No such file or directory)
open("/etc/ld.so.cache", O_RDONLY) = 4
fstat64(0x4, 0xffb476bc) = 0
mmap2(NULL, 183737, PROT_READ, MAP_PRIVATE, 4, 0) = 0xfffffffff778e000
close(4) = 0
open("/lib/i686/libg2c.so.0", O_RDONLY) = -1 ENOENT (No such file or directory)
open("/lib/libg2c.so.0", O_RDONLY) = -1 ENOENT (No such file or directory)
open("/usr/lib/sse2/libg2c.so.0", O_RDONLY) = -1 ENOENT (No such file or directory)
open("/usr/lib/libg2c.so.0", O_RDONLY) = -1 ENOENT (No such file or directory)
munmap(0xf778e000, 183737) = 0
munmap(0xf7841000, 2489824) = 0
munmap(0xf780e000, 208800) = 0
munmap(0xf7803000, 43824) = 0
munmap(0xf77d9000, 169568) = 0
munmap(0xf77bb000, 120136) = 0
brk(0x822b000) = 0x822b000
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/haplo/tclIndex", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb47e98) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "# Tcl autoload index file, versi"..., 4096) = 359
read(4, "", 4096) = 0
close(4) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/phrap/tclIndex", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb47e98) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "# Tcl autoload index file, versi"..., 4096) = 364
read(4, "", 4096) = 0
close(4) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/fak2/tclIndex", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb47e98) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "# Tcl autoload index file, versi"..., 4096) = 380
read(4, "", 4096) = 0
close(4) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/fak2/tclIndex", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb47e98) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "# Tcl autoload index file, versi"..., 4096) = 380
read(4, "", 4096) = 0
close(4) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/cap3/tclIndex", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb47e98) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "# Tcl autoload index file, versi"..., 4096) = 329
read(4, "", 4096) = 0
close(4) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/cap3/tclIndex", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb47e98) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "# Tcl autoload index file, versi"..., 4096) = 329
read(4, "", 4096) = 0
close(4) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/cap2/tclIndex", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb47e98) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "# Tcl autoload index file, versi"..., 4096) = 325
read(4, "", 4096) = 0
close(4) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/cap2/tclIndex", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb47e98) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "# Tcl autoload index file, versi"..., 4096) = 325
read(4, "", 4096) = 0
close(4) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/iwidgets/scripts/tclIndex", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb47e98) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "# Tcl autoload index file, versi"..., 4096) = 4096
read(4, "index(::iwidgets::Calendar::days"..., 4096) = 4096
read(4, "ir canvasprintbox.itk]]\nset auto"..., 4096) = 4096
read(4, "k]]\nset auto_index(::iwidgets::C"..., 4096) = 4096
read(4, "o_index(::iwidgets::Combobox::_b"..., 4096) = 4096
read(4, "e join $dir dialogshell.itk]]\nse"..., 4096) = 4096
read(4, "_index(::iwidgets::Entryfield::c"..., 4096) = 4096
read(4, "ileselectionbox::filetype) [list"..., 4096) = 4096
read(4, "ack.itk]]\nset auto_index(::iwidg"..., 4096) = 4096
read(4, "t source [file join $dir filesel"..., 4096) = 4096
read(4, " [file join $dir hierarchy.itk]]"..., 4096) = 4096
read(4, "et auto_index(::iwidgets::Hierar"..., 4096) = 4096
read(4, "ource [file join $dir labeledwid"..., 4096) = 4096
read(4, "ngth) [list source [file join $d"..., 4096) = 4096
read(4, "\nset auto_index(tkMenuFind) [lis"..., 4096) = 4096
read(4, "Page::command) [list source [fil"..., 4096) = 4096
read(4, "ile join $dir panedwindow.itk]]\n"..., 4096) = 4096
read(4, "auto_index(::iwidgets::Pushbutto"..., 4096) = 4096
mmap2(NULL, 139264, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_ANONYMOUS, -1, 0) = 0xfffffffff7a7f000
read(4, "dgets::Regexpfield::index) [list"..., 4096) = 4096
read(4, "gets::Scrolledcanvas::type) [lis"..., 4096) = 4096
read(4, "dhtml::_entity_a) [list source ["..., 4096) = 4096
read(4, "ex(::iwidgets::Scrolledhtml::_en"..., 4096) = 4096
read(4, "set auto_index(::iwidgets::Scrol"..., 4096) = 4096
read(4, "urce [file join $dir scrolledlis"..., 4096) = 4096
read(4, "o_index(::iwidgets::Scrolledwidg"..., 4096) = 4096
read(4, "le join $dir selectiondialog.itk"..., 4096) = 4096
read(4, " [file join $dir spinner.itk]]\ns"..., 4096) = 4096
read(4, "t source [file join $dir tabnote"..., 4096) = 4096
read(4, "in $dir tabset.itk]]\nset auto_in"..., 4096) = 4096
read(4, "ate) [list source [file join $di"..., 4096) = 4096
read(4, ":_popup) [list source [file join"..., 4096) = 4096
read(4, " toolbar.itk]]\nset auto_index(::"..., 4096) = 3945
read(4, "", 4096) = 0
brk(0x824c000) = 0x824c000
brk(0x826d000) = 0x826d000
munmap(0xf7a7f000, 139264) = 0
close(4) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = -1 ENOENT (No such file or directory)
access("/usr", F_OK) = 0
access("/usr/local", F_OK) = 0
access("/usr/local/staden-linux-x86-1-7-0", F_OK) = 0
access("/usr/local/staden-linux-x86-1-7-0/lib", F_OK) = 0
access("/usr/local/staden-linux-x86-1-7-0/lib/iwidgets", F_OK) = 0
access("/usr/local/staden-linux-x86-1-7-0/lib/iwidgets/generic", F_OK) = -1 ENOENT (No such file or directory)
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/iwidgets/generic/tclIndex", O_RDONLY|O_LARGEFILE) = -1 ENOENT (No such file or directory)
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/iwidgets/tclIndex", O_RDONLY|O_LARGEFILE) = -1 ENOENT (No such file or directory)
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/iwidgets/tclIndex", O_RDONLY|O_LARGEFILE) = -1 ENOENT (No such file or directory)
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/itk3.3/tclIndex", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb47e98) = -1 ENOTTY (Inappropriate ioctl for device)
brk(0x828e000) = 0x828e000
read(4, "# Tcl autoload index file, versi"..., 4096) = 578
read(4, "", 4096) = 0
close(4) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/itk3.3/tclIndex", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb47e98) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "# Tcl autoload index file, versi"..., 4096) = 578
read(4, "", 4096) = 0
close(4) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/itcl3.3/tclIndex", O_RDONLY|O_LARGEFILE) = -1 ENOENT (No such file or directory)
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/iwidgets/tclIndex", O_RDONLY|O_LARGEFILE) = -1 ENOENT (No such file or directory)
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/tk_utils/tclIndex", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb47e98) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "# Tcl autoload index file, versi"..., 4096) = 4096
read(4, "_def) [list source [file join $d"..., 4096) = 4096
read(4, "ndex(CheckFloatRange) [list sour"..., 4096) = 4096
read(4, "ist source [file join $dir html_"..., 4096) = 4096
read(4, "its) [list source [file join $di"..., 4096) = 4096
read(4, " [list source [file join $dir ca"..., 4096) = 4096
read(4, "yme_map.tcl]]\nset auto_index(Sel"..., 4096) = 4096
read(4, "set auto_index(spBiolimsDialog_I"..., 4096) = 4096
read(4, "index(::Widget::Xmclistbox::_bin"..., 4096) = 4096
read(4, "extract_element_name) [list sour"..., 4096) = 4096
read(4, "_element_different) [list source"..., 4096) = 1259
read(4, "", 4096) = 0
close(4) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/copy_reads/tclIndex", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb47e98) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "# Tcl autoload index file, versi"..., 4096) = 1457
read(4, "", 4096) = 0
close(4) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/tk_utils/tclIndex", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb47e98) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "# Tcl autoload index file, versi"..., 4096) = 4096
read(4, "_def) [list source [file join $d"..., 4096) = 4096
read(4, "ndex(CheckFloatRange) [list sour"..., 4096) = 4096
read(4, "ist source [file join $dir html_"..., 4096) = 4096
read(4, "its) [list source [file join $di"..., 4096) = 4096
read(4, " [list source [file join $dir ca"..., 4096) = 4096
read(4, "yme_map.tcl]]\nset auto_index(Sel"..., 4096) = 4096
read(4, "set auto_index(spBiolimsDialog_I"..., 4096) = 4096
read(4, "index(::Widget::Xmclistbox::_bin"..., 4096) = 4096
read(4, "extract_element_name) [list sour"..., 4096) = 4096
read(4, "_element_different) [list source"..., 4096) = 1259
read(4, "", 4096) = 0
close(4) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/gap/tclIndex", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb47e98) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "# Tcl autoload index file, versi"..., 4096) = 4096
read(4, "dex(popup_cs_contig_3) [list sou"..., 4096) = 4096
read(4, "e join $dir list_proc.tcl]]\nset "..., 4096) = 4096
read(4, "rce [file join $dir tag_editor.t"..., 4096) = 3803
read(4, "", 4096) = 0
close(4) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/tclIndex", O_RDONLY|O_LARGEFILE) = -1 ENOENT (No such file or directory)
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/tk_utils/tclIndex", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb47e98) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "# Tcl autoload index file, versi"..., 4096) = 4096
read(4, "_def) [list source [file join $d"..., 4096) = 4096
read(4, "ndex(CheckFloatRange) [list sour"..., 4096) = 4096
read(4, "ist source [file join $dir html_"..., 4096) = 4096
read(4, "its) [list source [file join $di"..., 4096) = 4096
read(4, " [list source [file join $dir ca"..., 4096) = 4096
read(4, "yme_map.tcl]]\nset auto_index(Sel"..., 4096) = 4096
read(4, "set auto_index(spBiolimsDialog_I"..., 4096) = 4096
read(4, "index(::Widget::Xmclistbox::_bin"..., 4096) = 4096
read(4, "extract_element_name) [list sour"..., 4096) = 4096
read(4, "_element_different) [list source"..., 4096) = 1259
read(4, "", 4096) = 0
close(4) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/tk_utils/tclIndex", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb47e98) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "# Tcl autoload index file, versi"..., 4096) = 4096
read(4, "_def) [list source [file join $d"..., 4096) = 4096
read(4, "ndex(CheckFloatRange) [list sour"..., 4096) = 4096
read(4, "ist source [file join $dir html_"..., 4096) = 4096
read(4, "its) [list source [file join $di"..., 4096) = 4096
read(4, " [list source [file join $dir ca"..., 4096) = 4096
read(4, "yme_map.tcl]]\nset auto_index(Sel"..., 4096) = 4096
read(4, "set auto_index(spBiolimsDialog_I"..., 4096) = 4096
read(4, "index(::Widget::Xmclistbox::_bin"..., 4096) = 4096
read(4, "extract_element_name) [list sour"..., 4096) = 4096
read(4, "_element_different) [list source"..., 4096) = 1259
read(4, "", 4096) = 0
close(4) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/tk/tclIndex", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb47e98) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "# Tcl autoload index file, versi"..., 4096) = 4096
read(4, "]]\nset auto_index(::tk::FocusGro"..., 4096) = 4096
read(4, "::tk::MenuDownArrow) [list sourc"..., 4096) = 4096
read(4, " [list source [file join $dir sp"..., 4096) = 4096
read(4, "\nset auto_index(::tk::IconList_A"..., 4096) = 4096
read(4, "_InterpFilter) [list source [fil"..., 4096) = 1730
read(4, "", 4096) = 0
close(4) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/tk_utils/tclIndex", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb47e98) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "# Tcl autoload index file, versi"..., 4096) = 4096
read(4, "_def) [list source [file join $d"..., 4096) = 4096
read(4, "ndex(CheckFloatRange) [list sour"..., 4096) = 4096
read(4, "ist source [file join $dir html_"..., 4096) = 4096
read(4, "its) [list source [file join $di"..., 4096) = 4096
read(4, " [list source [file join $dir ca"..., 4096) = 4096
read(4, "yme_map.tcl]]\nset auto_index(Sel"..., 4096) = 4096
read(4, "set auto_index(spBiolimsDialog_I"..., 4096) = 4096
read(4, "index(::Widget::Xmclistbox::_bin"..., 4096) = 4096
read(4, "extract_element_name) [list sour"..., 4096) = 4096
read(4, "_element_different) [list source"..., 4096) = 1259
read(4, "", 4096) = 0
close(4) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
open("/usr/local/lib/tclIndex", O_RDONLY|O_LARGEFILE) = -1 ENOENT (No such file or directory)
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/tclIndex", O_RDONLY|O_LARGEFILE) = -1 ENOENT (No such file or directory)
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
lstat64(0xffb46ec0, 0xffb46c5c) = 0
open("/usr/local/staden-linux-x86-1-7-0/lib/tcl/tclIndex", O_RDONLY|O_LARGEFILE) = 4
fcntl64(4, F_SETFD, FD_CLOEXEC) = 0
ioctl(4, SNDCTL_TMR_TIMEBASE or TCGETS, 0xffb47e98) = -1 ENOTTY (Inappropriate ioctl for device)
read(4, "# Tcl autoload index file, versi"..., 4096) = 4096
read(4, ") [list source [file join $dir s"..., 4096) = 1913
read(4, "", 4096) = 0
close(4) = 0
write(2, "invalid command name \"load_align"..., 211) = 211
write(2, "\r\n", 2) = 2
write(3, "\1\30\r\0\16\0\0\3\26\0\0\3\0\0\0\0\1\0\1\0\0\0\1\0\"\0"..., 224) = 224
read(3, "\1\10i\0\4\0\0\0\37\0\0\0\0\0\0\0\20\0\0\0\0\0\0\0\263"..., 32) = 32
readv(3, [{"3000001 gap.tcl\0", 16}, {"", 0}], 2) = 16
write(3, "\22\0\6\0?\0\0\0\201\1\0\0\37\0\0\0\10\0\1\0\0\0\0\0%\0"..., 28) = 28
write(3, "\22\0\6\0\1\0\0\3\202\1\0\0\37\0\0\0\10\0\1\0\0\0\0\0\4"..., 36) = 36
read(3, "\34\0l\0\1\0\0\3\202\1\0\0\267\373\313\257\0\0\0\0\0\0"..., 32) = 32
read(3, "\34\33m\0\1\0\0\3\202\1\0\0\267\373\313\257\1\0\0\0\0\0"..., 32) = 32
read(3, "\1\2n\0\0\0\0\0\37\0\300\2\0\0\0\0\0\0\0\0\0\0\0\0 ?\0"..., 32) = 32
write(3, "<\0\2\0\0\0\0\3+\1\1\0", 12) = 12
read(3, "\1\2p\0\0\0\0\0\37\0\300\2\0\0\0\0\0\0\0\0\0\0\0\0 ?\0"..., 32) = 32
shutdown(3, 2 /* send and receive */) = 0
close(3) = 0
fcntl64(2, F_GETFL) = 0x8002 (flags O_RDWR|O_LARGEFILE)
fcntl64(2, F_SETFL, O_RDWR|O_LARGEFILE) = 0
fcntl64(2, F_GETFL) = 0x8002 (flags O_RDWR|O_LARGEFILE)
fcntl64(1, F_GETFL) = 0x8002 (flags O_RDWR|O_LARGEFILE)
fcntl64(1, F_SETFL, O_RDWR|O_LARGEFILE) = 0
fcntl64(1, F_GETFL) = 0x8002 (flags O_RDWR|O_LARGEFILE)
fcntl64(0, F_GETFL) = 0x8002 (flags O_RDWR|O_LARGEFILE)
fcntl64(0, F_SETFL, O_RDWR|O_LARGEFILE) = 0
fcntl64(0, F_GETFL) = 0x8002 (flags O_RDWR|O_LARGEFILE)
exit_group(1) = ?

_______________________________________________
Staden mailing list
Staden@...
http://www.bio.net/biomail/listinfo/staden

Fwd: Error during installing Staden-src-1-7-0 package

2007-09-13T09:20:23Z

Hallo Jean,

.. I solved the problem you had using the following procedure:

The problem is indeed the compiled libz.a . To recompile that piece using the
-fPIC compiler option solves the problem. How to do this:

1. go into the directory <wherever_you_inst_it>/src/zlib (zlib should be a
symlink to zlib-1.2.2)
2. do a "make clean"
3. edit Makefile and change the following line

CFLAGS=-O3 -DUSE_MMAP

to:

CFLAGS=-O3 -DUSE_MMAP -fPIC

4. run "make" - it should compile the zlib.a file
5. cp the zlib.a file to ../lib/linux-x86_64-binaries/libz.a
6. cd to <wherever_you_inst_it>/src and do a "make -f Makefile.thirdparty" again

.. I encounter in another problem after that:

the wrong(32bit) libX was uses in linking stuff in tk_utils. To prevent that
problem you will have to edit the <wherever_you_inst_it>/src/mk/linux-x86_64.mk
file.

Change the line:

XBIN = /usr/X11R6/lib

in:

XBIN = /usr/X11R6/lib64 (or wherever X11 is installed)

This was on my RHEL Linux - but should be the same on Fedora for instance ...

Doing again a "make -f Makefile.thirdparty" should now compile the rest of the
Staden package ...

.. hope this will help you a bit ...
Greetings

Mike

[Staden] Fwd: Error during installing Staden-src-1-7-0 package
Jean Mao via staden%40net.bio.net (by maoj At helix.nih.gov)
Tue Feb 6 15:43:46 EST 2007
--------------------------------------------------------------------------------

Hi, I have problem compiling the package and here are what I have done. Any
help will be appreciated:

# first compile all the libraries
cd /usr/local/staden/staden-src-1-7-0
export STADENROOT=`pwd`
. staden.profile
cd src
make -f Makefile.thirdparty

# the program ran for a while then an error appear saying
/usr/local/staden/staden-src-1-7-0/lib/iwidgets can't be removed because
it's a directory. So I manually delete the directory and rerun make:

rm /usr/local/staden/staden-src-1-7-0/lib/iwidgets
make -f Makefile.rhirdparty

# at this point everything seems to be fine (but I was just guessing)
# Then I compile the staden package
cd /usr/local/staden/staden-src-1-7-0
make 2>&1 | tee make.out

# then the program ran for a while and show the errors below (far below):

In file included from include/Read.h:43,
from sff/linux-x86_64-binaries/../sff.c:26:
include/os.h:131:1: warning: "NEED_VA_COPY" redefined
<command line>:10:1: warning: this is the location of the previous
definition
sff/linux-x86_64-binaries/sff.o
cc -L../lib/linux-x86_64-binaries -shared -o
./lib/linux-x86_64-binaries/libread.so read/linux-x86_64-binarie
s/Read.o read/linux-x86_64-binaries/translate.o
read/linux-x86_64-binaries/scf_extras.o utils/linux-x86_64-binar
ies/find.o
utils/linux-x86_64-binaries/mach-io.outils/linux-x86_64-binaries/traceType.o
utils/linux-x86_64-bina
ries/read_alloc.o utils/linux-x86_64-binaries/compress.o
utils/linux-x86_64-binaries/open_trace_file.o utils/lin
ux-x86_64-binaries/hash_table.o utils/linux-x86_64-binaries/mFILE.o
utils/linux-x86_64-binaries/vlen.o scf/linux
-x86_64-binaries/read_scf.o scf/linux-x86_64-binaries/write_scf.o
scf/linux-x86_64-binaries/misc_scf.o exp_file/
linux-x86_64-binaries/expFileIO.o plain/linux-x86_64-binaries/seqIOPlain.o
abi/linux-x86_64-binaries/fpoint.o ab
i/linux-x86_64-binaries/seqIOABI.o alf/linux-x86_64-binaries/seqIOALF.o
ctf/linux-x86_64-binaries/ctfCompress.o
ctf/linux-x86_64-binaries/seqIOCTF.o ztr/linux-x86_64-binaries/compression.o
ztr/linux-x86_64-binaries/ztr_trans
late.o ztr/linux-x86_64-binaries/ztr.o sff/linux-x86_64-binaries/sff.o
-lz -lmisc -L/usr/lib64 -lcurl -L/usr
/kerberos/lib -L/usr/kerberos/lib64 -lssl -lcrypto -lgssapi_krb5 -lkrb5
-lcom_err -lk5crypto -lresolv -ldl -lz -
lgssapi_krb5 -lkrb5 -lk5crypto -lcom_err -lresolv -L/usr/kerberos/lib
-L/usr/kerberos/lib64 -lidn -lssl -lcrypto
-lssl -lcrypto -lgssapi_krb5 -lkrb5 -lcom_err -lk5crypto -lresolv -ldl -lz
-lz
/usr/bin/ld: ../lib/linux-x86_64-binaries/libz.a(crc32.o): relocation
R_X86_64_32 against `a local symbol' can n
ot be used when making a shared object; recompile with -fPIC
./lib/linux-x86_64-binaries/libz.a: could not read symbols: Bad value
collect2: ld returned 1 exit status
make[2]: *** [../lib/linux-x86_64-binaries/libread.so] Error 1
make[2]: Leaving directory `/usr/local/staden/staden-src-1-7-0/src/io_lib'
make[1]: *** [io_lib] Error 2
make[1]: Leaving directory `/usr/local/staden/staden-src-1-7-0/src'
make: *** [all] Error 2

Thank you.
-------------- next part --------------
cd src; make all
make[1]: Entering directory `/usr/local/staden/staden-src-1-7-0/src'
Makefile:75: warning: overriding commands for target `clean'
mk/global.mk:256: warning: ignoring old commands for target `clean'
Makefile:90: warning: overriding commands for target `depend'
mk/global.mk:515: warning: ignoring old commands for target `depend'
Makefile:144: warning: overriding commands for target `distsrc'
mk/global.mk:494: warning: ignoring old commands for target `distsrc'
cd Misc && make -w all
make[2]: Entering directory `/usr/local/staden/staden-src-1-7-0/src/Misc'
touch linux-x86_64-binaries/.dir
gcc -g -DUSE_NON_CONST -I. -I../Misc -Wimplicit -Wreturn-type -Wunused
-Wswitch -Wcomment -Wformat -Wstrict-prototypes -DNEED_VA_COPY=1
-D_FILE_OFFSET_BITS=64 -fPIC -o linux-x86_64-binaries/crash.o -c crash.c
In file included from misc.h:8,
from crash.c:1:
os.h:122:1: warning: "NEED_VA_COPY" redefined
<command line>:2:1: warning: this is the location of the previous definition
linux-x86_64-binaries/crash.o
gcc -g -DUSE_NON_CONST -I. -I../Misc -Wimplicit -Wreturn-type -Wunused
-Wswitch -Wcomment -Wformat -Wstrict-prototypes -DNEED_VA_COPY=1
-D_FILE_OFFSET_BITS=64 -fPIC -o linux-x86_64-binaries/date.o -c date.c
In file included from misc.h:8,
from date.c:1:
os.h:122:1: warning: "NEED_VA_COPY" redefined
<command line>:2:1: warning: this is the location of the previous definition
linux-x86_64-binaries/date.o
gcc -g -DUSE_NON_CONST -I. -I../Misc -Wimplicit -Wreturn-type -Wunused
-Wswitch -Wcomment -Wformat -Wstrict-prototypes -DNEED_VA_COPY=1
-D_FILE_OFFSET_BITS=64 -fPIC -o linux-x86_64-binaries/filenames.o -c filenames.c
In file included from misc.h:8,
from filenames.c:1:
os.h:122:1: warning: "NEED_VA_COPY" redefined
<command line>:2:1: warning: this is the location of the previous definition
linux-x86_64-binaries/filenames.o
gcc -g -DUSE_NON_CONST -I. -I../Misc -Wimplicit -Wreturn-type -Wunused
-Wswitch -Wcomment -Wformat -Wstrict-prototypes -DNEED_VA_COPY=1
-D_FILE_OFFSET_BITS=64 -fPIC -o linux-x86_64-binaries/files.o -c files.c
In file included from misc.h:8,
from files.c:1:
os.h:122:1: warning: "NEED_VA_COPY" redefined
<command line>:2:1: warning: this is the location of the previous definition
linux-x86_64-binaries/files.o
gcc -g -DUSE_NON_CONST -I. -I../Misc -Wimplicit -Wreturn-type -Wunused
-Wswitch -Wcomment -Wformat -Wstrict-prototypes -DNEED_VA_COPY=1
-D_FILE_OFFSET_BITS=64 -fPIC -o linux-x86_64-binaries/find.o -c find.c
In file included from misc.h:8,
from find.c:15:
os.h:122:1: warning: "NEED_VA_COPY" redefined
<command line>:2:1: warning: this is the location of the previous definition
linux-x86_64-binaries/find.o
gcc -g -DUSE_NON_CONST -I. -I../Misc -Wimplicit -Wreturn-type -Wunused
-Wswitch -Wcomment -Wformat -Wstrict-prototypes -DNEED_VA_COPY=1
-D_FILE_OFFSET_BITS=64 -fPIC -o linux-x86_64-binaries/shell.o -c shell.c
In file included from misc.h:8,
from shell.c:1:
os.h:122:1: warning: "NEED_VA_COPY" redefined
<command line>:2:1: warning: this is the location of the previous definition
linux-x86_64-binaries/shell.o
gcc -g -DUSE_NON_CONST -I. -I../Misc -Wimplicit -Wreturn-type -Wunused
-Wswitch -Wcomment -Wformat -Wstrict-prototypes -DNEED_VA_COPY=1
-D_FILE_OFFSET_BITS=64 -fPIC -o linux-x86_64-binaries/strings.o -c strings.c
In file included from misc.h:8,
from strings.c:1:
os.h:122:1: warning: "NEED_VA_COPY" redefined
<command line>:2:1: warning: this is the location of the previous definition
linux-x86_64-binaries/strings.o
gcc -g -DUSE_NON_CONST -I. -I../Misc -Wimplicit -Wreturn-type -Wunused
-Wswitch -Wcomment -Wformat -Wstrict-prototypes -DNEED_VA_COPY=1
-D_FILE_OFFSET_BITS=64 -fPIC -o linux-x86_64-binaries/usleep.o -c usleep.c
linux-x86_64-binaries/usleep.o
gcc -g -DUSE_NON_CONST -I. -I../Misc -Wimplicit -Wreturn-type -Wunused
-Wswitch -Wcomment -Wformat -Wstrict-prototypes -DNEED_VA_COPY=1
-D_FILE_OFFSET_BITS=64 -fPIC -o linux-x86_64-binaries/error.o -c error.c
linux-x86_64-binaries/error.o
gcc -g -DUSE_NON_CONST -I. -I../Misc -Wimplicit -Wreturn-type -Wunused
-Wswitch -Wcomment -Wformat -Wstrict-prototypes -DNEED_VA_COPY=1
-D_FILE_OFFSET_BITS=64 -fPIC -o linux-x86_64-binaries/xerror.o -c xerror.c
In file included from misc.h:8,
from xerror.c:16:
os.h:122:1: warning: "NEED_VA_COPY" redefined
<command line>:2:1: warning: this is the location of the previous definition
linux-x86_64-binaries/xerror.o
gcc -g -DUSE_NON_CONST -I. -I../Misc -Wimplicit -Wreturn-type -Wunused
-Wswitch -Wcomment -Wformat -Wstrict-prototypes -DNEED_VA_COPY=1
-D_FILE_OFFSET_BITS=64 -fPIC -o linux-x86_64-binaries/xalloc.o -c xalloc.c
linux-x86_64-binaries/xalloc.o
gcc -g -DUSE_NON_CONST -I. -I../Misc -Wimplicit -Wreturn-type -Wunused
-Wswitch -Wcomment -Wformat -Wstrict-prototypes -DNEED_VA_COPY=1
-D_FILE_OFFSET_BITS=64 -fPIC -o linux-x86_64-binaries/vlen.o -c vlen.c
linux-x86_64-binaries/vlen.o
gcc -g -DUSE_NON_CONST -I. -I../Misc -Wimplicit -Wreturn-type -Wunused
-Wswitch -Wcomment -Wformat -Wstrict-prototypes -DNEED_VA_COPY=1
-D_FILE_OFFSET_BITS=64 -fPIC -o linux-x86_64-binaries/FtoC.o -c FtoC.c
In file included from FtoC.c:1:
os.h:122:1: warning: "NEED_VA_COPY" redefined
<command line>:2:1: warning: this is the location of the previous definition
linux-x86_64-binaries/FtoC.o
gcc -g -DUSE_NON_CONST -I. -I../Misc -Wimplicit -Wreturn-type -Wunused
-Wswitch -Wcomment -Wformat -Wstrict-prototypes -DNEED_VA_COPY=1
-D_FILE_OFFSET_BITS=64 -fPIC -o linux-x86_64-binaries/getfile.o -c getfile.c
In file included from misc.h:8,
from getfile.c:9:
os.h:122:1: warning: "NEED_VA_COPY" redefined
<command line>:2:1: warning: this is the location of the previous definition
linux-x86_64-binaries/getfile.o
gcc -g -DUSE_NON_CONST -I. -I../Misc -Wimplicit -Wreturn-type -Wunused
-Wswitch -Wcomment -Wformat -Wstrict-prototypes -DNEED_VA_COPY=1
-D_FILE_OFFSET_BITS=64 -fPIC -o linux-x86_64-binaries/bitmap.o -c bitmap.c
In file included from bitmap.h:20,
from bitmap.c:19:
os.h:122:1: warning: "NEED_VA_COPY" redefined
<command line>:2:1: warning: this is the location of the previous definition
linux-x86_64-binaries/bitmap.o
gcc -g -DUSE_NON_CONST -I. -I../Misc -Wimplicit -Wreturn-type -Wunused
-Wswitch -Wcomment -Wformat -Wstrict-prototypes -DNEED_VA_COPY=1
-D_FILE_OFFSET_BITS=64 -fPIC -o linux-x86_64-binaries/array.o -c array.c
linux-x86_64-binaries/array.o
gcc -g -DUSE_NON_CONST -I. -I../Misc -Wimplicit -Wreturn-type -Wunused
-Wswitch -Wcomment -Wformat -Wstrict-prototypes -DNEED_VA_COPY=1
-D_FILE_OFFSET_BITS=64 -fPIC -o linux-x86_64-binaries/locks.o -c locks.c
linux-x86_64-binaries/locks.o
gcc -g -DUSE_NON_CONST -I. -I../Misc -Wimplicit -Wreturn-type -Wunused
-Wswitch -Wcomment -Wformat -Wstrict-prototypes -DNEED_VA_COPY=1
-D_FILE_OFFSET_BITS=64 -fPIC -o linux-x86_64-binaries/array_arith.o -c
array_arith.c
In file included from misc.h:8,
from array_arith.c:5:
os.h:122:1: warning: "NEED_VA_COPY" redefined
<command line>:2:1: warning: this is the location of the previous definition
linux-x86_64-binaries/array_arith.o
gcc -g -DUSE_NON_CONST -I. -I../Misc -Wimplicit -Wreturn-type -Wunused
-Wswitch -Wcomment -Wformat -Wstrict-prototypes -DNEED_VA_COPY=1
-D_FILE_OFFSET_BITS=64 -fPIC -o linux-x86_64-binaries/parse_db.o -c parse_db.c
In file included from misc.h:8,
from parse_db.c:25:
os.h:122:1: warning: "NEED_VA_COPY" redefined
<command line>:2:1: warning: this is the location of the previous definition
linux-x86_64-binaries/parse_db.o
gcc -g -DUSE_NON_CONST -I. -I../Misc -Wimplicit -Wreturn-type -Wunused
-Wswitch -Wcomment -Wformat -Wstrict-prototypes -DNEED_VA_COPY=1
-D_FILE_OFFSET_BITS=64 -fPIC -o linux-x86_64-binaries/dstring.o -c dstring.c
linux-x86_64-binaries/dstring.o
cc -L../lib/linux-x86_64-binaries -shared -o
./lib/linux-x86_64-binaries/libmisc.so linux-x86_64-binaries/crash.o
linux-x86_64-binaries/date.o linux-x86_64-binaries/filenames.o
linux-x86_64-binaries/files.o linux-x86_64-binaries/find.o
linux-x86_64-binaries/shell.o linux-x86_64-binaries/strings.o
linux-x86_64-binaries/usleep.o linux-x86_64-binaries/error.o
linux-x86_64-binaries/xerror.o linux-x86_64-binaries/xalloc.o
linux-x86_64-binaries/vlen.o linux-x86_64-binaries/FtoC.o
linux-x86_64-binaries/getfile.o linux-x86_64-binaries/bitmap.o
linux-x86_64-binaries/array.o linux-x86_64-binaries/locks.o
linux-x86_64-binaries/array_arith.o linux-x86_64-binaries/parse_db.o
linux-x86_64-binaries/dstring.o -lm
make[2]: Leaving directory `/usr/local/staden/staden-src-1-7-0/src/Misc'
cd io_lib && make -w all
make[2]: Entering directory `/usr/local/staden/staden-src-1-7-0/src/io_lib'
Makefile:172: warning: overriding commands for target `distsrc'
./mk/global.mk:494: warning: ignoring old commands for target `distsrc'
Makefile:202: warning: overriding commands for target `depend'
./mk/global.mk:515: warning: ignoring old commands for target `depend'
cd include; \
for i in abi alf ctf exp_file plain read scf sff utils ztr; \
do \
ln -s ../$i/*.h .;\
done
touch include/.links
touch read/linux-x86_64-binaries/.dir
touch utils/linux-x86_64-binaries/.dir
touch abi/linux-x86_64-binaries/.dir
touch alf/linux-x86_64-binaries/.dir
touch ctf/linux-x86_64-binaries/.dir
touch exp_file/linux-x86_64-binaries/.dir
touch plain/linux-x86_64-binaries/.dir
touch progs/linux-x86_64-binaries/.dir
touch scf/linux-x86_64-binaries/.dir
touch ztr/linux-x86_64-binaries/.dir
touch sff/linux-x86_64-binaries/.dir
make[2]: [read/linux-x86_64-binaries/Read.o] Error 1 (ignored)
gcc -g -DUSE_NON_CONST -DIOLIB_SCF -DIOLIB_EXP -DIOLIB_PLN -DIOLIB_ABI
-DIOLIB_ALF -DIOLIB_CTF -DIOLIB_ZTR -DIOLIB_SFF -Iinclude -I. -I../Misc
-Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat
-Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -I../zlib
-DHAVE_LIBCURL -o read/linux-x86_64-binaries/Read.o -c
read/linux-x86_64-binaries/../Read.c
In file included from read/linux-x86_64-binaries/../Read.h:43,
from read/linux-x86_64-binaries/../Read.c:40:
include/os.h:131:1: warning: "NEED_VA_COPY" redefined
<command line>:10:1: warning: this is the location of the previous definition
read/linux-x86_64-binaries/Read.o
make[2]: [read/linux-x86_64-binaries/translate.o] Error 1 (ignored)
gcc -g -DUSE_NON_CONST -DIOLIB_SCF -DIOLIB_EXP -DIOLIB_PLN -DIOLIB_ABI
-DIOLIB_ALF -DIOLIB_CTF -DIOLIB_ZTR -DIOLIB_SFF -Iinclude -I. -I../Misc
-Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat
-Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -I../zlib
-DHAVE_LIBCURL -o read/linux-x86_64-binaries/translate.o -c
read/linux-x86_64-binaries/../translate.c
In file included from include/misc.h:8,
from read/linux-x86_64-binaries/../translate.c:28:
include/os.h:131:1: warning: "NEED_VA_COPY" redefined
<command line>:10:1: warning: this is the location of the previous definition
read/linux-x86_64-binaries/translate.o
make[2]: [read/linux-x86_64-binaries/scf_extras.o] Error 1 (ignored)
gcc -g -DUSE_NON_CONST -DIOLIB_SCF -DIOLIB_EXP -DIOLIB_PLN -DIOLIB_ABI
-DIOLIB_ALF -DIOLIB_CTF -DIOLIB_ZTR -DIOLIB_SFF -Iinclude -I. -I../Misc
-Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat
-Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -I../zlib
-DHAVE_LIBCURL -o read/linux-x86_64-binaries/scf_extras.o -c
read/linux-x86_64-binaries/../scf_extras.c
In file included from include/misc.h:8,
from read/linux-x86_64-binaries/../scf_extras.c:28:
include/os.h:131:1: warning: "NEED_VA_COPY" redefined
<command line>:10:1: warning: this is the location of the previous definition
read/linux-x86_64-binaries/scf_extras.o
make[2]: [utils/linux-x86_64-binaries/find.o] Error 1 (ignored)
gcc -g -DUSE_NON_CONST -DIOLIB_SCF -DIOLIB_EXP -DIOLIB_PLN -DIOLIB_ABI
-DIOLIB_ALF -DIOLIB_CTF -DIOLIB_ZTR -DIOLIB_SFF -Iinclude -I. -I../Misc
-Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat
-Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -I../zlib
-DHAVE_LIBCURL -o utils/linux-x86_64-binaries/find.o -c
utils/linux-x86_64-binaries/../find.c
In file included from utils/linux-x86_64-binaries/../misc.h:8,
from utils/linux-x86_64-binaries/../find.c:15:
utils/linux-x86_64-binaries/../os.h:131:1: warning: "NEED_VA_COPY" redefined
<command line>:10:1: warning: this is the location of the previous definition
utils/linux-x86_64-binaries/find.o
make[2]: [utils/linux-x86_64-binaries/mach-io.o] Error 1 (ignored)
gcc -g -DUSE_NON_CONST -DIOLIB_SCF -DIOLIB_EXP -DIOLIB_PLN -DIOLIB_ABI
-DIOLIB_ALF -DIOLIB_CTF -DIOLIB_ZTR -DIOLIB_SFF -Iinclude -I. -I../Misc
-Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat
-Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -I../zlib
-DHAVE_LIBCURL -o utils/linux-x86_64-binaries/mach-io.o -c
utils/linux-x86_64-binaries/../mach-io.c
In file included from utils/linux-x86_64-binaries/../mach-io.h:41,
from utils/linux-x86_64-binaries/../mach-io.c:44:
utils/linux-x86_64-binaries/../os.h:131:1: warning: "NEED_VA_COPY" redefined
<command line>:10:1: warning: this is the location of the previous definition
utils/linux-x86_64-binaries/mach-io.o
make[2]: [utils/linux-x86_64-binaries/traceType.o] Error 1 (ignored)
gcc -g -DUSE_NON_CONST -DIOLIB_SCF -DIOLIB_EXP -DIOLIB_PLN -DIOLIB_ABI
-DIOLIB_ALF -DIOLIB_CTF -DIOLIB_ZTR -DIOLIB_SFF -Iinclude -I. -I../Misc
-Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat
-Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -I../zlib
-DHAVE_LIBCURL -o utils/linux-x86_64-binaries/traceType.o -c
utils/linux-x86_64-binaries/../traceType.c
In file included from include/Read.h:43,
from utils/linux-x86_64-binaries/../traceType.h:34,
from utils/linux-x86_64-binaries/../traceType.c:34:
include/os.h:131:1: warning: "NEED_VA_COPY" redefined
<command line>:10:1: warning: this is the location of the previous definition
utils/linux-x86_64-binaries/traceType.o
make[2]: [utils/linux-x86_64-binaries/read_alloc.o] Error 1 (ignored)
gcc -g -DUSE_NON_CONST -DIOLIB_SCF -DIOLIB_EXP -DIOLIB_PLN -DIOLIB_ABI
-DIOLIB_ALF -DIOLIB_CTF -DIOLIB_ZTR -DIOLIB_SFF -Iinclude -I. -I../Misc
-Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat
-Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -I../zlib
-DHAVE_LIBCURL -o utils/linux-x86_64-binaries/read_alloc.o -c
utils/linux-x86_64-binaries/../read_alloc.c
In file included from utils/linux-x86_64-binaries/../misc.h:8,
from utils/linux-x86_64-binaries/../read_alloc.c:39:
utils/linux-x86_64-binaries/../os.h:131:1: warning: "NEED_VA_COPY" redefined
<command line>:10:1: warning: this is the location of the previous definition
utils/linux-x86_64-binaries/read_alloc.o
make[2]: [utils/linux-x86_64-binaries/compress.o] Error 1 (ignored)
gcc -g -DUSE_NON_CONST -DIOLIB_SCF -DIOLIB_EXP -DIOLIB_PLN -DIOLIB_ABI
-DIOLIB_ALF -DIOLIB_CTF -DIOLIB_ZTR -DIOLIB_SFF -Iinclude -I. -I../Misc
-Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat
-Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -I../zlib
-DHAVE_LIBCURL -o utils/linux-x86_64-binaries/compress.o -c
utils/linux-x86_64-binaries/../compress.c
In file included from utils/linux-x86_64-binaries/../compress.c:36:
utils/linux-x86_64-binaries/../os.h:131:1: warning: "NEED_VA_COPY" redefined
<command line>:10:1: warning: this is the location of the previous definition
utils/linux-x86_64-binaries/compress.o
make[2]: [utils/linux-x86_64-binaries/open_trace_file.o] Error 1 (ignored)
gcc -g -DUSE_NON_CONST -DIOLIB_SCF -DIOLIB_EXP -DIOLIB_PLN -DIOLIB_ABI
-DIOLIB_ALF -DIOLIB_CTF -DIOLIB_ZTR -DIOLIB_SFF -Iinclude -I. -I../Misc
-Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat
-Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -I../zlib
-DHAVE_LIBCURL -o utils/linux-x86_64-binaries/open_trace_file.o -c
utils/linux-x86_64-binaries/../open_trace_file.c
In file included from utils/linux-x86_64-binaries/../open_trace_file.c:18:
utils/linux-x86_64-binaries/../os.h:131:1: warning: "NEED_VA_COPY" redefined
<command line>:10:1: warning: this is the location of the previous definition
utils/linux-x86_64-binaries/open_trace_file.o
make[2]: [utils/linux-x86_64-binaries/hash_table.o] Error 1 (ignored)
gcc -g -DUSE_NON_CONST -DIOLIB_SCF -DIOLIB_EXP -DIOLIB_PLN -DIOLIB_ABI
-DIOLIB_ALF -DIOLIB_CTF -DIOLIB_ZTR -DIOLIB_SFF -Iinclude -I. -I../Misc
-Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat
-Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -I../zlib
-DHAVE_LIBCURL -o utils/linux-x86_64-binaries/hash_table.o -c
utils/linux-x86_64-binaries/../hash_table.c
In file included from utils/linux-x86_64-binaries/../hash_table.c:4:
utils/linux-x86_64-binaries/../os.h:131:1: warning: "NEED_VA_COPY" redefined
<command line>:10:1: warning: this is the location of the previous definition
utils/linux-x86_64-binaries/hash_table.o
make[2]: [utils/linux-x86_64-binaries/mFILE.o] Error 1 (ignored)
gcc -g -DUSE_NON_CONST -DIOLIB_SCF -DIOLIB_EXP -DIOLIB_PLN -DIOLIB_ABI
-DIOLIB_ALF -DIOLIB_CTF -DIOLIB_ZTR -DIOLIB_SFF -Iinclude -I. -I../Misc
-Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat
-Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -I../zlib
-DHAVE_LIBCURL -o utils/linux-x86_64-binaries/mFILE.o -c
utils/linux-x86_64-binaries/../mFILE.c
In file included from utils/linux-x86_64-binaries/../mFILE.c:11:
utils/linux-x86_64-binaries/../os.h:131:1: warning: "NEED_VA_COPY" redefined
<command line>:10:1: warning: this is the location of the previous definition
utils/linux-x86_64-binaries/mFILE.o
make[2]: [utils/linux-x86_64-binaries/vlen.o] Error 1 (ignored)
gcc -g -DUSE_NON_CONST -DIOLIB_SCF -DIOLIB_EXP -DIOLIB_PLN -DIOLIB_ABI
-DIOLIB_ALF -DIOLIB_CTF -DIOLIB_ZTR -DIOLIB_SFF -Iinclude -I. -I../Misc
-Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat
-Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -I../zlib
-DHAVE_LIBCURL -o utils/linux-x86_64-binaries/vlen.o -c
utils/linux-x86_64-binaries/../vlen.c
utils/linux-x86_64-binaries/vlen.o
make[2]: [scf/linux-x86_64-binaries/read_scf.o] Error 1 (ignored)
gcc -g -DUSE_NON_CONST -DIOLIB_SCF -DIOLIB_EXP -DIOLIB_PLN -DIOLIB_ABI
-DIOLIB_ALF -DIOLIB_CTF -DIOLIB_ZTR -DIOLIB_SFF -Iinclude -I. -I../Misc
-Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat
-Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -I../zlib
-DHAVE_LIBCURL -o scf/linux-x86_64-binaries/read_scf.o -c
scf/linux-x86_64-binaries/../read_scf.c
In file included from scf/linux-x86_64-binaries/../scf.h:32,
from scf/linux-x86_64-binaries/../read_scf.c:39:
include/os.h:131:1: warning: "NEED_VA_COPY" redefined
<command line>:10:1: warning: this is the location of the previous definition
scf/linux-x86_64-binaries/read_scf.o
make[2]: [scf/linux-x86_64-binaries/write_scf.o] Error 1 (ignored)
gcc -g -DUSE_NON_CONST -DIOLIB_SCF -DIOLIB_EXP -DIOLIB_PLN -DIOLIB_ABI
-DIOLIB_ALF -DIOLIB_CTF -DIOLIB_ZTR -DIOLIB_SFF -Iinclude -I. -I../Misc
-Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat
-Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -I../zlib
-DHAVE_LIBCURL -o scf/linux-x86_64-binaries/write_scf.o -c
scf/linux-x86_64-binaries/../write_scf.c
In file included from scf/linux-x86_64-binaries/../scf.h:32,
from scf/linux-x86_64-binaries/../write_scf.c:56:
include/os.h:131:1: warning: "NEED_VA_COPY" redefined
<command line>:10:1: warning: this is the location of the previous definition
scf/linux-x86_64-binaries/write_scf.o
make[2]: [scf/linux-x86_64-binaries/misc_scf.o] Error 1 (ignored)
gcc -g -DUSE_NON_CONST -DIOLIB_SCF -DIOLIB_EXP -DIOLIB_PLN -DIOLIB_ABI
-DIOLIB_ALF -DIOLIB_CTF -DIOLIB_ZTR -DIOLIB_SFF -Iinclude -I. -I../Misc
-Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat
-Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -I../zlib
-DHAVE_LIBCURL -o scf/linux-x86_64-binaries/misc_scf.o -c
scf/linux-x86_64-binaries/../misc_scf.c
In file included from scf/linux-x86_64-binaries/../scf.h:32,
from scf/linux-x86_64-binaries/../misc_scf.c:29:
include/os.h:131:1: warning: "NEED_VA_COPY" redefined
<command line>:10:1: warning: this is the location of the previous definition
scf/linux-x86_64-binaries/misc_scf.o
make[2]: [exp_file/linux-x86_64-binaries/expFileIO.o] Error 1 (ignored)
gcc -g -DUSE_NON_CONST -DIOLIB_SCF -DIOLIB_EXP -DIOLIB_PLN -DIOLIB_ABI
-DIOLIB_ALF -DIOLIB_CTF -DIOLIB_ZTR -DIOLIB_SFF -Iinclude -I. -I../Misc
-Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat
-Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -I../zlib
-DHAVE_LIBCURL -o exp_file/linux-x86_64-binaries/expFileIO.o -c
exp_file/linux-x86_64-binaries/../expFileIO.c
In file included from exp_file/linux-x86_64-binaries/../expFileIO.h:33,
from exp_file/linux-x86_64-binaries/../expFileIO.c:71:
include/os.h:131:1: warning: "NEED_VA_COPY" redefined
<command line>:10:1: warning: this is the location of the previous definition
exp_file/linux-x86_64-binaries/expFileIO.o
make[2]: [plain/linux-x86_64-binaries/seqIOPlain.o] Error 1 (ignored)
gcc -g -DUSE_NON_CONST -DIOLIB_SCF -DIOLIB_EXP -DIOLIB_PLN -DIOLIB_ABI
-DIOLIB_ALF -DIOLIB_CTF -DIOLIB_ZTR -DIOLIB_SFF -Iinclude -I. -I../Misc
-Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat
-Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -I../zlib
-DHAVE_LIBCURL -o plain/linux-x86_64-binaries/seqIOPlain.o -c
plain/linux-x86_64-binaries/../seqIOPlain.c
In file included from include/misc.h:8,
from plain/linux-x86_64-binaries/../seqIOPlain.c:55:
include/os.h:131:1: warning: "NEED_VA_COPY" redefined
<command line>:10:1: warning: this is the location of the previous definition
plain/linux-x86_64-binaries/seqIOPlain.o
make[2]: [abi/linux-x86_64-binaries/fpoint.o] Error 1 (ignored)
gcc -g -DUSE_NON_CONST -DIOLIB_SCF -DIOLIB_EXP -DIOLIB_PLN -DIOLIB_ABI
-DIOLIB_ALF -DIOLIB_CTF -DIOLIB_ZTR -DIOLIB_SFF -Iinclude -I. -I../Misc
-Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat
-Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -I../zlib
-DHAVE_LIBCURL -o abi/linux-x86_64-binaries/fpoint.o -c
abi/linux-x86_64-binaries/../fpoint.c
abi/linux-x86_64-binaries/fpoint.o
make[2]: [abi/linux-x86_64-binaries/seqIOABI.o] Error 1 (ignored)
gcc -g -DUSE_NON_CONST -DIOLIB_SCF -DIOLIB_EXP -DIOLIB_PLN -DIOLIB_ABI
-DIOLIB_ALF -DIOLIB_CTF -DIOLIB_ZTR -DIOLIB_SFF -Iinclude -I. -I../Misc
-Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat
-Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -I../zlib
-DHAVE_LIBCURL -o abi/linux-x86_64-binaries/seqIOABI.o -c
abi/linux-x86_64-binaries/../seqIOABI.c
In file included from abi/linux-x86_64-binaries/../seqIOABI.h:19,
from abi/linux-x86_64-binaries/../seqIOABI.c:87:
include/os.h:131:1: warning: "NEED_VA_COPY" redefined
<command line>:10:1: warning: this is the location of the previous definition
abi/linux-x86_64-binaries/seqIOABI.o
make[2]: [alf/linux-x86_64-binaries/seqIOALF.o] Error 1 (ignored)
gcc -g -DUSE_NON_CONST -DIOLIB_SCF -DIOLIB_EXP -DIOLIB_PLN -DIOLIB_ABI
-DIOLIB_ALF -DIOLIB_CTF -DIOLIB_ZTR -DIOLIB_SFF -Iinclude -I. -I../Misc
-Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat
-Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -I../zlib
-DHAVE_LIBCURL -o alf/linux-x86_64-binaries/seqIOALF.o -c
alf/linux-x86_64-binaries/../seqIOALF.c
In file included from include/Read.h:43,
from alf/linux-x86_64-binaries/../seqIOALF.c:82:
include/os.h:131:1: warning: "NEED_VA_COPY" redefined
<command line>:10:1: warning: this is the location of the previous definition
alf/linux-x86_64-binaries/seqIOALF.o
make[2]: [ctf/linux-x86_64-binaries/ctfCompress.o] Error 1 (ignored)
gcc -g -DUSE_NON_CONST -DIOLIB_SCF -DIOLIB_EXP -DIOLIB_PLN -DIOLIB_ABI
-DIOLIB_ALF -DIOLIB_CTF -DIOLIB_ZTR -DIOLIB_SFF -Iinclude -I. -I../Misc
-Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat
-Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -I../zlib
-DHAVE_LIBCURL -o ctf/linux-x86_64-binaries/ctfCompress.o -c
ctf/linux-x86_64-binaries/../ctfCompress.c
In file included from include/Read.h:43,
from ctf/linux-x86_64-binaries/../seqIOCTF.h:4,
from ctf/linux-x86_64-binaries/../ctfCompress.c:8:
include/os.h:131:1: warning: "NEED_VA_COPY" redefined
<command line>:10:1: warning: this is the location of the previous definition
ctf/linux-x86_64-binaries/ctfCompress.o
make[2]: [ctf/linux-x86_64-binaries/seqIOCTF.o] Error 1 (ignored)
gcc -g -DUSE_NON_CONST -DIOLIB_SCF -DIOLIB_EXP -DIOLIB_PLN -DIOLIB_ABI
-DIOLIB_ALF -DIOLIB_CTF -DIOLIB_ZTR -DIOLIB_SFF -Iinclude -I. -I../Misc
-Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat
-Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -I../zlib
-DHAVE_LIBCURL -o ctf/linux-x86_64-binaries/seqIOCTF.o -c
ctf/linux-x86_64-binaries/../seqIOCTF.c
In file included from include/Read.h:43,
from ctf/linux-x86_64-binaries/../seqIOCTF.c:20:
include/os.h:131:1: warning: "NEED_VA_COPY" redefined
<command line>:10:1: warning: this is the location of the previous definition
ctf/linux-x86_64-binaries/seqIOCTF.o
make[2]: [ztr/linux-x86_64-binaries/compression.o] Error 1 (ignored)
gcc -g -DUSE_NON_CONST -DIOLIB_SCF -DIOLIB_EXP -DIOLIB_PLN -DIOLIB_ABI
-DIOLIB_ALF -DIOLIB_CTF -DIOLIB_ZTR -DIOLIB_SFF -Iinclude -I. -I../Misc
-Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat
-Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -I../zlib
-DHAVE_LIBCURL -o ztr/linux-x86_64-binaries/compression.o -c
ztr/linux-x86_64-binaries/../compression.c
In file included from include/Read.h:43,
from ztr/linux-x86_64-binaries/../ztr.h:4,
from ztr/linux-x86_64-binaries/../compression.c:13:
include/os.h:131:1: warning: "NEED_VA_COPY" redefined
<command line>:10:1: warning: this is the location of the previous definition
ztr/linux-x86_64-binaries/compression.o
make[2]: [ztr/linux-x86_64-binaries/ztr_translate.o] Error 1 (ignored)
gcc -g -DUSE_NON_CONST -DIOLIB_SCF -DIOLIB_EXP -DIOLIB_PLN -DIOLIB_ABI
-DIOLIB_ALF -DIOLIB_CTF -DIOLIB_ZTR -DIOLIB_SFF -Iinclude -I. -I../Misc
-Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat
-Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -I../zlib
-DHAVE_LIBCURL -o ztr/linux-x86_64-binaries/ztr_translate.o -c
ztr/linux-x86_64-binaries/../ztr_translate.c
In file included from include/Read.h:43,
from ztr/linux-x86_64-binaries/../ztr.h:4,
from ztr/linux-x86_64-binaries/../ztr_translate.c:4:
include/os.h:131:1: warning: "NEED_VA_COPY" redefined
<command line>:10:1: warning: this is the location of the previous definition
ztr/linux-x86_64-binaries/../ztr_translate.c:128: warning:
'ztr_encode_samples_A' defined but not used
ztr/linux-x86_64-binaries/../ztr_translate.c:134: warning:
'ztr_encode_samples_C' defined but not used
ztr/linux-x86_64-binaries/../ztr_translate.c:140: warning:
'ztr_encode_samples_G' defined but not used
ztr/linux-x86_64-binaries/../ztr_translate.c:146: warning:
'ztr_encode_samples_T' defined but not used
ztr/linux-x86_64-binaries/../ztr_translate.c:293: warning:
'ztr_encode_confidence_1' defined but not used
ztr/linux-x86_64-binaries/ztr_translate.o
make[2]: [ztr/linux-x86_64-binaries/ztr.o] Error 1 (ignored)
gcc -g -DUSE_NON_CONST -DIOLIB_SCF -DIOLIB_EXP -DIOLIB_PLN -DIOLIB_ABI
-DIOLIB_ALF -DIOLIB_CTF -DIOLIB_ZTR -DIOLIB_SFF -Iinclude -I. -I../Misc
-Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat
-Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -I../zlib
-DHAVE_LIBCURL -o ztr/linux-x86_64-binaries/ztr.o -c
ztr/linux-x86_64-binaries/../ztr.c
In file included from include/Read.h:43,
from ztr/linux-x86_64-binaries/../ztr.h:4,
from ztr/linux-x86_64-binaries/../ztr.c:7:
include/os.h:131:1: warning: "NEED_VA_COPY" redefined
<command line>:10:1: warning: this is the location of the previous definition
ztr/linux-x86_64-binaries/ztr.o
make[2]: [sff/linux-x86_64-binaries/sff.o] Error 1 (ignored)
gcc -g -DUSE_NON_CONST -DIOLIB_SCF -DIOLIB_EXP -DIOLIB_PLN -DIOLIB_ABI
-DIOLIB_ALF -DIOLIB_CTF -DIOLIB_ZTR -DIOLIB_SFF -Iinclude -I. -I../Misc
-Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat
-Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -I../zlib
-DHAVE_LIBCURL -o sff/linux-x86_64-binaries/sff.o -c
sff/linux-x86_64-binaries/../sff.c
In file included from include/Read.h:43,
from sff/linux-x86_64-binaries/../sff.c:26:
include/os.h:131:1: warning: "NEED_VA_COPY" redefined
<command line>:10:1: warning: this is the location of the previous definition
sff/linux-x86_64-binaries/sff.o
cc -L../lib/linux-x86_64-binaries -shared -o
./lib/linux-x86_64-binaries/libread.so read/linux-x86_64-binaries/Read.o
read/linux-x86_64-binaries/translate.o read/linux-x86_64-binaries/scf_extras.o
utils/linux-x86_64-binaries/find.o utils/linux-x86_64-binaries/mach-io.o
utils/linux-x86_64-binaries/traceType.o utils/linux-x86_64-binaries/read_alloc.o
utils/linux-x86_64-binaries/compress.o
utils/linux-x86_64-binaries/open_trace_file.o
utils/linux-x86_64-binaries/hash_table.o utils/linux-x86_64-binaries/mFILE.o
utils/linux-x86_64-binaries/vlen.o scf/linux-x86_64-binaries/read_scf.o
scf/linux-x86_64-binaries/write_scf.o scf/linux-x86_64-binaries/misc_scf.o
exp_file/linux-x86_64-binaries/expFileIO.o
plain/linux-x86_64-binaries/seqIOPlain.o abi/linux-x86_64-binaries/fpoint.o
abi/linux-x86_64-binaries/seqIOABI.o alf/linux-x86_64-binaries/seqIOALF.o
ctf/linux-x86_64-binaries/ctfCompress.o ctf/linux-x86_64-binaries/seqIOCTF.o
ztr/linux-x86_64-binaries/compression.o
ztr/linux-x86_64-binaries/ztr_translate.o ztr/linux-x86_64-binaries/ztr.o
sff/linux-x86_64-binaries/sff.o -lz -lmisc -L/usr/lib64 -lcurl
-L/usr/kerberos/lib -L/usr/kerberos/lib64 -lssl -lcrypto -lgssapi_krb5 -lkrb5
-lcom_err -lk5crypto -lresolv -ldl -lz -lgssapi_krb5 -lkrb5 -lk5crypto -lcom_err
-lresolv -L/usr/kerberos/lib -L/usr/kerberos/lib64 -lidn -lssl -lcrypto -lssl
-lcrypto -lgssapi_krb5 -lkrb5 -lcom_err -lk5crypto -lresolv -ldl -lz -lz
/usr/bin/ld: ../lib/linux-x86_64-binaries/libz.a(crc32.o): relocation
R_X86_64_32 against `a local symbol' can not be used when making a shared
object; recompile with -fPIC
./lib/linux-x86_64-binaries/libz.a: could not read symbols: Bad value
collect2: ld returned 1 exit status
make[2]: *** [../lib/linux-x86_64-binaries/libread.so] Error 1
make[2]: Leaving directory `/usr/local/staden/staden-src-1-7-0/src/io_lib'
make[1]: *** [io_lib] Error 2
make[1]: Leaving directory `/usr/local/staden/staden-src-1-7-0/src'
make: *** [all] Error 2

--
+--------------------------------------------------------------------+
| Mike Schilling Head IT Eurofins MWG |
| Eurofins MWG GmbH voice : int+49 8092 8289303 |
| Anzinger Strasse 7, fax : int+49 8092 8289561 |
| D-85560 Ebersberg, Germany mobile: int+49 172 8270532 |
| email : mschilling@... |
| Register No.: HRB 165840 web : http://www.mwgdna.com |
| Register Court: Munich |
| Chief Operating Officer: Bruno Poddevin, Ph.D. |
| Ust-IdNr.: DE200191571 |
+--------------------------------------------------------------------+

_______________________________________________
Staden mailing list
Staden@...
http://www.bio.net/biomail/listinfo/staden

Re: Staden startup

2007-08-18T19:24:22Z

I copied all the files from package staden-linux-1-6-0/linux-bin to
staden-src-1-7-0/linux-bin. It gave me error but atleast bash has
started recognizing gap4, pregap4 etc commands.
However I dont know the compatibility between both the release and why
did not Staden came automatically with preloaded files in staden-
src-1-7-0/linux-bin.
Is it right way to do?

_______________________________________________
Staden mailing list
Staden@...
http://www.bio.net/biomail/listinfo/staden

Staden startup

2007-08-13T15:56:39Z

Hi everyone,
Though I tried hard to look at possible solution in the group, I am
not able to find (or understand) out an answer.

I downloaded staden1.7.
I ran makefile.thirdparty
It stopped in middle due to error (iwidgets). So I manually installed
as written in the Readme document.
I copied : export STADENROOT=/usr/local/staden
. $STADENROOT/staden.profile in the /etc/profile.local and /etc/
profile (just to make it run anyhow)
I did cd src and did make (it again gave me some errors)
I did make distunix (it again gave few more errors)

If I type pregap4 (or gap4 etc) from the command line, it gives me
message: command not found

I dont know where to start from and where the error is.

I checked machine binaries and all the *.so files are installed
properly.

Are there any other steps which I am missing.

Do I need to set environment variable some place also.

Is there any specific command to first start staden and then access
gap4 etc.

I will be thankful for any answers as my project is getting delayed.

Thanks,
Arun

_______________________________________________
Staden mailing list
Staden@...
http://www.bio.net/biomail/listinfo/staden

error while loading shared libraries: libtk_utils.so

2007-07-19T08:00:13Z

Hi All

I am not the first to experience this so a solution should be
available (although I do not have it)
I have 64 bit Centos 5 linux on my dual core AMD machine.
1. I have downloaded staden-linux-x86-1-7-0.tar.gz and unpacked in my /
usr/local directory
2. My .bash_profile is as follows

# .bash_profile

# Get the aliases and functions
if [ -f ~/.bashrc ]; then
. ~/.bashrc
fi

# User specific environment and startup programs

PATH=$PATH:$HOME/bin:/usr/local/bin/blast-2.2.16/bin:/usr/local/staden-
linux-x86-1-7-0/linux-bin:/usr/local/staden-linux-x86-1-7-0/lib/linux-
binaries:/usr/local/bin/mira_2.9.8_dev_linux-gnu_x86_64/bin
export PATH

STADENROOT=/usr/local/staden-linux-x86-1-7-0
export STADENROOT
.$STADENROOT/staden.profile

TK_LIBRARY=$STADENROOT/lib/tk
export TK_LIBRARY

TCL_LIBRARY=$STADENROOT/lib/tcl
export TCL_LIBRARY

I persistently get the error
error while loading shared libraries: libtk_utils.so: cannot open
shared object file: No such file or directory

3. I have even tried placing the following in the path (see above)
/usr/local/staden-linux-x86-1-7-0/lib/linux-binaries

4. File permissions are not the problem

Is there a stupid mistake somewhere on my part? What am I missing?

DerekL

_______________________________________________
Staden mailing list
Staden@...
http://www.bio.net/biomail/listinfo/staden

Probs with pregap4

2007-05-06T11:54:53Z

Hi,
I'm having the same problem as a few others and I've yet to solve
it. Every time I try to enter sequences trace files or embl files
from pregap4 to gap4, I get the following error message
- Report from 'Enter assembly (into Gap4)' -
ERR: Failed to change directory to /Users/koquin/Desktop/SequenceTest/
SeqTest/7May/pregap.assembly.
ERR: "couldn't change working directory to "/Users/koquin/Desktop/
SequenceTest/SeqTest/7May/pregap.assembly": no such file or directory"
ERR: Aborting enter assembly.
Any help would be much appreciated.

University of Maryland
BEES Program, Department of Biology
1204K Biology/Psychology Building
College Park, MD 20742
USA
koquin@...

_______________________________________________
Staden mailing list
Staden@...
http://www.bio.net/biomail/listinfo/staden

Staden & ace / 454?

2007-03-28T00:33:11Z

Hi

Could anyone advise me about their experiences of getting 454 Newbler-
assembled data into Staden? As far as I can tell, the only format
available is .ace?

Also, I notice that trev can now display 454 flowgrams, but the sff
file we received contains all the fragments in a single file. Is there
a way to split this?

Advice would be appreciated!

Regards!

Fourie

_______________________________________________
Staden mailing list
Staden@...
http://www.bio.net/biomail/listinfo/staden

Fwd: Error during installing Staden-src-1-7-0 package

2007-02-06T12:43:46Z

Hi, I have problem compiling the package and here are what I have done. Any
help will be appreciated:

# first compile all the libraries
cd /usr/local/staden/staden-src-1-7-0
export STADENROOT=`pwd`
. staden.profile
cd src
make -f Makefile.thirdparty

# the program ran for a while then an error appear saying
/usr/local/staden/staden-src-1-7-0/lib/iwidgets can't be removed because
it's a directory. So I manually delete the directory and rerun make:

rm /usr/local/staden/staden-src-1-7-0/lib/iwidgets
make -f Makefile.rhirdparty

# at this point everything seems to be fine (but I was just guessing)
# Then I compile the staden package
cd /usr/local/staden/staden-src-1-7-0
make 2>&1 | tee make.out

# then the program ran for a while and show the errors below (far below):

In file included from include/Read.h:43,
from sff/linux-x86_64-binaries/../sff.c:26:
include/os.h:131:1: warning: "NEED_VA_COPY" redefined
<command line>:10:1: warning: this is the location of the previous
definition
sff/linux-x86_64-binaries/sff.o
cc -L../lib/linux-x86_64-binaries -shared -o
./lib/linux-x86_64-binaries/libread.so read/linux-x86_64-binarie
s/Read.o read/linux-x86_64-binaries/translate.o
read/linux-x86_64-binaries/scf_extras.o utils/linux-x86_64-binar
ies/find.o utils/linux-x86_64-binaries/mach-io.outils/linux-x86_64-binaries/traceType.o
utils/linux-x86_64-bina
ries/read_alloc.o utils/linux-x86_64-binaries/compress.o
utils/linux-x86_64-binaries/open_trace_file.o utils/lin
ux-x86_64-binaries/hash_table.o utils/linux-x86_64-binaries/mFILE.o
utils/linux-x86_64-binaries/vlen.o scf/linux
-x86_64-binaries/read_scf.o scf/linux-x86_64-binaries/write_scf.o
scf/linux-x86_64-binaries/misc_scf.o exp_file/
linux-x86_64-binaries/expFileIO.o plain/linux-x86_64-binaries/seqIOPlain.o
abi/linux-x86_64-binaries/fpoint.o ab
i/linux-x86_64-binaries/seqIOABI.o alf/linux-x86_64-binaries/seqIOALF.o
ctf/linux-x86_64-binaries/ctfCompress.o
ctf/linux-x86_64-binaries/seqIOCTF.o ztr/linux-x86_64-binaries/compression.o
ztr/linux-x86_64-binaries/ztr_trans
late.o ztr/linux-x86_64-binaries/ztr.o sff/linux-x86_64-binaries/sff.o
-lz -lmisc -L/usr/lib64 -lcurl -L/usr
/kerberos/lib -L/usr/kerberos/lib64 -lssl -lcrypto -lgssapi_krb5 -lkrb5
-lcom_err -lk5crypto -lresolv -ldl -lz -
lgssapi_krb5 -lkrb5 -lk5crypto -lcom_err -lresolv -L/usr/kerberos/lib
-L/usr/kerberos/lib64 -lidn -lssl -lcrypto
-lssl -lcrypto -lgssapi_krb5 -lkrb5 -lcom_err -lk5crypto -lresolv -ldl -lz
-lz
/usr/bin/ld: ../lib/linux-x86_64-binaries/libz.a(crc32.o): relocation
R_X86_64_32 against `a local symbol' can n
ot be used when making a shared object; recompile with -fPIC
./lib/linux-x86_64-binaries/libz.a: could not read symbols: Bad value
collect2: ld returned 1 exit status
make[2]: *** [../lib/linux-x86_64-binaries/libread.so] Error 1
make[2]: Leaving directory `/usr/local/staden/staden-src-1-7-0/src/io_lib'
make[1]: *** [io_lib] Error 2
make[1]: Leaving directory `/usr/local/staden/staden-src-1-7-0/src'
make: *** [all] Error 2

Thank you.

cd src; make all
make[1]: Entering directory `/usr/local/staden/staden-src-1-7-0/src'
Makefile:75: warning: overriding commands for target `clean'
mk/global.mk:256: warning: ignoring old commands for target `clean'
Makefile:90: warning: overriding commands for target `depend'
mk/global.mk:515: warning: ignoring old commands for target `depend'
Makefile:144: warning: overriding commands for target `distsrc'
mk/global.mk:494: warning: ignoring old commands for target `distsrc'
cd Misc && make -w all
make[2]: Entering directory `/usr/local/staden/staden-src-1-7-0/src/Misc'
touch linux-x86_64-binaries/.dir
gcc -g -DUSE_NON_CONST -I. -I../Misc -Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat -Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -o linux-x86_64-binaries/crash.o -c crash.c
In file included from misc.h:8,
from crash.c:1:
os.h:122:1: warning: "NEED_VA_COPY" redefined
<command line>:2:1: warning: this is the location of the previous definition
linux-x86_64-binaries/crash.o
gcc -g -DUSE_NON_CONST -I. -I../Misc -Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat -Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -o linux-x86_64-binaries/date.o -c date.c
In file included from misc.h:8,
from date.c:1:
os.h:122:1: warning: "NEED_VA_COPY" redefined
<command line>:2:1: warning: this is the location of the previous definition
linux-x86_64-binaries/date.o
gcc -g -DUSE_NON_CONST -I. -I../Misc -Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat -Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -o linux-x86_64-binaries/filenames.o -c filenames.c
In file included from misc.h:8,
from filenames.c:1:
os.h:122:1: warning: "NEED_VA_COPY" redefined
<command line>:2:1: warning: this is the location of the previous definition
linux-x86_64-binaries/filenames.o
gcc -g -DUSE_NON_CONST -I. -I../Misc -Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat -Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -o linux-x86_64-binaries/files.o -c files.c
In file included from misc.h:8,
from files.c:1:
os.h:122:1: warning: "NEED_VA_COPY" redefined
<command line>:2:1: warning: this is the location of the previous definition
linux-x86_64-binaries/files.o
gcc -g -DUSE_NON_CONST -I. -I../Misc -Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat -Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -o linux-x86_64-binaries/find.o -c find.c
In file included from misc.h:8,
from find.c:15:
os.h:122:1: warning: "NEED_VA_COPY" redefined
<command line>:2:1: warning: this is the location of the previous definition
linux-x86_64-binaries/find.o
gcc -g -DUSE_NON_CONST -I. -I../Misc -Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat -Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -o linux-x86_64-binaries/shell.o -c shell.c
In file included from misc.h:8,
from shell.c:1:
os.h:122:1: warning: "NEED_VA_COPY" redefined
<command line>:2:1: warning: this is the location of the previous definition
linux-x86_64-binaries/shell.o
gcc -g -DUSE_NON_CONST -I. -I../Misc -Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat -Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -o linux-x86_64-binaries/strings.o -c strings.c
In file included from misc.h:8,
from strings.c:1:
os.h:122:1: warning: "NEED_VA_COPY" redefined
<command line>:2:1: warning: this is the location of the previous definition
linux-x86_64-binaries/strings.o
gcc -g -DUSE_NON_CONST -I. -I../Misc -Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat -Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -o linux-x86_64-binaries/usleep.o -c usleep.c
linux-x86_64-binaries/usleep.o
gcc -g -DUSE_NON_CONST -I. -I../Misc -Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat -Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -o linux-x86_64-binaries/error.o -c error.c
linux-x86_64-binaries/error.o
gcc -g -DUSE_NON_CONST -I. -I../Misc -Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat -Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -o linux-x86_64-binaries/xerror.o -c xerror.c
In file included from misc.h:8,
from xerror.c:16:
os.h:122:1: warning: "NEED_VA_COPY" redefined
<command line>:2:1: warning: this is the location of the previous definition
linux-x86_64-binaries/xerror.o
gcc -g -DUSE_NON_CONST -I. -I../Misc -Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat -Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -o linux-x86_64-binaries/xalloc.o -c xalloc.c
linux-x86_64-binaries/xalloc.o
gcc -g -DUSE_NON_CONST -I. -I../Misc -Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat -Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -o linux-x86_64-binaries/vlen.o -c vlen.c
linux-x86_64-binaries/vlen.o
gcc -g -DUSE_NON_CONST -I. -I../Misc -Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat -Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -o linux-x86_64-binaries/FtoC.o -c FtoC.c
In file included from FtoC.c:1:
os.h:122:1: warning: "NEED_VA_COPY" redefined
<command line>:2:1: warning: this is the location of the previous definition
linux-x86_64-binaries/FtoC.o
gcc -g -DUSE_NON_CONST -I. -I../Misc -Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat -Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -o linux-x86_64-binaries/getfile.o -c getfile.c
In file included from misc.h:8,
from getfile.c:9:
os.h:122:1: warning: "NEED_VA_COPY" redefined
<command line>:2:1: warning: this is the location of the previous definition
linux-x86_64-binaries/getfile.o
gcc -g -DUSE_NON_CONST -I. -I../Misc -Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat -Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -o linux-x86_64-binaries/bitmap.o -c bitmap.c
In file included from bitmap.h:20,
from bitmap.c:19:
os.h:122:1: warning: "NEED_VA_COPY" redefined
<command line>:2:1: warning: this is the location of the previous definition
linux-x86_64-binaries/bitmap.o
gcc -g -DUSE_NON_CONST -I. -I../Misc -Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat -Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -o linux-x86_64-binaries/array.o -c array.c
linux-x86_64-binaries/array.o
gcc -g -DUSE_NON_CONST -I. -I../Misc -Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat -Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -o linux-x86_64-binaries/locks.o -c locks.c
linux-x86_64-binaries/locks.o
gcc -g -DUSE_NON_CONST -I. -I../Misc -Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat -Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -o linux-x86_64-binaries/array_arith.o -c array_arith.c
In file included from misc.h:8,
from array_arith.c:5:
os.h:122:1: warning: "NEED_VA_COPY" redefined
<command line>:2:1: warning: this is the location of the previous definition
linux-x86_64-binaries/array_arith.o
gcc -g -DUSE_NON_CONST -I. -I../Misc -Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat -Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -o linux-x86_64-binaries/parse_db.o -c parse_db.c
In file included from misc.h:8,
from parse_db.c:25:
os.h:122:1: warning: "NEED_VA_COPY" redefined
<command line>:2:1: warning: this is the location of the previous definition
linux-x86_64-binaries/parse_db.o
gcc -g -DUSE_NON_CONST -I. -I../Misc -Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat -Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -o linux-x86_64-binaries/dstring.o -c dstring.c
linux-x86_64-binaries/dstring.o
cc -L../lib/linux-x86_64-binaries -shared -o ../lib/linux-x86_64-binaries/libmisc.so linux-x86_64-binaries/crash.o linux-x86_64-binaries/date.o linux-x86_64-binaries/filenames.o linux-x86_64-binaries/files.o linux-x86_64-binaries/find.o linux-x86_64-binaries/shell.o linux-x86_64-binaries/strings.o linux-x86_64-binaries/usleep.o linux-x86_64-binaries/error.o linux-x86_64-binaries/xerror.o linux-x86_64-binaries/xalloc.o linux-x86_64-binaries/vlen.o linux-x86_64-binaries/FtoC.o linux-x86_64-binaries/getfile.o linux-x86_64-binaries/bitmap.o linux-x86_64-binaries/array.o linux-x86_64-binaries/locks.o linux-x86_64-binaries/array_arith.o linux-x86_64-binaries/parse_db.o linux-x86_64-binaries/dstring.o -lm
make[2]: Leaving directory `/usr/local/staden/staden-src-1-7-0/src/Misc'
cd io_lib && make -w all
make[2]: Entering directory `/usr/local/staden/staden-src-1-7-0/src/io_lib'
Makefile:172: warning: overriding commands for target `distsrc'
../mk/global.mk:494: warning: ignoring old commands for target `distsrc'
Makefile:202: warning: overriding commands for target `depend'
../mk/global.mk:515: warning: ignoring old commands for target `depend'
cd include; \
for i in abi alf ctf exp_file plain read scf sff utils ztr; \
do \
ln -s ../$i/*.h .;\
done
touch include/.links
touch read/linux-x86_64-binaries/.dir
touch utils/linux-x86_64-binaries/.dir
touch abi/linux-x86_64-binaries/.dir
touch alf/linux-x86_64-binaries/.dir
touch ctf/linux-x86_64-binaries/.dir
touch exp_file/linux-x86_64-binaries/.dir
touch plain/linux-x86_64-binaries/.dir
touch progs/linux-x86_64-binaries/.dir
touch scf/linux-x86_64-binaries/.dir
touch ztr/linux-x86_64-binaries/.dir
touch sff/linux-x86_64-binaries/.dir
make[2]: [read/linux-x86_64-binaries/Read.o] Error 1 (ignored)
gcc -g -DUSE_NON_CONST -DIOLIB_SCF -DIOLIB_EXP -DIOLIB_PLN -DIOLIB_ABI -DIOLIB_ALF -DIOLIB_CTF -DIOLIB_ZTR -DIOLIB_SFF -Iinclude -I. -I../Misc -Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat -Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -I../zlib -DHAVE_LIBCURL -o read/linux-x86_64-binaries/Read.o -c read/linux-x86_64-binaries/../Read.c
In file included from read/linux-x86_64-binaries/../Read.h:43,
from read/linux-x86_64-binaries/../Read.c:40:
include/os.h:131:1: warning: "NEED_VA_COPY" redefined
<command line>:10:1: warning: this is the location of the previous definition
read/linux-x86_64-binaries/Read.o
make[2]: [read/linux-x86_64-binaries/translate.o] Error 1 (ignored)
gcc -g -DUSE_NON_CONST -DIOLIB_SCF -DIOLIB_EXP -DIOLIB_PLN -DIOLIB_ABI -DIOLIB_ALF -DIOLIB_CTF -DIOLIB_ZTR -DIOLIB_SFF -Iinclude -I. -I../Misc -Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat -Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -I../zlib -DHAVE_LIBCURL -o read/linux-x86_64-binaries/translate.o -c read/linux-x86_64-binaries/../translate.c
In file included from include/misc.h:8,
from read/linux-x86_64-binaries/../translate.c:28:
include/os.h:131:1: warning: "NEED_VA_COPY" redefined
<command line>:10:1: warning: this is the location of the previous definition
read/linux-x86_64-binaries/translate.o
make[2]: [read/linux-x86_64-binaries/scf_extras.o] Error 1 (ignored)
gcc -g -DUSE_NON_CONST -DIOLIB_SCF -DIOLIB_EXP -DIOLIB_PLN -DIOLIB_ABI -DIOLIB_ALF -DIOLIB_CTF -DIOLIB_ZTR -DIOLIB_SFF -Iinclude -I. -I../Misc -Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat -Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -I../zlib -DHAVE_LIBCURL -o read/linux-x86_64-binaries/scf_extras.o -c read/linux-x86_64-binaries/../scf_extras.c
In file included from include/misc.h:8,
from read/linux-x86_64-binaries/../scf_extras.c:28:
include/os.h:131:1: warning: "NEED_VA_COPY" redefined
<command line>:10:1: warning: this is the location of the previous definition
read/linux-x86_64-binaries/scf_extras.o
make[2]: [utils/linux-x86_64-binaries/find.o] Error 1 (ignored)
gcc -g -DUSE_NON_CONST -DIOLIB_SCF -DIOLIB_EXP -DIOLIB_PLN -DIOLIB_ABI -DIOLIB_ALF -DIOLIB_CTF -DIOLIB_ZTR -DIOLIB_SFF -Iinclude -I. -I../Misc -Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat -Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -I../zlib -DHAVE_LIBCURL -o utils/linux-x86_64-binaries/find.o -c utils/linux-x86_64-binaries/../find.c
In file included from utils/linux-x86_64-binaries/../misc.h:8,
from utils/linux-x86_64-binaries/../find.c:15:
utils/linux-x86_64-binaries/../os.h:131:1: warning: "NEED_VA_COPY" redefined
<command line>:10:1: warning: this is the location of the previous definition
utils/linux-x86_64-binaries/find.o
make[2]: [utils/linux-x86_64-binaries/mach-io.o] Error 1 (ignored)
gcc -g -DUSE_NON_CONST -DIOLIB_SCF -DIOLIB_EXP -DIOLIB_PLN -DIOLIB_ABI -DIOLIB_ALF -DIOLIB_CTF -DIOLIB_ZTR -DIOLIB_SFF -Iinclude -I. -I../Misc -Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat -Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -I../zlib -DHAVE_LIBCURL -o utils/linux-x86_64-binaries/mach-io.o -c utils/linux-x86_64-binaries/../mach-io.c
In file included from utils/linux-x86_64-binaries/../mach-io.h:41,
from utils/linux-x86_64-binaries/../mach-io.c:44:
utils/linux-x86_64-binaries/../os.h:131:1: warning: "NEED_VA_COPY" redefined
<command line>:10:1: warning: this is the location of the previous definition
utils/linux-x86_64-binaries/mach-io.o
make[2]: [utils/linux-x86_64-binaries/traceType.o] Error 1 (ignored)
gcc -g -DUSE_NON_CONST -DIOLIB_SCF -DIOLIB_EXP -DIOLIB_PLN -DIOLIB_ABI -DIOLIB_ALF -DIOLIB_CTF -DIOLIB_ZTR -DIOLIB_SFF -Iinclude -I. -I../Misc -Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat -Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -I../zlib -DHAVE_LIBCURL -o utils/linux-x86_64-binaries/traceType.o -c utils/linux-x86_64-binaries/../traceType.c
In file included from include/Read.h:43,
from utils/linux-x86_64-binaries/../traceType.h:34,
from utils/linux-x86_64-binaries/../traceType.c:34:
include/os.h:131:1: warning: "NEED_VA_COPY" redefined
<command line>:10:1: warning: this is the location of the previous definition
utils/linux-x86_64-binaries/traceType.o
make[2]: [utils/linux-x86_64-binaries/read_alloc.o] Error 1 (ignored)
gcc -g -DUSE_NON_CONST -DIOLIB_SCF -DIOLIB_EXP -DIOLIB_PLN -DIOLIB_ABI -DIOLIB_ALF -DIOLIB_CTF -DIOLIB_ZTR -DIOLIB_SFF -Iinclude -I. -I../Misc -Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat -Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -I../zlib -DHAVE_LIBCURL -o utils/linux-x86_64-binaries/read_alloc.o -c utils/linux-x86_64-binaries/../read_alloc.c
In file included from utils/linux-x86_64-binaries/../misc.h:8,
from utils/linux-x86_64-binaries/../read_alloc.c:39:
utils/linux-x86_64-binaries/../os.h:131:1: warning: "NEED_VA_COPY" redefined
<command line>:10:1: warning: this is the location of the previous definition
utils/linux-x86_64-binaries/read_alloc.o
make[2]: [utils/linux-x86_64-binaries/compress.o] Error 1 (ignored)
gcc -g -DUSE_NON_CONST -DIOLIB_SCF -DIOLIB_EXP -DIOLIB_PLN -DIOLIB_ABI -DIOLIB_ALF -DIOLIB_CTF -DIOLIB_ZTR -DIOLIB_SFF -Iinclude -I. -I../Misc -Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat -Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -I../zlib -DHAVE_LIBCURL -o utils/linux-x86_64-binaries/compress.o -c utils/linux-x86_64-binaries/../compress.c
In file included from utils/linux-x86_64-binaries/../compress.c:36:
utils/linux-x86_64-binaries/../os.h:131:1: warning: "NEED_VA_COPY" redefined
<command line>:10:1: warning: this is the location of the previous definition
utils/linux-x86_64-binaries/compress.o
make[2]: [utils/linux-x86_64-binaries/open_trace_file.o] Error 1 (ignored)
gcc -g -DUSE_NON_CONST -DIOLIB_SCF -DIOLIB_EXP -DIOLIB_PLN -DIOLIB_ABI -DIOLIB_ALF -DIOLIB_CTF -DIOLIB_ZTR -DIOLIB_SFF -Iinclude -I. -I../Misc -Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat -Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -I../zlib -DHAVE_LIBCURL -o utils/linux-x86_64-binaries/open_trace_file.o -c utils/linux-x86_64-binaries/../open_trace_file.c
In file included from utils/linux-x86_64-binaries/../open_trace_file.c:18:
utils/linux-x86_64-binaries/../os.h:131:1: warning: "NEED_VA_COPY" redefined
<command line>:10:1: warning: this is the location of the previous definition
utils/linux-x86_64-binaries/open_trace_file.o
make[2]: [utils/linux-x86_64-binaries/hash_table.o] Error 1 (ignored)
gcc -g -DUSE_NON_CONST -DIOLIB_SCF -DIOLIB_EXP -DIOLIB_PLN -DIOLIB_ABI -DIOLIB_ALF -DIOLIB_CTF -DIOLIB_ZTR -DIOLIB_SFF -Iinclude -I. -I../Misc -Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat -Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -I../zlib -DHAVE_LIBCURL -o utils/linux-x86_64-binaries/hash_table.o -c utils/linux-x86_64-binaries/../hash_table.c
In file included from utils/linux-x86_64-binaries/../hash_table.c:4:
utils/linux-x86_64-binaries/../os.h:131:1: warning: "NEED_VA_COPY" redefined
<command line>:10:1: warning: this is the location of the previous definition
utils/linux-x86_64-binaries/hash_table.o
make[2]: [utils/linux-x86_64-binaries/mFILE.o] Error 1 (ignored)
gcc -g -DUSE_NON_CONST -DIOLIB_SCF -DIOLIB_EXP -DIOLIB_PLN -DIOLIB_ABI -DIOLIB_ALF -DIOLIB_CTF -DIOLIB_ZTR -DIOLIB_SFF -Iinclude -I. -I../Misc -Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat -Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -I../zlib -DHAVE_LIBCURL -o utils/linux-x86_64-binaries/mFILE.o -c utils/linux-x86_64-binaries/../mFILE.c
In file included from utils/linux-x86_64-binaries/../mFILE.c:11:
utils/linux-x86_64-binaries/../os.h:131:1: warning: "NEED_VA_COPY" redefined
<command line>:10:1: warning: this is the location of the previous definition
utils/linux-x86_64-binaries/mFILE.o
make[2]: [utils/linux-x86_64-binaries/vlen.o] Error 1 (ignored)
gcc -g -DUSE_NON_CONST -DIOLIB_SCF -DIOLIB_EXP -DIOLIB_PLN -DIOLIB_ABI -DIOLIB_ALF -DIOLIB_CTF -DIOLIB_ZTR -DIOLIB_SFF -Iinclude -I. -I../Misc -Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat -Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -I../zlib -DHAVE_LIBCURL -o utils/linux-x86_64-binaries/vlen.o -c utils/linux-x86_64-binaries/../vlen.c
utils/linux-x86_64-binaries/vlen.o
make[2]: [scf/linux-x86_64-binaries/read_scf.o] Error 1 (ignored)
gcc -g -DUSE_NON_CONST -DIOLIB_SCF -DIOLIB_EXP -DIOLIB_PLN -DIOLIB_ABI -DIOLIB_ALF -DIOLIB_CTF -DIOLIB_ZTR -DIOLIB_SFF -Iinclude -I. -I../Misc -Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat -Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -I../zlib -DHAVE_LIBCURL -o scf/linux-x86_64-binaries/read_scf.o -c scf/linux-x86_64-binaries/../read_scf.c
In file included from scf/linux-x86_64-binaries/../scf.h:32,
from scf/linux-x86_64-binaries/../read_scf.c:39:
include/os.h:131:1: warning: "NEED_VA_COPY" redefined
<command line>:10:1: warning: this is the location of the previous definition
scf/linux-x86_64-binaries/read_scf.o
make[2]: [scf/linux-x86_64-binaries/write_scf.o] Error 1 (ignored)
gcc -g -DUSE_NON_CONST -DIOLIB_SCF -DIOLIB_EXP -DIOLIB_PLN -DIOLIB_ABI -DIOLIB_ALF -DIOLIB_CTF -DIOLIB_ZTR -DIOLIB_SFF -Iinclude -I. -I../Misc -Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat -Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -I../zlib -DHAVE_LIBCURL -o scf/linux-x86_64-binaries/write_scf.o -c scf/linux-x86_64-binaries/../write_scf.c
In file included from scf/linux-x86_64-binaries/../scf.h:32,
from scf/linux-x86_64-binaries/../write_scf.c:56:
include/os.h:131:1: warning: "NEED_VA_COPY" redefined
<command line>:10:1: warning: this is the location of the previous definition
scf/linux-x86_64-binaries/write_scf.o
make[2]: [scf/linux-x86_64-binaries/misc_scf.o] Error 1 (ignored)
gcc -g -DUSE_NON_CONST -DIOLIB_SCF -DIOLIB_EXP -DIOLIB_PLN -DIOLIB_ABI -DIOLIB_ALF -DIOLIB_CTF -DIOLIB_ZTR -DIOLIB_SFF -Iinclude -I. -I../Misc -Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat -Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -I../zlib -DHAVE_LIBCURL -o scf/linux-x86_64-binaries/misc_scf.o -c scf/linux-x86_64-binaries/../misc_scf.c
In file included from scf/linux-x86_64-binaries/../scf.h:32,
from scf/linux-x86_64-binaries/../misc_scf.c:29:
include/os.h:131:1: warning: "NEED_VA_COPY" redefined
<command line>:10:1: warning: this is the location of the previous definition
scf/linux-x86_64-binaries/misc_scf.o
make[2]: [exp_file/linux-x86_64-binaries/expFileIO.o] Error 1 (ignored)
gcc -g -DUSE_NON_CONST -DIOLIB_SCF -DIOLIB_EXP -DIOLIB_PLN -DIOLIB_ABI -DIOLIB_ALF -DIOLIB_CTF -DIOLIB_ZTR -DIOLIB_SFF -Iinclude -I. -I../Misc -Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat -Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -I../zlib -DHAVE_LIBCURL -o exp_file/linux-x86_64-binaries/expFileIO.o -c exp_file/linux-x86_64-binaries/../expFileIO.c
In file included from exp_file/linux-x86_64-binaries/../expFileIO.h:33,
from exp_file/linux-x86_64-binaries/../expFileIO.c:71:
include/os.h:131:1: warning: "NEED_VA_COPY" redefined
<command line>:10:1: warning: this is the location of the previous definition
exp_file/linux-x86_64-binaries/expFileIO.o
make[2]: [plain/linux-x86_64-binaries/seqIOPlain.o] Error 1 (ignored)
gcc -g -DUSE_NON_CONST -DIOLIB_SCF -DIOLIB_EXP -DIOLIB_PLN -DIOLIB_ABI -DIOLIB_ALF -DIOLIB_CTF -DIOLIB_ZTR -DIOLIB_SFF -Iinclude -I. -I../Misc -Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat -Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -I../zlib -DHAVE_LIBCURL -o plain/linux-x86_64-binaries/seqIOPlain.o -c plain/linux-x86_64-binaries/../seqIOPlain.c
In file included from include/misc.h:8,
from plain/linux-x86_64-binaries/../seqIOPlain.c:55:
include/os.h:131:1: warning: "NEED_VA_COPY" redefined
<command line>:10:1: warning: this is the location of the previous definition
plain/linux-x86_64-binaries/seqIOPlain.o
make[2]: [abi/linux-x86_64-binaries/fpoint.o] Error 1 (ignored)
gcc -g -DUSE_NON_CONST -DIOLIB_SCF -DIOLIB_EXP -DIOLIB_PLN -DIOLIB_ABI -DIOLIB_ALF -DIOLIB_CTF -DIOLIB_ZTR -DIOLIB_SFF -Iinclude -I. -I../Misc -Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat -Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -I../zlib -DHAVE_LIBCURL -o abi/linux-x86_64-binaries/fpoint.o -c abi/linux-x86_64-binaries/../fpoint.c
abi/linux-x86_64-binaries/fpoint.o
make[2]: [abi/linux-x86_64-binaries/seqIOABI.o] Error 1 (ignored)
gcc -g -DUSE_NON_CONST -DIOLIB_SCF -DIOLIB_EXP -DIOLIB_PLN -DIOLIB_ABI -DIOLIB_ALF -DIOLIB_CTF -DIOLIB_ZTR -DIOLIB_SFF -Iinclude -I. -I../Misc -Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat -Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -I../zlib -DHAVE_LIBCURL -o abi/linux-x86_64-binaries/seqIOABI.o -c abi/linux-x86_64-binaries/../seqIOABI.c
In file included from abi/linux-x86_64-binaries/../seqIOABI.h:19,
from abi/linux-x86_64-binaries/../seqIOABI.c:87:
include/os.h:131:1: warning: "NEED_VA_COPY" redefined
<command line>:10:1: warning: this is the location of the previous definition
abi/linux-x86_64-binaries/seqIOABI.o
make[2]: [alf/linux-x86_64-binaries/seqIOALF.o] Error 1 (ignored)
gcc -g -DUSE_NON_CONST -DIOLIB_SCF -DIOLIB_EXP -DIOLIB_PLN -DIOLIB_ABI -DIOLIB_ALF -DIOLIB_CTF -DIOLIB_ZTR -DIOLIB_SFF -Iinclude -I. -I../Misc -Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat -Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -I../zlib -DHAVE_LIBCURL -o alf/linux-x86_64-binaries/seqIOALF.o -c alf/linux-x86_64-binaries/../seqIOALF.c
In file included from include/Read.h:43,
from alf/linux-x86_64-binaries/../seqIOALF.c:82:
include/os.h:131:1: warning: "NEED_VA_COPY" redefined
<command line>:10:1: warning: this is the location of the previous definition
alf/linux-x86_64-binaries/seqIOALF.o
make[2]: [ctf/linux-x86_64-binaries/ctfCompress.o] Error 1 (ignored)
gcc -g -DUSE_NON_CONST -DIOLIB_SCF -DIOLIB_EXP -DIOLIB_PLN -DIOLIB_ABI -DIOLIB_ALF -DIOLIB_CTF -DIOLIB_ZTR -DIOLIB_SFF -Iinclude -I. -I../Misc -Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat -Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -I../zlib -DHAVE_LIBCURL -o ctf/linux-x86_64-binaries/ctfCompress.o -c ctf/linux-x86_64-binaries/../ctfCompress.c
In file included from include/Read.h:43,
from ctf/linux-x86_64-binaries/../seqIOCTF.h:4,
from ctf/linux-x86_64-binaries/../ctfCompress.c:8:
include/os.h:131:1: warning: "NEED_VA_COPY" redefined
<command line>:10:1: warning: this is the location of the previous definition
ctf/linux-x86_64-binaries/ctfCompress.o
make[2]: [ctf/linux-x86_64-binaries/seqIOCTF.o] Error 1 (ignored)
gcc -g -DUSE_NON_CONST -DIOLIB_SCF -DIOLIB_EXP -DIOLIB_PLN -DIOLIB_ABI -DIOLIB_ALF -DIOLIB_CTF -DIOLIB_ZTR -DIOLIB_SFF -Iinclude -I. -I../Misc -Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat -Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -I../zlib -DHAVE_LIBCURL -o ctf/linux-x86_64-binaries/seqIOCTF.o -c ctf/linux-x86_64-binaries/../seqIOCTF.c
In file included from include/Read.h:43,
from ctf/linux-x86_64-binaries/../seqIOCTF.c:20:
include/os.h:131:1: warning: "NEED_VA_COPY" redefined
<command line>:10:1: warning: this is the location of the previous definition
ctf/linux-x86_64-binaries/seqIOCTF.o
make[2]: [ztr/linux-x86_64-binaries/compression.o] Error 1 (ignored)
gcc -g -DUSE_NON_CONST -DIOLIB_SCF -DIOLIB_EXP -DIOLIB_PLN -DIOLIB_ABI -DIOLIB_ALF -DIOLIB_CTF -DIOLIB_ZTR -DIOLIB_SFF -Iinclude -I. -I../Misc -Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat -Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -I../zlib -DHAVE_LIBCURL -o ztr/linux-x86_64-binaries/compression.o -c ztr/linux-x86_64-binaries/../compression.c
In file included from include/Read.h:43,
from ztr/linux-x86_64-binaries/../ztr.h:4,
from ztr/linux-x86_64-binaries/../compression.c:13:
include/os.h:131:1: warning: "NEED_VA_COPY" redefined
<command line>:10:1: warning: this is the location of the previous definition
ztr/linux-x86_64-binaries/compression.o
make[2]: [ztr/linux-x86_64-binaries/ztr_translate.o] Error 1 (ignored)
gcc -g -DUSE_NON_CONST -DIOLIB_SCF -DIOLIB_EXP -DIOLIB_PLN -DIOLIB_ABI -DIOLIB_ALF -DIOLIB_CTF -DIOLIB_ZTR -DIOLIB_SFF -Iinclude -I. -I../Misc -Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat -Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -I../zlib -DHAVE_LIBCURL -o ztr/linux-x86_64-binaries/ztr_translate.o -c ztr/linux-x86_64-binaries/../ztr_translate.c
In file included from include/Read.h:43,
from ztr/linux-x86_64-binaries/../ztr.h:4,
from ztr/linux-x86_64-binaries/../ztr_translate.c:4:
include/os.h:131:1: warning: "NEED_VA_COPY" redefined
<command line>:10:1: warning: this is the location of the previous definition
ztr/linux-x86_64-binaries/../ztr_translate.c:128: warning: 'ztr_encode_samples_A' defined but not used
ztr/linux-x86_64-binaries/../ztr_translate.c:134: warning: 'ztr_encode_samples_C' defined but not used
ztr/linux-x86_64-binaries/../ztr_translate.c:140: warning: 'ztr_encode_samples_G' defined but not used
ztr/linux-x86_64-binaries/../ztr_translate.c:146: warning: 'ztr_encode_samples_T' defined but not used
ztr/linux-x86_64-binaries/../ztr_translate.c:293: warning: 'ztr_encode_confidence_1' defined but not used
ztr/linux-x86_64-binaries/ztr_translate.o
make[2]: [ztr/linux-x86_64-binaries/ztr.o] Error 1 (ignored)
gcc -g -DUSE_NON_CONST -DIOLIB_SCF -DIOLIB_EXP -DIOLIB_PLN -DIOLIB_ABI -DIOLIB_ALF -DIOLIB_CTF -DIOLIB_ZTR -DIOLIB_SFF -Iinclude -I. -I../Misc -Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat -Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -I../zlib -DHAVE_LIBCURL -o ztr/linux-x86_64-binaries/ztr.o -c ztr/linux-x86_64-binaries/../ztr.c
In file included from include/Read.h:43,
from ztr/linux-x86_64-binaries/../ztr.h:4,
from ztr/linux-x86_64-binaries/../ztr.c:7:
include/os.h:131:1: warning: "NEED_VA_COPY" redefined
<command line>:10:1: warning: this is the location of the previous definition
ztr/linux-x86_64-binaries/ztr.o
make[2]: [sff/linux-x86_64-binaries/sff.o] Error 1 (ignored)
gcc -g -DUSE_NON_CONST -DIOLIB_SCF -DIOLIB_EXP -DIOLIB_PLN -DIOLIB_ABI -DIOLIB_ALF -DIOLIB_CTF -DIOLIB_ZTR -DIOLIB_SFF -Iinclude -I. -I../Misc -Wimplicit -Wreturn-type -Wunused -Wswitch -Wcomment -Wformat -Wstrict-prototypes -DNEED_VA_COPY=1 -D_FILE_OFFSET_BITS=64 -fPIC -I../zlib -DHAVE_LIBCURL -o sff/linux-x86_64-binaries/sff.o -c sff/linux-x86_64-binaries/../sff.c
In file included from include/Read.h:43,
from sff/linux-x86_64-binaries/../sff.c:26:
include/os.h:131:1: warning: "NEED_VA_COPY" redefined
<command line>:10:1: warning: this is the location of the previous definition
sff/linux-x86_64-binaries/sff.o
cc -L../lib/linux-x86_64-binaries -shared -o ../lib/linux-x86_64-binaries/libread.so read/linux-x86_64-binaries/Read.o read/linux-x86_64-binaries/translate.o read/linux-x86_64-binaries/scf_extras.o utils/linux-x86_64-binaries/find.o utils/linux-x86_64-binaries/mach-io.o utils/linux-x86_64-binaries/traceType.o utils/linux-x86_64-binaries/read_alloc.o utils/linux-x86_64-binaries/compress.o utils/linux-x86_64-binaries/open_trace_file.o utils/linux-x86_64-binaries/hash_table.o utils/linux-x86_64-binaries/mFILE.o utils/linux-x86_64-binaries/vlen.o scf/linux-x86_64-binaries/read_scf.o scf/linux-x86_64-binaries/write_scf.o scf/linux-x86_64-binaries/misc_scf.o exp_file/linux-x86_64-binaries/expFileIO.o plain/linux-x86_64-binaries/seqIOPlain.o abi/linux-x86_64-binaries/fpoint.o abi/linux-x86_64-binaries/seqIOABI.o alf/linux-x86_64-binaries/seqIOALF.o ctf/linux-x86_64-binaries/ctfCompress.o ctf/linux-x86_64-binaries/seqIOCTF.o ztr/linux-x86_64-binaries/compression.o ztr/linux-x86_64-binaries/ztr_translate.o ztr/linux-x86_64-binaries/ztr.o sff/linux-x86_64-binaries/sff.o -lz -lmisc -L/usr/lib64 -lcurl -L/usr/kerberos/lib -L/usr/kerberos/lib64 -lssl -lcrypto -lgssapi_krb5 -lkrb5 -lcom_err -lk5crypto -lresolv -ldl -lz -lgssapi_krb5 -lkrb5 -lk5crypto -lcom_err -lresolv -L/usr/kerberos/lib -L/usr/kerberos/lib64 -lidn -lssl -lcrypto -lssl -lcrypto -lgssapi_krb5 -lkrb5 -lcom_err -lk5crypto -lresolv -ldl -lz -lz
/usr/bin/ld: ../lib/linux-x86_64-binaries/libz.a(crc32.o): relocation R_X86_64_32 against `a local symbol' can not be used when making a shared object; recompile with -fPIC
../lib/linux-x86_64-binaries/libz.a: could not read symbols: Bad value
collect2: ld returned 1 exit status
make[2]: *** [../lib/linux-x86_64-binaries/libread.so] Error 1
make[2]: Leaving directory `/usr/local/staden/staden-src-1-7-0/src/io_lib'
make[1]: *** [io_lib] Error 2
make[1]: Leaving directory `/usr/local/staden/staden-src-1-7-0/src'
make: *** [all] Error 2

_______________________________________________
Staden mailing list
Staden@...
http://www.bio.net/biomail/listinfo/staden

assembly problem with 6700 seq

2007-01-15T07:44:03Z

Hi all.
I'm not so new with Staden Package (integrated with
phred/phrap/repeatmasker), but recently I'm facing assembly problems
never found before. At the moment, I'm using Staden v.1.
7 on a FedoraCore3 machine. When trying to assemble about 6700 seqs
(.ab1 and .SCF), stored on a new 80GB HD (97% free space), I'm getting
the following error message (sorry for the length!!):

Mon 15 Jan 16:15:44 2007 sequence_vector_clip::run: couldn't open
"/mnt/data2/assembly/pregap.tmp": no space left on device
Mon 15 Jan 16:15:44 2007 cross_match_svec::run: couldn't open
"/mnt/data2/assembly/pregap.fasta": no space left on device
Mon 15 Jan 16:15:44 2007 cloning_vector_clip::run: couldn't open
"/mnt/data2/assembly/pregap.tmp": no space left on device
Mon 15 Jan 16:15:44 2007 repeat_masker::run: couldn't open
"/mnt/data2/assembly/pregap.fasta": no space left on device
Mon 15 Jan 16:15:44 2007 phrap_assemble::run: couldn't open
"/mnt/data2/assembly/pregap.tmp": no space left on device
Mon 15 Jan 16:15:46 2007 Error creating busy file

Mon 15 Jan 16:15:46 2007 No space left on device [28]
Mon 15 Jan 16:15:46 2007 cannot create file [5]
Mon 15 Jan 16:15:46 2007 cannot create database
Mon 15 Jan 16:15:46 2007 gap-create.c:112
Mon 15 Jan 16:15:46 2007 Success [0]
Mon 15 Jan 16:15:46 2007 no error [1000]
Mon 15 Jan 16:15:46 2007 cannot create database
Mon 15 Jan 16:15:46 2007 IO.c:1348
Mon 15 Jan 16:15:46 2007 Continue at own risk!
Mon 15 Jan 16:15:46 2007 open_db:
Mon 15 Jan 16:15:46 2007 shutdown::shutdown: couldn't open
"/mnt/data2/assembly/pregap.log": no space left on device

..and it's not all.
With Staden 1.7 loaded on a 16 CPU cluster' frontend PC (OS Rocks), with
the same phred/phrap configuration, I get this error message (sorry for
the length, again):

[...]

- Report from 'Phrap assembly' -
ERR: Failed to execute phrap.
ERR: "
gcphrap -minmatch 12 -minscore 30 -exp
/home/users/sghignon/candidatus/p2f10/pregap.assembly
/home/users/sghignon/candidatus/p2f10/pregap.tmp
gcphrap version 0.990329
Reading parameters ... 1.008 Mbytes allocated -- total 1.008 Mbytes
Run date:time 070115:121704
Done
Total space allocated: 1.008 Mbytes; currently free: 1.003 Mbytes in 2
blocks
Reading query file into memory .................... Done
Total space allocated: 1.008 Mbytes; currently free: 0.374 Mbytes in 6
blocks
Complementing ...1.008 Mbytes allocated -- total 2.016 Mbytes
Done
Total space allocated: 2.016 Mbytes; currently free: 1.266 Mbytes in 6
blocks
Allocating align_entries ... Done
Total space allocated: 2.016 Mbytes; currently free: 1.053 Mbytes in 6
blocks
Reading quality files ...

NO QUALITY FILE /home/users/sghignon/candidatus/p2f10/pregap.tmp.qual
WAS FOUND. REMAINING INPUT QUALITIES SET TO 15. Done
Total space allocated: 2.016 Mbytes; currently free: 1.053 Mbytes in 6
blocks
5.040 Mbytes allocated -- total 7.056 Mbytes
Finding words ...
0 961779
10 86573
20 170
30 35
40 12
50 3
60 1
110 1
160 1
170 1
min no. words: 0 at 24
max no. words: 161 at 0
avg no. words: 0.0 Done
Total space allocated: 7.056 Mbytes; currently free: 1.070 Mbytes in 7
blocks
186214 words; after pruning: 165396
Sorting words ... Done

12 101555
13 11
14 11
15 7
16 3
17 1
18 1
19 2
Finding complement word matches ... Done
Total space allocated: 7.056 Mbytes; currently free: 0.943 Mbytes in 8
blocks
n_cross_matches: 1706
# pass words: 3482, #fail words: 12406
num_cand_pairs: 1145, num_dups: 561
Finding internal word matches ... n_same_matches: 2010
, #pass words: 2010, #fail words: 7179 num_cand_pairs: 2351, num_dups: 1365
Done
Total space allocated: 7.056 Mbytes; currently free: 0.919 Mbytes in 8
blocks
Finding duplicates ... Done
Total space allocated: 7.056 Mbytes; currently free: 5.941 Mbytes in 7
blocks
SWATTING ...... Done
Total space allocated: 7.056 Mbytes; currently free: 5.756 Mbytes in 8
blocks
Quickalign: 466 successes, 104 failures
3564 SWAT alignments performed. 562 pairs have score >= 30
Making reversed pairs ... Done
Total space allocated: 7.056 Mbytes; currently free: 5.824 Mbytes in 8
blocks
Finding starts/ends ... Done
Total space allocated: 7.056 Mbytes; currently free: 5.824 Mbytes in 8
blocks
Total # pairs: 2000, size: 0.112 Mbytes
Finding segments ... Done
Total space allocated: 7.056 Mbytes; currently free: 5.744 Mbytes in 8
blocks
Finding more vector ... Done
Total space allocated: 7.056 Mbytes; currently free: 5.744 Mbytes in 8
blocks
Finding mean offsets ... Done
Total space allocated: 7.056 Mbytes; currently free: 5.744 Mbytes in 8
blocks
Finding near duplicates ... Done
Total space allocated: 7.056 Mbytes; currently free: 5.744 Mbytes in 8
blocks
Finding self matches ... Done
Total space allocated: 7.056 Mbytes; currently free: 5.744 Mbytes in 8
blocks
Finding node rejects ... Done
Total space allocated: 7.056 Mbytes; currently free: 5.744 Mbytes in 8
blocks
Finding truncated pairs ... Done
Total space allocated: 7.056 Mbytes; currently free: 5.744 Mbytes in 8
blocks
Finding multi-segment reads ... Done
Total space allocated: 7.056 Mbytes; currently free: 5.744 Mbytes in 8
blocks
Finding starts/ends ... Done
Total space allocated: 7.056 Mbytes; currently free: 5.744 Mbytes in 8
blocks
Finding deletions ... Done
Total space allocated: 7.056 Mbytes; currently free: 5.744 Mbytes in 8
blocks
Finding extents ... Done
Total space allocated: 7.056 Mbytes; currently free: 4.886 Mbytes in 8
blocks
Printing qualities ... Done
Total space allocated: 7.056 Mbytes; currently free: 4.886 Mbytes in 8
blocks
Computing LLR scores ... Done
Total space allocated: 7.056 Mbytes; currently free: 4.886 Mbytes in 8
blocks
Finding extents ... Done
Total space allocated: 7.056 Mbytes; currently free: 4.886 Mbytes in 8
blocks
Computing LLR scores ... Done
Total space allocated: 7.056 Mbytes; currently free: 4.886 Mbytes in 8
blocks
Printing qualities ... Done
Total space allocated: 7.056 Mbytes; currently free: 4.886 Mbytes in 8
blocks
Printing coverage ... Done
Total space allocated: 7.056 Mbytes; currently free: 4.886 Mbytes in 8
blocks
Finding blocked reads ... Done
Total space allocated: 7.056 Mbytes; currently free: 4.886 Mbytes in 8
blocks
Merging ...

Pass: 1
#reads #contigs (not counting singlets)
1 34
7 1
9 1
10 1
13 1
16 1
23 1
38 1

Pass: 3
#reads #contigs (not counting singlets)
1 9
2 6
9 1
10 1
11 1
15 1
19 1
25 1
40 1

Pass: 4
#reads #contigs (not counting singlets)
3 1
9 1
13 1
14 1
19 2
25 1
48 1

Read equivalence class histogram:
1 24
3 1
9 1
13 1
14 1
19 2
25 1
48 1
Done
Total space allocated: 7.056 Mbytes; currently free: 4.855 Mbytes in 8
blocks
Merging chimeras ... Done
Total space allocated: 7.056 Mbytes; currently free: 4.855 Mbytes in 8
blocks
Merging other singletons ...
LLR_join_cutoff: -60
Done
Total space allocated: 7.056 Mbytes; currently free: 4.855 Mbytes in 8
blocks
Finding extents ... Done
Total space allocated: 7.056 Mbytes; currently free: 4.859 Mbytes in 9
blocks
Making contig sequences ... Done
Total space allocated: 7.056 Mbytes; currently free: 4.713 Mbytes in 18
blocks
Aligning reads to contigs ... Done
Total space allocated: 7.056 Mbytes; currently free: 4.687 Mbytes in 23
blocks
Revising contigs ... Done
Total space allocated: 7.056 Mbytes; currently free: 4.518 Mbytes in 23
blocks
289 old base segments, 0.009 Mb
3826 new base segments, 0.122 Mb
total old contig length 33053, 0.099 Mb
total new contig length 32782, 0.098 Mb
Aligning reads to contigs ..."
ERR: Aborting assembly.

- Report from 'Enter assembly (into Gap4)' -
ERR: Could not open file
/home/users/sghignon/candidatus/p2f10/pregap.assembly/fofn.
ERR: "couldn't open "fofn": no such file or directory"
ERR: Aborting enter assembly.

*** Processing finished ***

How can I solve those issues? are both related to memory resources?
Is there someone aware oh this?
Thanks in advance

stefano

_______________________________________________
Staden mailing list
Staden@...
http://www.bio.net/biomail/listinfo/staden

Re: using emboss programs from spin

2006-11-01T04:03:42Z

Guy Bottu wrote:
> Peter Rice from the EMBOSS team had promised to do some work on Staden
> to make it again EMBOSS compatible, but he has a lot of other things to
> do and I am afraid he did not yet come to it. Maybe you can send a mail
> to the EMBOSS mailing list emboss@...

Yes please ... we would very much like to know how many Staden users are
interested in the EMBOSS interface.

I plan to update it for EMBOSS 4.0.0 (released last July).

regards,

Peter

_______________________________________________
Staden mailing list
Staden@...
http://www.bio.net/biomail/listinfo/staden

Re: using emboss programs from spin

2006-10-29T03:33:18Z

Miguel Ortiz Lombardia <mortiz@...> wrote:

> But then I get many "qualifier" errors. I think this is because the
> spin_emboss package instead of the spin2_emboss one is being used. I
> checked at least that for the EMBOSS program "matcher".

> Could someone tell me how to enforce the use of spin2_emboss?

I think the nature of your problem is different. create_emboss_files
contains a line
exec stash $STADLIB/spin2_emboss/create_emboss_files......
that tells the program to make files for spin2 ; you can replace this by
spin. spin2 is a successor program of spin, which however did not get
beyond alpha test because the cut of the support for the Staden team.
There is more serious : spin worked relatively well with EMBOSS 2.8 but
starting with EMBOSS 2.9 the syntax of the ACD files was changed and
since then under spin EMBOSS programs do not greyout optional parameters
as needed or simply do not run at all. I managed to make it work at the
BEN site, but only with a lot of ugly hacking....
Peter Rice from the EMBOSS team had promised to do some work on Staden
to make it again EMBOSS compatible, but he has a lot of other things to
do and I am afraid he did not yet come to it. Maybe you can send a mail
to the EMBOSS mailing list emboss@...

Regards,
Guy Bottu,
Belgian EMBnet Node

_______________________________________________
Staden mailing list
Staden@...
http://www.bio.net/biomail/listinfo/staden

using emboss programs from spin

2006-10-19T05:36:35Z

Dear all,

I have installed on a linux system (Ubuntu 6.06):

Staden-1.7.0
EMBOSS 3.0.0

First, I had to make the iwidgets symbolic link in staden-1.7.0/lib to
point to the right place:

ln -sf /usr/lib/iwidgets4.0.1 iwidgets

I wanted to use the spin interface to run emboss programs. So I run
create_emboss_files. Because the tcl script assumes a wrong localization
of the acd files (and then it hangs indefinitely) I had to change the
create_emboss_files.tcl file so the script would know where such files
are in fact. This is what I did:

1. Comment out the procedure "proc acd_dir"

2. Down in the file change set acd_dir [acd_dir] to:
set acd_dir /usr/local/share/EMBOSS/acd

After doing this, the acd files are found and some of them processed.
Others produce errors, I can post these errors if someone is interested.

To use staden with emboss, I issued:

export STADENROOT=/usr/local/staden-1.7.0
. $STADENROOT/staden.profile
export EMBOSS_DATA=/usr/local/share/EMBOSS/data

But then I get many "qualifier" errors. I think this is because the
spin_emboss package instead of the spin2_emboss one is being used. I
checked at least that for the EMBOSS program "matcher".

Could someone tell me how to enforce the use of spin2_emboss?

Thank you very much in advance,

Miguel
--
Miguel Ortiz Lombardía
Centro de Investigaciones Oncológicas
C/ Melchor Fernández Almagro, 3
28029 Madrid, Spain
Tel. +34 912 246 900
Fax. +34 912 246 976
email: molatwork@...
www: http://www.ysbl.york.ac.uk/~mol/
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
Le travail est ce que l'homme a trouvé de mieux
pour ne rien faire de sa vie. (Raoul Vaneigem)

**NOTA DE CONFIDENCIALIDAD** Este correo electrónico, y en su caso los ficheros adjuntos, pueden contener información protegida para el uso exclusivo de su destinatario. Se prohíbe la distribución, reproducción o cualquier otro tipo de transmisión por parte de otra persona que no sea el destinatario. Si usted recibe por error este correo, se ruega comunicarlo al remitente y borrar el mensaje recibido.
**CONFIDENTIALITY NOTICE** This email communication and any attachments may contain confidential and privileged information for the sole use of the designated recipient named above. Distribution, reproduction or any other use of this transmission by any party other than the intended recipient is prohibited. If you are not the intended recipient please contact the sender and delete all copies.

_______________________________________________
Staden mailing list
Staden@...
http://www.bio.net/biomail/listinfo/staden

Re: installing on linux

2006-10-17T15:15:53Z

In article <mailman.1269.1159823598.20007.staden@...>, "Laura
Miozzi" <laura.miozzi@...> wrote:

> Dear all,
>
> I'm trying to install staden package on mandriva distribution. I followed
> the instructions found on internet (make; make install...)
> but when I try to start gap4 I obtain always the following error message:
>
> "stash: error while loading shared libraries: libtk_utils.so: cannot open
> shared object file: No such file or directory"
>
> I guess that there is something wrong in how I have set the environmental
> variables but I can't find out what it is...
>
> Acually I started to use linux some month ago, so I don't know how resolve
> the problem...could you help me, please?
>
> Thank you!
> Regards

You haven't got the configuration for Staden fully sorted out.

First, you probably are using 'bash' as your shell so look in the file
called 'staden.profile' which is in the top level of the subdirectory
called 'staden', 'Staden' or 'Staden_1.6.0' or wherever you initially
installed the program. If you are using a different shell then look
instead in the file called 'staden.login'.

[Note that 'bash' is a variation of what is the traditional 'Bourne shell'
mentioned here.]

[staden.profile]

# Setup file for Staden software running on a Sun
# This setup for Bourne shell (sh) users
#
# This file should be source'd from your .profile
# assuming the environmental variable STADENROOT has been set up
# to point to the root directory for the staden software
#
# e.g.
# STADENROOT=/home/BioSW/staden; export STADENROOT
# . $STADENROOT/staden.profile

[The '#' symbols indicate that these lines are comments. Normally you
would not edit this file but it is useful to look at because it has the
instructions on how to install the Staden package.]

There are several variations possible here depending on whether you are
setting up the linux box for multiuser or whether you are the sole user.
The standard file that is generally modified for these purposes is in the
subdirectory '/etc' and is called 'profile'. Newer linux distributions
recommend putting customized local settings in the file 'profile.local'.
Check what is written at the top of the text file '/etc/profile' and see
if your linux version mentions the file 'profile.local'. If there is a
file '/etc/profile.local' then open it in a text editor (and make sure
that you are using a text editor, or at least save the file as a 'text'
file, when editing these types of files.) If the file doesn't exist and
that is what you are using then you will create it.

You need to add only two lines to the 'profile.local' or 'profile' file,
namely the last two in the section of the 'staden.profile' file that I
included above. You do not begin the lines with the '#' of course or they
will be ignored as comments.

The line 'STADENROOT' must give the full, precise path to the name of the
subdirectory that holds the Staden package. By default I believe the
subdirectory name is 'staden' but I personally use a more detailed name.
So for my Staden installations the line says:

'STADENROOT=/usr/local/bin/Staden_1.6.0' [without the two " ' "].

because I have always installed my localized software to the '/usr/local' tree.
You may have a similar setup or your Staden package may be in, say,
'opt/bin', but that is the only information you will need. Note that there
are no spaces anywhere in the line.
You can add the '; export STADENROOT' to the end of the 'STADENROOT' line
or you can write 'export STADENROOT' on the following line. There is
actually an even simpler variation as well.
So the 3 possible variations that you may add to the 'profile.local' or
'profile' file are [and you will use _your_ path]:

Variation 1:
STADENROOT=/usr/local/bin/Staden_1.6.0; export STADENROOT
. $STADENROOT/staden.profile

Variation 2:
STADENROOT=/usr/local/bin/Staden_1.6.0
export STADENROOT
. $STADENROOT/staden.profile

VARIATION 3:
export STADENROOT=/usr/local/bin/Staden_1.6.0
. $STADENROOT/staden.profile

You can choose whichever one you prefer.
And note that the line
' . $STADENROOT/staden.profile'
is really
[space].[space]$STADENROOT/staden.profile

I believe you may have to restart your linux (i.e., reboot) to get the new
file read. As I recall '/etc/profile' and '/etc/profile.local' are only
read during the system boot.

That should get you a fully functional Staden package.
This configuration setup is used for all UNIX/linux systems and also the
UNIX-like variation used in MacOSX.

Dave

--
David F. Spencer, Ph.D.
Dept. of Biochemistry and Molecular Biology
Dalhousie University, Halifax, Nova Scotia, Canada

_______________________________________________
Staden mailing list
Staden@...
http://www.bio.net/biomail/listinfo/staden

installing on linux

2006-10-02T10:56:23Z

Dear all,

I'm trying to install staden package on mandriva distribution. I followed
the instructions found on internet (make; make install...)
but when I try to start gap4 I obtain always the following error message:

"stash: error while loading shared libraries: libtk_utils.so: cannot open
shared object file: No such file or directory"

I guess that there is something wrong in how I have set the environmental
variables but I can't find out what it is...

Acually I started to use linux some month ago, so I don't know how resolve
the problem...could you help me, please?

Thank you!
Regards

--
Laura Miozzi
_______________________________________________
Staden mailing list
Staden@...
http://www.bio.net/biomail/listinfo/staden

prefinish for automated primer suggestion

2006-09-28T14:20:43Z

Hello,

I would like to use prefinish in an automated way to suggest primers for
assembly finishing.
Due to a lack of documentation I'm not sure if this is possible at all.
Can I use prefinish from the console to suggest primers for an gap4 -
assembly?
Where can I find a more detailed documentation about this tool and his
features?
If prefinish isen't able to perform these task I would consider to use
autofinish. But I'm not sure how to convert the gap4 database into .ace
format for use by autofinish. Any hints on these?

With kind regards,

deKesi

_______________________________________________
Staden mailing list
Staden@...
http://www.bio.net/biomail/listinfo/staden

Re: Staden install on LINUX!

2006-09-14T19:01:01Z

Dear Kai,

it seems that you miss the library "libtk_utils.so". It is possible that
it is related to the error you reported at the beginning of your
message, but the file you attached was discarded somewher before
reaching the newsgroup.

One hypothesis is that you miss one development file to build the
library itself. The tail of your build log should tell what went wrong.
Do you have the Tcl and Tk development files installed?

Have a nice day,

--
Charles Plessy
http://charles.plessy.org
Wako, Saitama, Japan

wangk wrote:

> Dear Sir
>
> Sorry to disturb you, but I met some problems in my work. I have downloded staden Software Package(staden-linux-x86-1-7-0.tar.gz and staden-src-1-7-0.tar.gz) from your website. The problem is when I typing 'make' in the directory /home/soft/staden/staden-src-1-7-0, the result is aways like this(I have typed 'make clean' before):
>
> make[1]: *** [Misc] Error 2
> make[1]: Leaving directory `/home/soft/staden/staden-src-1-7-0/src'
> make: *** [all] Error 2
>
> (reference the file staden-make.out)
>
> environment variable :
>
> export STADENROOT=/home/soft/staden/staden-linux-x86-1-7-0/
> . $STADENROOT/staden.profile
>
> so when I type gap4, it aways show
>
> stash: error while loading shared libraries: libtk_utils.so: cannot open shared object file: No such file or directory
>
> I realy don't know what is wrong with my work. Hope get your hlep informations!
>
> regards!
>
> Kai Wang
>
>
>
> wangk
> 2006-09-14
>

_______________________________________________
Staden mailing list
Staden@...
http://www.bio.net/biomail/listinfo/staden

Staden install on LINUX!

2006-09-14T03:25:17Z

Dear Sir

Sorry to disturb you, but I met some problems in my work. I have downloded staden Software Package(staden-linux-x86-1-7-0.tar.gz and staden-src-1-7-0.tar.gz) from your website. The problem is when I typing 'make' in the directory /home/soft/staden/staden-src-1-7-0, the result is aways like this(I have typed 'make clean' before):

make[1]: *** [Misc] Error 2
make[1]: Leaving directory `/home/soft/staden/staden-src-1-7-0/src'
make: *** [all] Error 2

(reference the file staden-make.out)

environment variable :

export STADENROOT=/home/soft/staden/staden-linux-x86-1-7-0/
. $STADENROOT/staden.profile

so when I type gap4, it aways show

stash: error while loading shared libraries: libtk_utils.so: cannot open shared object file: No such file or directory

I realy don't know what is wrong with my work. Hope get your hlep informations!

regards!

Kai Wang

wangk
2006-09-14

_______________________________________________
Staden mailing list
Staden@...
http://www.bio.net/biomail/listinfo/staden

How to get staden 1.6.0 running under Mac OS X 10.3.9

2006-08-31T02:48:27Z

Hi folks,

i want to install staden 1.6.0 under Mac OS X 10.3.9. X11 is already
installed and i downloaded the current release of the staden package from
their website. But what to do next? Can anyone give me a step-by-step
instruction what to do or something like a best practice guide to get staden
running for all my users on one mac. I read something about adding lines to
the .bashrc config file.

Thank you and greets from germany.
--
thomas dot fischer at lrz.uni-muenchen dot de

_______________________________________________
Staden mailing list
Staden@...
http://www.bio.net/biomail/listinfo/staden

Phred and Phrap exe

2006-07-24T10:34:01Z

Hello dear Staden Package users,

I received source code of Phred and Phrap because I am planning to use
these sofwares to run with PreGap. I am not a computer wizard and I
would like to know whether they are users who have already complied
these 2 softwares for windows (2000 and XP).
If this is the case, can some of you send me the exe to my email
address: Patrice.Bouvagnet@...

Thank you.
Best regards

Patrice Bouvagnet

_______________________________________________
Staden mailing list
Staden@...
http://www.bio.net/biomail/listinfo/staden

Benchmarking reassembly/Loading fasta files

2006-07-13T11:04:36Z

Hi All,

As part of my PhD project I'm working on a tool to benchmark reassembly
algorithms. To do this I'm planning on doing the following:

1. Taking a sequence file and breaking it into reads of a specified
length and during this process adding errors.

2. Reassembly these simulated reads with the reassembly programs
available in GAP4.

3. Align contigs of a useful size to the original sequence, note those
that align within a given edit distance.

4. Calculate the percentage of the sequence that is covered by contigs.

I have just completed the alignment with edit distance tool and am now
beginning the processes of benchmarking reassembly algorithms. Does
anybody have any thoughts or suggestions? I should say that my main
interest is short read reassembly.

Secondly, I'm having a problem with GAP4. It only seems to load
19 sequences from my fasta file. My fasta file looks like this:

>R0
CCAATTAGTCCTATTAAGAC

>R1
CAATTAGTCCTATTAAGACT

>R2
AATTAGTCCTATTAAGACTG

>R3
ATTAGTCCTATTAAGACTGT

However if I include any more than 19 sequences in my fasta file I
get the following error:

Failed files:
/home/new/A1.fasta (UNK) 'init: Unknown file type'

Is this a bug? Or I'm I doing something wrong?

Many Thanks for Reading,

Nava Whiteford

_______________________________________________
Staden mailing list
Staden@...
http://www.bio.net/biomail/listinfo/staden

Staden Package: new 1997.1 release

2006-06-19T14:52:17Z

James, Roger,

Not certain you are still at this address but I heard th= e Gap
package is continuing to evolve with the next generation sequencing
instruments. We met many years ago at the Whitehead and we are now
sitting = on ~ 1/2Gb of short read sequencing from the new sequ encing technology from APG.

ABI j= ust bought this technology and will putting an enormous thrust
behind its development = and we wanted to begin to reach out to
software developers in the space to make= the data formats known and
more compatible. We have been importing the reads to= G= AP4 = and
would like to discuss with you a few features which may make the
software more fr= iendly importing 5 M exp files.

Let me know if you get this and if you are interested in= seeing some
data.

Kevin McKernan<= /st1:PersonName>
<o:p>
_______________________________________________
Staden mailing list
Staden@...
http://www.bio.net/biomail/listinfo/staden

Installing STADEN on Mac 10.4 Tiger

2006-05-26T11:28:40Z

Hi,
Could anyone help me here.
I have actually dounloded the Mac Version of Staden on my desktop.
I seem not to be able to instal it . I have searched all documentation in the
download and on the website from where I downloaded it, Still, I could not find
a clue
Can nyone help me here/
Cheers,
Olabisi

___________________________________________________________
Try the all-new Yahoo! Mail. "The New Version is radically easier to use" The Wall Street Journal
http://uk.docs.yahoo.com/nowyoucan.html

_______________________________________________
Staden mailing list
Staden@...
http://www.bio.net/biomail/listinfo/staden

Re: Solving transposon problems on genome assembly

2006-05-17T13:25:29Z

Duarte Molha wrote:
> I am working on the sequencing of a microorganism and altough the main
> sequencing has been completed I am having problems due to the existence of
> many repeats (transposon regions).
> This makes my genome assembly very difficult and produces many contigs.
> Does anyone know if there is there anyway of improving this with the
> staden package?

Hello Duarte,

does your sequence data have quality information? Was the sequencing made
with library size of different template sizes and is this information
present in ancillary data (EXP files have them as well as XML traceinfo)?

If yes, you might want to try out a number of other assemblers that are
available out there. Phrap comes to mind (there's a version with gap4
integration), or - warning, shameless plug ahead - the MIRA assembler
(which produces assemblies that can be directly imported into gap4).

Should the transposons be not too large and ideally have perhaps something
between .3% and 1% (or more) of SNPs inbetween the different versions, then
I think that there is a realistic chance to get that solved without too
much hassle.

MIRA: http://www.chevreux.org/projects_mira.html
phrap: http://www.phrap.org/
list of others: http://en.wikipedia.org/wiki/Sequence_assembly

Regards,
Bastien

--
-- The universe has its own cure for stupidity. --
-- Unfortunately, it doesn't always apply it. --

_______________________________________________
Staden mailing list
Staden@...
http://www.bio.net/biomail/listinfo/staden

Solving transposon problems on genome assembly

2006-05-16T22:05:03Z

Hi

I am working on the sequencing of a microorganism and altough the main
sequencing has been completed I am having problems due to the existence of
many repeats (transposon regions).
This makes my genome assembly very difficult and produces many contigs.

Does anyone know if there is there anyway of improving this with the
staden package?

Best Regards

Duarte

--
Using Opera's revolutionary e-mail client: http://www.opera.com/mail/

_______________________________________________
Staden mailing list
Staden@...
http://www.bio.net/biomail/listinfo/staden