tag:old.nabble.com,2006:forum-3491Nabble - Generic Model Organism System Database2009-12-08T11:35:40ZThis project is to develop a set of software modules to be used to develop a generic model organism system database. Such databases contain information about the genomes and biology of laboratory organisms. Generic Model Organism System Database home is <a href="http://sourceforge.net/projects/gmod/" target="_top" rel="nofollow">here</a>.tag:old.nabble.com,2006:post-26699903proposal for gff3 of mass-spec data2009-12-08T11:35:40Z2009-12-08T11:35:40ZNicole Washingtonhi there,
<br><br>there's not much out there to describe how to define results of mass
<br>spec data, and the mapping of peptides to a genome.
<br><br>Here's what's required to make it work. We know what the annotated
<br>transcripts are in the genome. We also know that the relationships
<br>between polypeptides and CDS features is a derives_from relationship.
<br>When mass spec is performed, you have a protein sequence that is
<br>cleaved and then sequenced... therefore there's a set of short peptide
<br>sequences that are derived from the same longer peptide/protein, which
<br>is derived from the same CDS (or mRNA).
<br><br>So, let's say that we can then form a "peptide collection", which is a
<br>set of peptides that are derived from the same mRNA/transcript. The
<br>peptides can be mapped to the genome coords from which they were
<br>likely to be translated from.
<br><br># first, have a transcript defined
<br>IV Coding_transcript full_transcript 7160112 7165697 . - .
<br>ID=Transcript:C42D4.8;Note=DNA-directed+RNA+polymerase+II+largest
<br>+subunit;WormPep=WP:CE31330;Gene=WBGene00004411;CDS=C42D4.8
<br><br>#then, define the set of peptides. this could be an "unlocated" set
<br>PG2 my-favorite-stage peptide_collection . . . . .
<br>ID=PG2;parent=Transcript:C42D4.8;parental_relationship=derives_from
<br><br>#define a peptide, that is part of the set
<br>PG2.4 my-favorite-stage polypeptide_region 1 30 . . .
<br>ID=PG2.4;parent=PG2
<br><br>#show where the peptide matches to the genome.
<br>IV my-favorite-stage nucleotide_to_protein 7162644 7162734 . - 2
<br>Target=PG2.4 1 30
<br><br>#if it matches other locations in the genome, just add it
<br>III my-favorite-stage nucleotide_to_protein 62644 62734 . + 1
<br>Target=PG2.4 1 30
<br><br>#in this example the peptide spans an intron
<br>PG2.11 my-favorite-stage polypeptide_region 1 29 . . .
<br>ID=PG2.11;parent=PG2
<br>IV my-favorite-stage nucleotide_to_protein 7161859 7161809 . - .
<br>Target=PG2.11 1 29;Gap=M17 R1 M11
<br><br>what do you think?
<br><br>nicole
<br><br>------------------------------------------------------------------------------
<br>Return on Information:
<br>Google Enterprise Search pays you back
<br>Get the facts.
<br><a href="http://p.sf.net/sfu/google-dev2dev" target="_top" rel="nofollow">http://p.sf.net/sfu/google-dev2dev</a><br>_______________________________________________
<br>Gmod-gbrowse mailing list
<br><a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26699903&i=0" target="_top" rel="nofollow">Gmod-gbrowse@...</a>
<br><a href="https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse" target="_top" rel="nofollow">https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse</a><br><p>From forum: <a href="http://old.nabble.com/gmod-gbrowse-f3500.html" embed="fixTarget[3500]" target="_top" >gmod-gbrowse</a></p>tag:old.nabble.com,2006:post-26699149Re: OverLIB tooltips for feature mouseover2009-12-08T11:16:16Z2009-12-08T11:16:16ZVictor-55At 02:11 PM 12/8/2009, Victor wrote:
<br><br>>>link= sub { return "\" onmouseover=\"overlib('This is an ordinary
<br>>>popup.');return false;\" onmouseout=\"nd();return true;\"; }
<br><br>Correction (last quote should not be escaped):
<br><br>link= sub { return "\" onmouseover=\"overlib('This is an ordinary
<br>popup.');return false;\" onmouseout=\"nd();return true;"; }
<br><br><br><br><br>------------------------------------------------------------------------------
<br>Return on Information:
<br>Google Enterprise Search pays you back
<br>Get the facts.
<br><a href="http://p.sf.net/sfu/google-dev2dev" target="_top" rel="nofollow">http://p.sf.net/sfu/google-dev2dev</a><br>_______________________________________________
<br>Gmod-gbrowse mailing list
<br><a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26699149&i=0" target="_top" rel="nofollow">Gmod-gbrowse@...</a>
<br><a href="https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse" target="_top" rel="nofollow">https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse</a><br><p>From forum: <a href="http://old.nabble.com/gmod-gbrowse-f3500.html" embed="fixTarget[3500]" target="_top" >gmod-gbrowse</a></p>tag:old.nabble.com,2006:post-26699284Re: OverLIB tooltips for feature mouseover2009-12-08T11:13:05Z2009-12-08T11:13:05ZHaiming WangHi Lacey,
<br><br>In PlasmoDB and other EuPathDB projects, tooltips are generated by a
<br>Javascript library which can be downloaded from the following link,
<br><br><a href="http://www.walterzorn.com/tooltip/tooltip_e.htm" target="_top" rel="nofollow">http://www.walterzorn.com/tooltip/tooltip_e.htm</a><br><br>In your conf, you need to do the following,
<br><br>1) Indicate where to locate the JavaScript library which needs to be
<br>inside the <body> section, preferably immediately after the opening
<br><body> tag.
<br><br>html6 = <script type="text/javascript"
<br>src="/gbrowse/wz_tooltip.js"></script>
<br><br>2) Since most of tooltips are html tables, we created a template for that
<br><br>init_code = sub hover {
<br> use HTML::Template;
<br> my ($name, $data) = @_;
<br> my $tmpl = HTML::Template->new(filename =>
<br>'@gbrowseTargetDir@/hover.tmpl');
<br> $tmpl->param(DATA => [ map { { @$_ > 1 ? (KEY => $_->[0],
<br>VALUE => $_->[1]) : (SINGLE => $_->[0]) } } @$data ]);
<br> my $str = $tmpl->output;
<br> $str =~ s/'/\\'/g;
<br> $str =~ s/\s+$//;
<br> my $cmd = "this.T_STICKY=false;this.T_TITLE='$name'";
<br> $cmd = qq{" onMouseOver="$cmd;return escape('$str')};
<br> return $cmd;
<br> }
<br><br>3) In each track, key:value pairs will be added into the tooltips.
<br><br>title = sub {
<br> my $f = shift;
<br> my $name = $f->name;
<br> my $chr = $f->seq_id;
<br> my ($desc) = $f->get_tag_values("Note");
<br> my ($taxon) = $f->get_tag_values("Taxon");
<br> my @data;
<br> push @data, [ 'Name:' => $name ];
<br> push @data, [ 'Description:' => $desc ];
<br> hover("Annotated Gene: $name", \@data);
<br> }
<br>link =
<br>@siteWebAppUrl@/showRecord.do?name=GeneRecordClasses.GeneRecordClass&primary_key=$name
<br><br>You can factor them into separate modules, therefore conf will looks
<br>clean, such as
<br>link = sub { GBrowse::PopupAndLinks::geneTitle(shift) }
<br><br>One caveat, the amount of tooltips data can be huge depending on the
<br>viewing region. It will slow the performance. I'd suggest to use the
<br>AJAX balloon tips coming with GBrowse v1.7 if possible. I hope this is
<br>helpful.
<br><br>-Haiming
<br><br>-----------------------
<br>Haiming Wang
<br>EuPathDB Group
<br>Center for Tropical & Emerging Global Diseases
<br>University of Georgia
<br>Phone: 706-542-1447
<br><br><br>Lacey Sanderson wrote:
<div class='shrinkable-quote'><br>> I am using GBrowse 1.70 and really like the popups used
<br>> at <a href="http://www.plasmodb.org/cgi-bin/gbrowse/plasmodb/" target="_top" rel="nofollow">http://www.plasmodb.org/cgi-bin/gbrowse/plasmodb/</a><br>>
<br>> These seem to be implemented using overLIB
<br>> (<a href="http://www.bosrup.com/web/overlib/" target="_top" rel="nofollow">http://www.bosrup.com/web/overlib/</a>)
<br>>
<br>> However, I can't get them working, even after pouring through the
<br>> previous mouseover message
<br>> (<a href="http://old.nabble.com/mouseover-td4559223.html#a5152981" target="_top" rel="nofollow">http://old.nabble.com/mouseover-td4559223.html#a5152981</a>)
<br>>
<br>> From the OverLIB webpage I need to:
<br>> 1. Add <script type="text/javascript" src="overlib.js"><!-- overLIB
<br>> (c) Erik Bosrup --></script> in the head section
<br>> 2. Add <div id="overDiv" style="position:absolute; visibility:hidden;
<br>> z-index:1000;"></div> in the top of the body
<br>> 3. For a basic popup: Add <a href="javascript:void(0);"
<br>> onmouseover="return overlib('This is an ordinary
<br>> popup.');" onmouseout="return nd();">here</a> to define the link
<br>>
<br>> In my GBrowse .conf file I have done the above steps as follows:
<br>> 1. head = <script type="text/javascript" src="js/overlib/overlib.js"><!-- overLIB (c) Erik Bosrup --></script>
<br>> 2. header = <img src="<a href="http://128.233.29.40/gbrowse/images/Header.jpg" target="_top" rel="nofollow">http://128.233.29.40/gbrowse/images/Header.jpg</a>" alt="Pulse Crop GBrowse" />
<br>> <div id="overDiv" style="position:absolute; visibility:hidden; z-index:1000;"></div> #For overlib mouseovers
<br>> 3. Track Definition
<br>> [Genes]
<br>> feature = gene:imgag_working_models
<br>> category = Model Legumes:Medicago
<br>> key = IMGAG Gene Loci
<br>> glyph = transcript2
<br>> bgcolor = green
<br>> fgcolor = yellow
<br>> height = 6
<br>> description = 0
<br>> link = sub {
<br>> my $mes = "; onmouseover=\"return overlib(\'This is an ordinary popup.\');\" onmouseout=\"return nd();"
<br>> return $mes;
<br>> }
<br>>
<br>> I have also set balloon tips = 0 in the [General] Section and set title="" in the [TRACK DEFAULTS]
<br>>
<br>> However, when I mouseover the glyph my pointer changes to a hand and the details link is displayed in the status bar but no popup...
<br>> Any help would be Much appreciated!
<br>>
<br>> Lacey
<br>>
<br>> ------------------------------------------------------------------------
<br>>
<br>> ------------------------------------------------------------------------------
<br>> Return on Information:
<br>> Google Enterprise Search pays you back
<br>> Get the facts.
<br>> <a href="http://p.sf.net/sfu/google-dev2dev" target="_top" rel="nofollow">http://p.sf.net/sfu/google-dev2dev</a><br>>
<br>> ------------------------------------------------------------------------
<br>>
<br>> _______________________________________________
<br>> Gmod-gbrowse mailing list
<br>> <a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26699284&i=0" target="_top" rel="nofollow">Gmod-gbrowse@...</a>
<br>> <a href="https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse" target="_top" rel="nofollow">https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse</a><br>>
</div><br><br>------------------------------------------------------------------------------
<br>Return on Information:
<br>Google Enterprise Search pays you back
<br>Get the facts.
<br><a href="http://p.sf.net/sfu/google-dev2dev" target="_top" rel="nofollow">http://p.sf.net/sfu/google-dev2dev</a><br>_______________________________________________
<br>Gmod-gbrowse mailing list
<br><a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26699284&i=1" target="_top" rel="nofollow">Gmod-gbrowse@...</a>
<br><a href="https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse" target="_top" rel="nofollow">https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse</a><br><p>From forum: <a href="http://old.nabble.com/gmod-gbrowse-f3500.html" embed="fixTarget[3500]" target="_top" >gmod-gbrowse</a></p>tag:old.nabble.com,2006:post-26698893[SPAM]2009-12-08T10:59:00Z2009-12-08T10:59:00ZDement<br><br /> <br />------------------------------------------------------------------------------
<br>Return on Information:
<br>Google Enterprise Search pays you back
<br>Get the facts.
<br><a href="http://p.sf.net/sfu/google-dev2dev" target="_top" rel="nofollow">http://p.sf.net/sfu/google-dev2dev</a><br><br />_______________________________________________
<br>Gmod-schema-cmts mailing list
<br><a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26698893&i=0" target="_top" rel="nofollow">Gmod-schema-cmts@...</a>
<br><a href="https://lists.sourceforge.net/lists/listinfo/gmod-schema-cmts" target="_top" rel="nofollow">https://lists.sourceforge.net/lists/listinfo/gmod-schema-cmts</a><br><div class="small"><br/><img src="http://old.nabble.com/images/icon_attachment.gif" > <strong>actinometer.jpg</strong> (12K) <a href="http://old.nabble.com/attachment/26698893/0/actinometer.jpg" target="_top">Download Attachment</a></div><p>From forum: <a href="http://old.nabble.com/gmod-schema-cmts-f3507.html" embed="fixTarget[3507]" target="_top" >gmod-schema-cmts</a></p>tag:old.nabble.com,2006:post-26699045Re: OverLIB tooltips for feature mouseover2009-12-08T10:48:20Z2009-12-08T10:48:20ZVictor-55At 01:34 PM 12/8/2009, Lacey Sanderson wrote:
<br><div class='shrinkable-quote'><br>>3. Track Definition
<br>>[Genes]
<br>>feature = gene:imgag_working_models
<br>>category = Model Legumes:Medicago
<br>>key = IMGAG Gene Loci
<br>>glyph = transcript2
<br>>bgcolor = green
<br>>fgcolor = yellow
<br>>height = 6
<br>>description = 0
<br>>link = sub {
<br>> my $mes = "; onmouseover=\"return overlib(\'This is
<br>> an ordinary popup.\');\" onmouseout=\"return nd();"
<br>> return $mes;
<br>> }
</div><br>Try
<br><br>link= sub { return "\" onmouseover=\"overlib('This is an ordinary
<br>popup.');return false;\" onmouseout=\"nd();return true;\"; }
<br><br>Works for me this way.
<br><br>Doing quotes the right way is more tricky in GBrowse config files
<br>than many think..
<br><br>Victor
<br><br><br><br>------------------------------------------------------------------------------
<br>Return on Information:
<br>Google Enterprise Search pays you back
<br>Get the facts.
<br><a href="http://p.sf.net/sfu/google-dev2dev" target="_top" rel="nofollow">http://p.sf.net/sfu/google-dev2dev</a><br>_______________________________________________
<br>Gmod-gbrowse mailing list
<br><a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26699045&i=0" target="_top" rel="nofollow">Gmod-gbrowse@...</a>
<br><a href="https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse" target="_top" rel="nofollow">https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse</a><br><p>From forum: <a href="http://old.nabble.com/gmod-gbrowse-f3500.html" embed="fixTarget[3500]" target="_top" >gmod-gbrowse</a></p>tag:old.nabble.com,2006:post-26698520OverLIB tooltips for feature mouseover2009-12-08T10:34:46Z2009-12-08T10:34:46ZLacey Sanderson<html><body style="word-wrap: break-word; -webkit-nbsp-mode: space; -webkit-line-break: after-white-space; "><font class="Apple-style-span" face="Arial">I am using GBrowse 1.70 and really like the popups used at </font><span><a style="color: brown;" linkindex="207" href="http://www.plasmodb.org/cgi-bin/gbrowse/plasmodb/" target="_top" rel="nofollow"><font class="Apple-style-span" face="Arial">http://www.plasmodb.org/cgi-bin/gbrowse/plasmodb/</font></a></span><div><font class="Apple-style-span" face="Arial"><br></font></div><div><font class="Apple-style-span" face="Arial">These seem to be implemented using overLIB (<a href="http://www.bosrup.com/web/overlib/" target="_top" rel="nofollow">http://www.bosrup.com/web/overlib/</a>)</font></div><div><font class="Apple-style-span" face="Arial"><br></font></div><div><font class="Apple-style-span" face="Arial">However, I can't get them working, even after pouring through the previous mouseover message (<a href="http://old.nabble.com/mouseover-td4559223.html#a5152981" target="_top" rel="nofollow">http://old.nabble.com/mouseover-td4559223.html#a5152981</a>)</font></div><div><font class="Apple-style-span" face="Arial"><br></font></div><div><font class="Apple-style-span" face="Arial">From the OverLIB webpage I need to:</font></div><div><font class="Apple-style-span" face="Arial">1. Add </font><span class="Apple-style-span" style="white-space: pre; "><font class="Apple-style-span" face="Arial"><script type="text/javascript" src="overlib.js"><!-- overLIB (c) Erik Bosrup --></script> in the head section</font></span></div><div><span class="Apple-style-span" style="white-space: pre;"><font class="Apple-style-span" face="Arial">2. Add <div id="overDiv" style="position:absolute; visibility:hidden; z-index:1000;"></div> in the top of the body</font></span></div><div><span class="Apple-style-span" style="white-space: pre;"><font class="Apple-style-span" face="Arial">3. For a basic popup: Add <a href="javascript:void(0);" onmouseover="return overlib('This is an ordinary</font></span></div><pre><font class="Apple-style-span" face="Arial"> popup.');" onmouseout="return nd();">here</a> to define the link
</font></pre><pre><font class="Apple-style-span" face="Arial"><br></font></pre><pre><font class="Apple-style-span" face="Arial">In my GBrowse .conf file I have done the above steps as follows:</font></pre><pre><font class="Apple-style-span" face="Arial">1. head = <script type="text/javascript" src="js/overlib/overlib.js"><!-- overLIB (c) Erik Bosrup --></script></font></pre><pre><font class="Apple-style-span" face="Arial">2. header = <img src="<a href="http://128.233.29.40/gbrowse/images/Header.jpg" target="_top" rel="nofollow">http://128.233.29.40/gbrowse/images/Header.jpg</a>" alt="Pulse Crop GBrowse" />
<div id="overDiv" style="position:absolute; visibility:hidden; z-index:1000;"></div> #For overlib mouseovers</font></pre><pre><font class="Apple-style-span" face="Arial">3. Track Definition</font></pre><pre><font class="Apple-style-span" face="Arial">[Genes]
feature = gene:imgag_working_models
category = Model Legumes:Medicago
key = IMGAG Gene Loci
glyph = transcript2
bgcolor = green
fgcolor = yellow
height = 6
description = 0
link = sub {
my $mes = "; onmouseover=\"return overlib(\'This is an ordinary popup.\');\" onmouseout=\"return nd();"
return $mes;
}</font></pre><pre><font class="Apple-style-span" face="Arial"><br></font></pre><pre><font class="Apple-style-span" face="Arial">I have also set balloon tips = 0 in the [General] Section and set title="" in the [TRACK DEFAULTS]</font></pre><pre><font class="Apple-style-span" face="Arial"><br></font></pre><pre><font class="Apple-style-span" face="Arial">However, when I mouseover the glyph my pointer changes to a hand and the details link is displayed in the status bar but no popup...</font></pre><pre><font class="Apple-style-span" face="Arial">Any help would be Much appreciated!</font></pre><pre><font class="Apple-style-span" face="Arial"><br></font></pre><pre><font class="Apple-style-span" face="Arial">Lacey</font></pre><pre><font class="Apple-style-span" face="Arial"><br></font></pre></body></html>
<br />------------------------------------------------------------------------------
<br>Return on Information:
<br>Google Enterprise Search pays you back
<br>Get the facts.
<br><a href="http://p.sf.net/sfu/google-dev2dev" target="_top" rel="nofollow">http://p.sf.net/sfu/google-dev2dev</a><br><br />_______________________________________________
<br>Gmod-gbrowse mailing list
<br><a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26698520&i=0" target="_top" rel="nofollow">Gmod-gbrowse@...</a>
<br><a href="https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse" target="_top" rel="nofollow">https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse</a><br><p>From forum: <a href="http://old.nabble.com/gmod-gbrowse-f3500.html" embed="fixTarget[3500]" target="_top" >gmod-gbrowse</a></p>tag:old.nabble.com,2006:post-26698050Re: [maker-devel] Massive lift-over of data from mm8 to mm9 - best way2009-12-08T10:05:31Z2009-12-08T10:05:31ZCarson Holt<HTML>
<HEAD>
<TITLE>Re: [maker-devel] [Gmod-gbrowse] Massive lift-over of data from mm8 to mm9 - best way</TITLE>
</HEAD>
<BODY>
<FONT FACE="Calibri, Verdana, Helvetica, Arial"><SPAN STYLE='font-size:11pt'>Hi Mark,<BR>
<BR>
MAKER will do this. Currently it is a two step process, in the next MAKER release this will be just one step. Just supply transcripts from the old assembly as ESTs to MAKER, then set the predictor to est2genome (turn repeatmasking options off by setting them to empty values). This will map everything forward onto the new assembly. MAKER at first will destroy the old names because it thinks these are ESTs, so it doesn’t give name preservation a priority. Pulling the old names forward is very easy though with just a second step. Take the final MAKER output GFF3 file filter it for the source tag est2genome (cat output.gff | grep –P “\test2genome\t” > new.gff). Then use this GFF3 file as input for the pred_gff option in MAKER, and set the predictor to pred_gff. This will map the names forward in the final GFF3 file.<BR>
<BR>
Thanks,<BR>
Carson<BR>
<BR>
<BR>
On 12/4/09 12:55 PM, "Dave Clements, GMOD Help Desk" <<a href="help@gmod.org" target="_top" rel="nofollow">help@...</a>> wrote:<BR>
<BR>
</SPAN></FONT><BLOCKQUOTE><FONT FACE="Calibri, Verdana, Helvetica, Arial"><SPAN STYLE='font-size:11pt'>Hi Mark,<BR>
<BR>
MAKER (see <a href="http://gmod.org/wiki/MAKER_Tutorial" target="_top" rel="nofollow">http://gmod.org/wiki/MAKER_Tutorial</a> and<BR>
<a href="http://gmod.org/wiki/MAKER" target="_top" rel="nofollow">http://gmod.org/wiki/MAKER</a> - which points you to the main MAKER site)<BR>
supports moving annotation from one assembly to another. I don't<BR>
remember the details, but if you can't find them, please post to the<BR>
MAKER list (cc'd here).<BR>
<BR>
Dave C.<BR>
<BR>
On Wed, Dec 2, 2009 at 3:39 PM, Wes Barris <<a href="wes.barris@csiro.au" target="_top" rel="nofollow">wes.barris@...</a>> wrote:<BR>
> mark meyer wrote:<BR>
>> Hi all,<BR>
>><BR>
>> We have a massive amount of ChIP-chip, ChIP-seq data that needs to be<BR>
>> lifted over to mm9 from mm8.<BR>
>><BR>
>> A) Is there a way to do this within Gbrowse itself?<BR>
><BR>
> Not that I am aware of.<BR>
><BR>
>> B) What is the easiest way to do this? If Gbrowse can't, can someone<BR>
>> recommend a quick way with detailed instructions? I know that UCSC has<BR>
>> a liftover tool, but it seems very slow and can only process one file at<BR>
>> a time.<BR>
><BR>
> I use the UCSC livtover tool quite often. Why not write a little<BR>
> script to do your work.<BR>
><BR>
>> We literally have hundreds, if not > 1k, GFF files that need to be<BR>
>> converted.<BR>
><BR>
> Be carefull when lifting over features with parents. It is possible<BR>
> to have children lifted over but not the parent.<BR>
><BR>
>> My guess it would be easiest to do this within Gbrowse itself since it<BR>
>> is already databased, but didn't see a quick way to do this. Sorry if I<BR>
>> missed something in the documentation.<BR>
>><BR>
>> Thanks,<BR>
>><BR>
>> Mark<BR>
><BR>
><BR>
> --<BR>
> Wes Barris <<a href="wes.barris@csiro.au" target="_top" rel="nofollow">wes.barris@...</a>><BR>
><BR>
> ------------------------------------------------------------------------------<BR>
> Join us December 9, 2009 for the Red Hat Virtual Experience,<BR>
> a free event focused on virtualization and cloud computing.<BR>
> Attend in-depth sessions from your desk. Your couch. Anywhere.<BR>
> <a href="http://p.sf.net/sfu/redhat-sfdev2dev" target="_top" rel="nofollow">http://p.sf.net/sfu/redhat-sfdev2dev</a><BR>
> _______________________________________________<BR>
> Gmod-gbrowse mailing list<BR>
> <a href="Gmod-gbrowse@lists.sourceforge.net" target="_top" rel="nofollow">Gmod-gbrowse@...</a><BR>
> <a href="https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse" target="_top" rel="nofollow">https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse</a><BR>
><BR>
<BR>
<BR>
<BR>
--<BR>
Please keep responses on the list!<BR>
<a href="http://gmod.org/wiki/January_2010_GMOD_Meeting" target="_top" rel="nofollow">http://gmod.org/wiki/January_2010_GMOD_Meeting</a><BR>
<a href="http://gmod.org/wiki/GMOD_News" target="_top" rel="nofollow">http://gmod.org/wiki/GMOD_News</a><BR>
Was this helpful? <a href="http://gmod.org/wiki/Help_Desk_Feedback" target="_top" rel="nofollow">http://gmod.org/wiki/Help_Desk_Feedback</a><BR>
<BR>
_______________________________________________<BR>
maker-devel mailing list<BR>
<a href="maker-devel@yandell-lab.org" target="_top" rel="nofollow">maker-devel@...</a><BR>
<a href="http://yandell-lab.org/mailman/listinfo/maker-devel_yandell-lab.org" target="_top" rel="nofollow">http://yandell-lab.org/mailman/listinfo/maker-devel_yandell-lab.org</a><BR>
<BR>
</SPAN></FONT></BLOCKQUOTE>
</BODY>
</HTML>
<br />------------------------------------------------------------------------------
<br>Return on Information:
<br>Google Enterprise Search pays you back
<br>Get the facts.
<br><a href="http://p.sf.net/sfu/google-dev2dev" target="_top" rel="nofollow">http://p.sf.net/sfu/google-dev2dev</a><br><br />_______________________________________________
<br>Gmod-gbrowse mailing list
<br><a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26698050&i=0" target="_top" rel="nofollow">Gmod-gbrowse@...</a>
<br><a href="https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse" target="_top" rel="nofollow">https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse</a><br><p>From forum: <a href="http://old.nabble.com/gmod-gbrowse-f3500.html" embed="fixTarget[3500]" target="_top" >gmod-gbrowse</a></p>tag:old.nabble.com,2006:post-26697952Re: gbrowse2 bioperl/bio-graphics libraries2009-12-08T09:59:44Z2009-12-08T09:59:44ZScott Cain-4Hi Sean,
<br><br>I remember seeing the stuff about PL_unitcheckav before, but I don't
<br>remember what the problem was. Anyone? Definitely try running
<br>./Build realclean.
<br><br>Scott
<br><br><br>On Tue, Dec 8, 2009 at 12:32 PM, Sean O'Keeffe <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697952&i=0" target="_top" rel="nofollow">okeeffe@...</a>> wrote:
<div class='shrinkable-quote'><br>> Scott Cain wrote:
<br>>>
<br>>> Hi Sean,
<br>>>
<br>>> Executing `perl -V` should give you as the last bit of output the list
<br>>> of directories in at @INC. This should include any paths added by the
<br>>> environment variable PERL5LIB.
<br>>>
<br>>> Scott
<br>>>
<br>>>
<br>>> On Tue, Dec 8, 2009 at 11:53 AM, Sean O'Keeffe <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697952&i=1" target="_top" rel="nofollow">okeeffe@...</a>>
<br>>> wrote:
<br>>>
<br>>>>
<br>>>> Hi Folks,
<br>>>> Is there a way to find out where gbrowse is looking for installed
<br>>>> libraries?
<br>>>> I'm trying to install Gbrowse2 on top of Gbrowse1.71b and keep getting
<br>>>> errors below.
<br>>>> (Both bioperl-live and bio-graphics have been checked out today and
<br>>>> installed locally in /home/okeeffe where I have a local perl installed
<br>>>> also - hence /home/okeeffe/bin/perl Build.PL)
<br>>>>
<br>>>> /home/okeeffe/bin/perl Build.PL
<br>>>> --apachemodules=/project/gbrowse/httpd_internal/modules
<br>>>> --cgibin=/project/gbrowse/httpd_internal/htdocs/gbrowse2/cgi-bin
<br>>>> --conf=/project/gbrowse/httpd_internal/htdocs/gbrowse2/conf
<br>>>> --htdocs=/project/gbrowse/httpd_internal/htdocs/gbrowse2/htdocs
<br>>>> --databases=/project/gbrowse/httpd_internal/htdocs/gbrowse2/databases
<br>>>> --tmp=/project/gbrowse/httpd_internal/htdocs/gbrowse2/tmp
<br>>>> --portdemo=8080 --installconf=n --installetc=n --wwwuser=nobody
<br>>>> --install_base=/home/okeeffe/lib/perl5
<br>>>> Checking whether your kit is complete...
<br>>>> Looks good
<br>>>>
<br>>>> Checking prerequisites...
<br>>>> - ERROR: Bio::Root::Version is not installed
<br>>>> - ERROR: Bio::Graphics is not installed
<br>>>> * Optional prerequisite Safe::World is not installed
<br>>>> * Optional prerequisite File::NFSLock is not installed
<br>>>> * Optional prerequisite DBD::Pg is not installed
<br>>>> * Optional prerequisite DB_File::Lock is not installed
<br>>>>
<br>>>> ERRORS/WARNINGS FOUND IN PREREQUISITES. You may wish to install the
<br>>>> versions
<br>>>> of the modules indicated above before proceeding with this installation
<br>>>>
<br>>>> cc -I/home/okeeffe/lib/perl5/5.8.8/x86_64-linux/CORE -fPIC -fpic -c
<br>>>> -fno-strict-aliasing -pipe -Wdeclaration-after-statement
<br>>>> -I/usr/local/include -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -O2 -o
<br>>>> /tmp/compilet-1015242186.o /tmp/compilet-1015242186.c
<br>>>> cc -shared -L/usr/local/lib -o /tmp/compilet-1015242186.so
<br>>>> /tmp/compilet-1015242186.o
<br>>>> NOTE: Run ./Build reconfig to change existing configuration.
<br>>>> Deleting Build
<br>>>> Removed previous script 'Build'
<br>>>>
<br>>>> Creating new 'Build' script for 'GBrowse' version '1.9971'
<br>>>> Now run:
<br>>>> ./Build test
<br>>>> ./Build demo (optional)
<br>>>> ./Build install (as superuser/administrator)
<br>>>> -or-
<br>>>> ./Build install_slave (optional, for slave installations)
<br>>>>
<br>>>> Other useful targets:
<br>>>> ./Build reconfig (to reconfigure install locations)
<br>>>> ./Build demostop (to stop the demo)
<br>>>>
<br>>>>
<br>>>> ####
<br>>>>
<br>>>> Doing perl Build.PL just to see, gives me:
<br>>>> Checking whether your kit is complete...
<br>>>> Looks good
<br>>>>
<br>>>> Checking prerequisites...
<br>>>> - ERROR: Couldn't find a $VERSION in prerequisite Bio::Graphics
<br>>>> - ERROR: JSON is not installed
<br>>>> - ERROR: Statistics::Descriptive is not installed
<br>>>> * Optional prerequisite Safe::World is not installed
<br>>>> * Optional prerequisite File::NFSLock is not installed
<br>>>> * Optional prerequisite DBD::Pg is not installed
<br>>>> * Optional prerequisite DB_File::Lock is not installed
<br>>>> * Optional prerequisite FCGI is not installed
<br>>>>
<br>>>> Anyway I'd like to be able to find out where it's finding/not finding
<br>>>> said versions
<br>>>> Thanks.
<br>>>>
<br>>>>
<br>>>>
<br>>>> ------------------------------------------------------------------------------
<br>>>> Return on Information:
<br>>>> Google Enterprise Search pays you back
<br>>>> Get the facts.
<br>>>> <a href="http://p.sf.net/sfu/google-dev2dev" target="_top" rel="nofollow">http://p.sf.net/sfu/google-dev2dev</a><br>>>> _______________________________________________
<br>>>> Gmod-gbrowse mailing list
<br>>>> <a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697952&i=2" target="_top" rel="nofollow">Gmod-gbrowse@...</a>
<br>>>> <a href="https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse" target="_top" rel="nofollow">https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse</a><br>>>>
<br>>>>
<br>>>
<br>>>
<br>>>
<br>>>
<br>>
<br>> Indeed, thanks Scott.
<br>> & running a setenv to change the PERL5LIB now gives me success.
<br>> However, now both test and install return:
<br>> ./Build install
<br>> NOTE: Run ./Build reconfig to change existing configuration.
<br>> cc -I/amd/dolce/1/home/abt_vin/okeeffe/Gbrowse2/libalign
<br>> -I/home/okeeffe/lib/perl5/5.8.8/x86_64-linux/CORE -DXS_VERSION="1.9971"
<br>> -DVERSION="1.9971" -fPIC -fpic -c -fno-strict-aliasing -pipe
<br>> -Wdeclaration-after-statement -I/usr/local/include -D_LARGEFILE_SOURCE
<br>> -D_FILE_OFFSET_BITS=64 -O2 -o lib/Bio/Graphics/Browser2/CAlign.o
<br>> lib/Bio/Graphics/Browser2/CAlign.c
<br>> lib/Bio/Graphics/Browser2/CAlign.c: In function
<br>> 'boot_Bio__Graphics__Browser2__CAlign':
<br>> lib/Bio/Graphics/Browser2/CAlign.c:299: error: 'PL_unitcheckav' undeclared
<br>> (first use in this function)
<br>> lib/Bio/Graphics/Browser2/CAlign.c:299: error: (Each undeclared identifier
<br>> is reported only once
<br>> lib/Bio/Graphics/Browser2/CAlign.c:299: error: for each function it appears
<br>> in.)
<br>> error building lib/Bio/Graphics/Browser2/CAlign.o from
<br>> 'lib/Bio/Graphics/Browser2/CAlign.c' at
<br>> /home/okeeffe/lib/perl5/site_perl/5.8.8/ExtUtils/CBuilder/Base.pm line 110.
<br>>
<br>>
</div><br><br><br>--
<br>------------------------------------------------------------------------
<br>Scott Cain, Ph. D. scott at scottcain dot net
<br>GMOD Coordinator (<a href="http://gmod.org/" target="_top" rel="nofollow">http://gmod.org/</a>) 216-392-3087
<br>Ontario Institute for Cancer Research
<br><br>------------------------------------------------------------------------------
<br>Return on Information:
<br>Google Enterprise Search pays you back
<br>Get the facts.
<br><a href="http://p.sf.net/sfu/google-dev2dev" target="_top" rel="nofollow">http://p.sf.net/sfu/google-dev2dev</a><br>_______________________________________________
<br>Gmod-gbrowse mailing list
<br><a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697952&i=3" target="_top" rel="nofollow">Gmod-gbrowse@...</a>
<br><a href="https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse" target="_top" rel="nofollow">https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse</a><br><p>From forum: <a href="http://old.nabble.com/gmod-gbrowse-f3500.html" embed="fixTarget[3500]" target="_top" >gmod-gbrowse</a></p>tag:old.nabble.com,2006:post-26697623Re: A question about landmark region and adding Name and ID tags to attribute column2009-12-08T09:38:15Z2009-12-08T09:38:15ZScott Cain-4Hi Fariba,
<br><br>Please keep your correspondence on the mailing list.
<br><br>For configuration question like this, I suggest you look at the tutorial at
<br><br> <a href="http://129.128.185.138/gbrowse/tutorial/tutorial.html" target="_top" rel="nofollow">http://129.128.185.138/gbrowse/tutorial/tutorial.html</a><br><br>You probably need to use a different glyph, and you need to turn
<br>labels on. You don't need an aggregator if you are using
<br>Bio::DB::SeqFeature::Store, only if you are using Bio::DB::GFF.
<br><br>Scott
<br><br><br>On Tue, Dec 8, 2009 at 12:54 AM, Fariba M <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697623&i=0" target="_top" rel="nofollow">fariba_mahdavifard@...</a>> wrote:
<div class='shrinkable-quote'><br>>
<br>> Hi Scott,
<br>>
<br>> I just reinstalled the GBrowse and now I can search for everything perfectly. Thanks for you help.
<br>>
<br>> But now the graphical output of AUGUSTUS is <a href="http://gbrowse.gobics.de/cgi-bin/gbrowse/AUG-1474656927/?name=Bgal_fosmid" target="_top" rel="nofollow">http://gbrowse.gobics.de/cgi-bin/gbrowse/AUG-1474656927/?name=Bgal_fosmid</a><br>> while my output is: <a href="http://129.128.185.138/cgi-bin/gbrowse/Bgal_test_agustus/?name=Bgal_fosmid" target="_top" rel="nofollow">http://129.128.185.138/cgi-bin/gbrowse/Bgal_test_agustus/?name=Bgal_fosmid</a><br>>
<br>> I need to do some modification to make mine similar to AUGUSTUS output. The first difference is that mine doesn't show the gene names on the figure. I added e.g. Name=g1 to the 9th column of my .gff3 file, but it still doesn't show?
<br>>
<br>> The other question is "aggregator"? Do I need to use that? how?
<br>>
<br>> Thanks,
<br>> Fariba
<br>>
<br>>
<br>>
<br>> --- On Sat, 12/5/09, Scott Cain <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697623&i=1" target="_top" rel="nofollow">scott@...</a>> wrote:
<br>>
<br>> From: Scott Cain <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697623&i=2" target="_top" rel="nofollow">scott@...</a>>
<br>> Subject: Re: [Gmod-gbrowse] A question about landmark region and adding Name and ID tags to attribute column
<br>> To: "Fariba M" <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697623&i=3" target="_top" rel="nofollow">fariba_mahdavifard@...</a>>
<br>> Date: Saturday, December 5, 2009, 1:19 AM
<br>>
<br>> Well, your data and conf work fine on properly installed gbrowse,
<br>> whereas your gbrowse has errors in the error log. Your data and the
<br>> volvox data are not exactly the same, so while one might work ok (as
<br>> far as you can tell, but perhaps not completely), yours does not. The
<br>> gbrowse install needs to be fixed.
<br>>
<br>> Scott
<br>>
<br>>
<br>> On Fri, Dec 4, 2009 at 4:44 PM, Fariba M <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697623&i=4" target="_top" rel="nofollow">fariba_mahdavifard@...</a>> wrote:
<br>> >
<br>> > Hi Scott,
<br>> >
<br>> > But if there is a problem in Gbrowse installation, why does it work perfectly for volvox?
<br>> >
<br>> > Fariba
<br>> >
<br>> > --- On Sat, 12/5/09, Scott Cain <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697623&i=5" target="_top" rel="nofollow">scott@...</a>> wrote:
<br>> >
<br>> > From: Scott Cain <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697623&i=6" target="_top" rel="nofollow">scott@...</a>>
<br>> > Subject: Re: [Gmod-gbrowse] A question about landmark region and adding Name and ID tags to attribute column
<br>> > To: "Fariba M" <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697623&i=7" target="_top" rel="nofollow">fariba_mahdavifard@...</a>>
<br>> > Date: Saturday, December 5, 2009, 12:39 AM
<br>> >
<br>> > I'd say it means something went wrong; you should check with the
<br>> > person who installed it if there were any error messages during the
<br>> > install. Certainly, it should have gotten a newer version of
<br>> > Bio::Graphics, so I'd say there were error messages, even if the
<br>> > person doing the install didn't see them.
<br>> >
<br>> > Scott
<br>> >
<br>> >
<br>> > On Fri, Dec 4, 2009 at 4:05 PM, Fariba M <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697623&i=8" target="_top" rel="nofollow">fariba_mahdavifard@...</a>> wrote:
<br>> > >
<br>> > > It's been probably installed using netinstaller, so does it mean something?
<br>> > >
<br>> > > Fariba
<br>> > >
<br>> > > --- On Fri, 12/4/09, Scott Cain <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697623&i=9" target="_top" rel="nofollow">scott@...</a>> wrote:
<br>> > >
<br>> > > From: Scott Cain <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697623&i=10" target="_top" rel="nofollow">scott@...</a>>
<br>> > > Subject: Re: [Gmod-gbrowse] A question about landmark region and adding Name and ID tags to attribute column
<br>> > > To: "Fariba M" <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697623&i=11" target="_top" rel="nofollow">fariba_mahdavifard@...</a>>
<br>> > > Cc: "Gbrowse (E-mail)" <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697623&i=12" target="_top" rel="nofollow">gmod-gbrowse@...</a>>
<br>> > > Date: Friday, December 4, 2009, 8:07 AM
<br>> > >
<br>> > > Yes, you should, in fact, I would suggest that person should be the
<br>> > > first line of support.
<br>> > >
<br>> > > Scott
<br>> > >
<br>> > > On Thu, Dec 3, 2009 at 11:32 PM, Fariba M <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697623&i=13" target="_top" rel="nofollow">fariba_mahdavifard@...</a>> wrote:
<br>> > > >
<br>> > > > Well, in fact I haven't install it, somebody else has installed and I'm just using.
<br>> > > > Can I somehow figure out how it has been installed? or should I contact the installer?
<br>> > > >
<br>> > > > Fariba
<br>> > > >
<br>> > > >
<br>> > > > --- On Fri, 12/4/09, Scott Cain <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697623&i=14" target="_top" rel="nofollow">scott@...</a>> wrote:
<br>> > > >
<br>> > > > From: Scott Cain <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697623&i=15" target="_top" rel="nofollow">scott@...</a>>
<br>> > > > Subject: Re: [Gmod-gbrowse] A question about landmark region and adding Name and ID tags to attribute column
<br>> > > > To: "Fariba M" <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697623&i=16" target="_top" rel="nofollow">fariba_mahdavifard@...</a>>
<br>> > > > Cc: "Gbrowse (E-mail)" <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697623&i=17" target="_top" rel="nofollow">gmod-gbrowse@...</a>>
<br>> > > > Date: Friday, December 4, 2009, 7:34 AM
<br>> > > >
<br>> > > > Hi Fariba,
<br>> > > >
<br>> > > > While I don't think the Bio::Graphics version is the problem you
<br>> > > > should clearly update it. The fact that it isn't updated makes me
<br>> > > > wonder what other preqs aren't present. How did you install GBrowse?
<br>> > > > Did you use the netinstaller?
<br>> > > >
<br>> > > > Scott
<br>> > > >
<br>> > > > On Thu, Dec 3, 2009 at 5:22 PM, Fariba M <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697623&i=18" target="_top" rel="nofollow">fariba_mahdavifard@...</a>> wrote:
<br>> > > > >
<br>> > > > > That's strange!!
<br>> > > > > it works OK for volvox, could you search through this link?
<br>> > > > > <a href="http://129.128.185.138/cgi-bin/gbrowse/Bgal_test_agustus/" target="_top" rel="nofollow">http://129.128.185.138/cgi-bin/gbrowse/Bgal_test_agustus/</a><br>> > > > >
<br>> > > > > In my error.log file I got some errors like:
<br>> > > > > [client 129.128.246.91] which will patch Bio::Graphics to the latest version.
<br>> > > > >
<br>> > > > > GBROWSE VERSION MISMATCH:
<br>> > > > >
<br>> > > > > GBrowse version 1.70 requires a compatible version of the Bio::Graphics library.
<br>> > > > >
<br>> > > > > You should either install BioPerl (the CVS live version) or reinstall GBrowse
<br>> > > > >
<br>> > > > > I don't exactly what the problem is, should I install something?
<br>> > > > >
<br>> > > > > Fariba
<br>> > > > > I
<br>> > > > >
<br>> > > > > --- On Fri, 12/4/09, Scott Cain <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697623&i=19" target="_top" rel="nofollow">scott@...</a>> wrote:
<br>> > > > >
<br>> > > > > From: Scott Cain <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697623&i=20" target="_top" rel="nofollow">scott@...</a>>
<br>> > > > > Subject: Re: [Gmod-gbrowse] A question about landmark region and adding Name and ID tags to attribute column
<br>> > > > > To: "Fariba M" <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697623&i=21" target="_top" rel="nofollow">fariba_mahdavifard@...</a>>
<br>> > > > > Cc: "Gbrowse (E-mail)" <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697623&i=22" target="_top" rel="nofollow">gmod-gbrowse@...</a>>
<br>> > > > > Date: Friday, December 4, 2009, 1:12 AM
<br>> > > > >
<br>> > > > > Strange--I am at a loss. Like I wrote before, doing exactly those
<br>> > > > > things works in my instance of GBrowse. Does searching work
<br>> > > > > appropriately in the yeast and volvox datasets? Also is there
<br>> > > > > anything in the apache error_log?
<br>> > > > >
<br>> > > > > Scott
<br>> > > > >
<br>> > > > >
<br>> > > > > On Thu, Dec 3, 2009 at 4:37 PM, Fariba M <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697623&i=23" target="_top" rel="nofollow">fariba_mahdavifard@...</a>> wrote:
<br>> > > > > >
<br>> > > > > > Hi Scott,
<br>> > > > > >
<br>> > > > > > For example: in order to search for Bgal_fosmid:1000..2000, I enter that in Landmark or Region box , but Gbrowse can't find this landmark. This msg appears: "The landmark named Bgal_fosmid:1000..2000 is not recognized. See the help pages for suggestions."
<br>> > > > > >
<br>> > > > > > Or:
<br>> > > > > > In "Details" section I click on e.g. Bgal_fosmid:1097..5200 it goes to another page and provides some details, but again when I click on Bgal_fosmid:1097..5200 (+ strand) it can't find it.
<br>> > > > > >
<br>> > > > > > Fariba
<br>> > > > > >
<br>> > > > > > --- On Thu, 12/3/09, Scott Cain <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697623&i=24" target="_top" rel="nofollow">scott@...</a>> wrote:
<br>> > > > > >
<br>> > > > > > From: Scott Cain <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697623&i=25" target="_top" rel="nofollow">scott@...</a>>
<br>> > > > > > Subject: Re: [Gmod-gbrowse] A question about landmark region and adding Name and ID tags to attribute column
<br>> > > > > > To: "Fariba M" <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697623&i=26" target="_top" rel="nofollow">fariba_mahdavifard@...</a>>
<br>> > > > > > Cc: "Gbrowse (E-mail)" <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697623&i=27" target="_top" rel="nofollow">gmod-gbrowse@...</a>>
<br>> > > > > > Date: Thursday, December 3, 2009, 10:27 PM
<br>> > > > > >
<br>> > > > > > Hi Fariba,
<br>> > > > > >
<br>> > > > > > Now that we've sorted out your data problems off list, I'm bringing
<br>> > > > > > this back to the GBrowse mailing list.
<br>> > > > > >
<br>> > > > > > I took your data and conf file and only changed the path to the data
<br>> > > > > > (and I changed it to the path to the directory, not to the file), and
<br>> > > > > > searching works as expected. In fact, you should notice if you use
<br>> > > > > > the zoom and pan functions that the currently location should show up
<br>> > > > > > in the search text field.
<br>> > > > > >
<br>> > > > > > So, when you try to search, what exactly do you do, what happens, and
<br>> > > > > > what if anything is reported in the apache error_log?
<br>> > > > > >
<br>> > > > > > Scott
<br>> > > > > >
<br>> > > > > >
<br>> > > > > > On Thu, Dec 3, 2009 at 1:44 PM, Fariba M <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697623&i=28" target="_top" rel="nofollow">fariba_mahdavifard@...</a>> wrote:
<br>> > > > > > >
<br>> > > > > > > Hi Scott,
<br>> > > > > > >
<br>> > > > > > > I really appreciate your help. Thanks a lot.
<br>> > > > > > >
<br>> > > > > > > You were right, that file was invalid. I modified it and the attached .gff3 file is now valid.
<br>> > > > > > > although it's not still working to search for locations in Bgal_fosmid.
<br>> > > > > > >
<br>> > > > > > > Fariba
<br>> > > > > > >
<br>> > > > > > >
<br>> > > > > > >
<br>> > > > > > > --- On Thu, 12/3/09, Scott Cain <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697623&i=29" target="_top" rel="nofollow">scott@...</a>> wrote:
<br>> > > > > > >
<br>> > > > > > > From: Scott Cain <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697623&i=30" target="_top" rel="nofollow">scott@...</a>>
<br>> > > > > > > Subject: Re: [Gmod-gbrowse] A question about landmark region and adding Name and ID tags to attribute column
<br>> > > > > > > To: "Fariba M" <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697623&i=31" target="_top" rel="nofollow">fariba_mahdavifard@...</a>>
<br>> > > > > > > Date: Thursday, December 3, 2009, 8:35 PM
<br>> > > > > > >
<br>> > > > > > > Fariba,
<br>> > > > > > >
<br>> > > > > > > There can only be lines that are comments (beginning with a # symbol),
<br>> > > > > > > fasta sequence (only at the end of the file) or nine columns of tab
<br>> > > > > > > delimited text. Anything else is invalid. There is a GFF3 validator
<br>> > > > > > > at wormbase:
<br>> > > > > > >
<br>> > > > > > > <a href="http://dev.wormbase.org/db/validate_gff3/validate_gff3_online" target="_top" rel="nofollow">http://dev.wormbase.org/db/validate_gff3/validate_gff3_online</a><br>> > > > > > >
<br>> > > > > > > Scott
<br>> > > > > > >
<br>> > > > > > > On Thu, Dec 3, 2009 at 12:00 PM, Fariba M <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697623&i=32" target="_top" rel="nofollow">fariba_mahdavifard@...</a>> wrote:
<br>> > > > > > > >
<br>> > > > > > > > Hi Scott,
<br>> > > > > > > >
<br>> > > > > > > > Yes, I'm using that file as .gff3 ; this is the output of Augustus <a href="http://augustus.gobics.de/" target="_top" rel="nofollow">http://augustus.gobics.de/</a><br>> > > > > > > > The web-based version of Augustus can show the output in gbrowse perfectly, but I need to do it in linux script.
<br>> > > > > > > >
<br>> > > > > > > > Could you please let me know what is wrong with that .gff3 file? I tried to remove the first lines (before #start g1) but it still didn't work. what are the other junks?
<br>> > > > > > > >
<br>> > > > > > > > Thanks,
<br>> > > > > > > > Fairba
<br>> > > > > > > >
<br>> > > > > > > >
<br>> > > > > > > >
<br>> > > > > > > > --- On Thu, 12/3/09, Scott Cain <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697623&i=33" target="_top" rel="nofollow">scott@...</a>> wrote:
<br>> > > > > > > >
<br>> > > > > > > > From: Scott Cain <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697623&i=34" target="_top" rel="nofollow">scott@...</a>>
<br>> > > > > > > > Subject: Re: [Gmod-gbrowse] A question about landmark region and adding Name and ID tags to attribute column
<br>> > > > > > > > To: "Fariba M" <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697623&i=35" target="_top" rel="nofollow">fariba_mahdavifard@...</a>>
<br>> > > > > > > > Date: Thursday, December 3, 2009, 7:13 PM
<br>> > > > > > > >
<br>> > > > > > > > Hi Fariba,
<br>> > > > > > > >
<br>> > > > > > > > The GFF3 file you sent is not a GFF3 file, it has a bunch of other
<br>> > > > > > > > garbage in it. If that is what you are really using, that is probably
<br>> > > > > > > > why GBrowse isn't working.
<br>> > > > > > > >
<br>> > > > > > > > Scott
<br>> > > > > > > >
<br>> > > > > > > >
<br>> > > > > > > > On Wed, Dec 2, 2009 at 10:58 PM, Fariba M <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697623&i=36" target="_top" rel="nofollow">fariba_mahdavifard@...</a>> wrote:
<br>> > > > > > > > >
<br>> > > > > > > > > Attached are my .conf and .gff3 files.
<br>> > > > > > > > > and this is the link :
<br>> > > > > > > > > <a href="http://129.128.185.138/cgi-bin/gbrowse/Bgal_test_agustus/?name=Bgal_fosmid" target="_top" rel="nofollow">http://129.128.185.138/cgi-bin/gbrowse/Bgal_test_agustus/?name=Bgal_fosmid</a><br>> > > > > > > > >
<br>> > > > > > > > > Thanks a lot,
<br>> > > > > > > > > Fariba
<br>> > > > > > > > >
<br>> > > > > > > > >
<br>> > > > > > > > >
<br>> > > > > > > > > --- On Thu, 12/3/09, Scott Cain <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697623&i=37" target="_top" rel="nofollow">scott@...</a>> wrote:
<br>> > > > > > > > >
<br>> > > > > > > > > From: Scott Cain <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697623&i=38" target="_top" rel="nofollow">scott@...</a>>
<br>> > > > > > > > > Subject: Re: [Gmod-gbrowse] A question about landmark region and adding Name and ID tags to attribute column
<br>> > > > > > > > > To: "Fariba M" <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697623&i=39" target="_top" rel="nofollow">fariba_mahdavifard@...</a>>
<br>> > > > > > > > > Cc: "Gbrowse (E-mail)" <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697623&i=40" target="_top" rel="nofollow">gmod-gbrowse@...</a>>
<br>> > > > > > > > > Date: Thursday, December 3, 2009, 7:21 AM
<br>> > > > > > > > >
<br>> > > > > > > > > Hi Fariba,
<br>> > > > > > > > >
<br>> > > > > > > > > Would you like to send me a set of sample data and a conf file that
<br>> > > > > > > > > has the problems you are describing?
<br>> > > > > > > > >
<br>> > > > > > > > > Scott
<br>> > > > > > > > >
<br>> > > > > > > > >
<br>> > > > > > > > > On Wed, Dec 2, 2009 at 10:44 PM, Fariba M <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697623&i=41" target="_top" rel="nofollow">fariba_mahdavifard@...</a>> wrote:
<br>> > > > > > > > > >
<br>> > > > > > > > > > In general, for my data, Gbrowse can't find any sub sequence, it just finds "Bgal_fosmid". If you search for example "Bgal_fosmid:1000..5000" it can't find it. it says "the landmark named Bgal_fosmid:1000..5000 is not recognized"!
<br>> > > > > > > > > >
<br>> > > > > > > > > > it's not the case for volvox data! it can find e.g. ctgA:3014..6130
<br>> > > > > > > > > >
<br>> > > > > > > > > > Fariba
<br>> > > > > > > > > >
<br>> > > > > > > > > >
<br>> > > > > > > > > > --- On Thu, 12/3/09, Scott Cain <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697623&i=42" target="_top" rel="nofollow">scott@...</a>> wrote:
<br>> > > > > > > > > >
<br>> > > > > > > > > > From: Scott Cain <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697623&i=43" target="_top" rel="nofollow">scott@...</a>>
<br>> > > > > > > > > > Subject: Re: [Gmod-gbrowse] A question about landmark region and adding Name and ID tags to attribute column
<br>> > > > > > > > > > To: "Fariba M" <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697623&i=44" target="_top" rel="nofollow">fariba_mahdavifard@...</a>>
<br>> > > > > > > > > > Cc: "Gbrowse (E-mail)" <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697623&i=45" target="_top" rel="nofollow">gmod-gbrowse@...</a>>
<br>> > > > > > > > > > Date: Thursday, December 3, 2009, 6:01 AM
<br>> > > > > > > > > >
<br>> > > > > > > > > > Hi Fariba,
<br>> > > > > > > > > >
<br>> > > > > > > > > > There is nothing special in the GFF file that you need to do to scroll and zoom; can you scroll and zoom in the yeast and volvox datasets? Are you talking about using the click and drag on the arrows to zoom and pan, or using the buttons and drop down menu? Do you have drag and drop turned on in the conf file?
<br>> > > > > > > > > >
<br>> > > > > > > > > > Scott
<br>> > > > > > > > > >
<br>> > > > > > > > > >
<br>> > > > > > > > > > On Wed, Dec 2, 2009 at 7:48 PM, Fariba M <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697623&i=46" target="_top" rel="nofollow">fariba_mahdavifard@...</a>> wrote:
<br>> > > > > > > > > >>
<br>> > > > > > > > > >> Hi Scott,
<br>> > > > > > > > > >> Thanks a lot for your help.
<br>> > > > > > > > > >> Finally I can connect to data and search for Bgal_fosmid output, after adding a new line to .gff3 file. So now .gff file looks like this:
<br>> > > > > > > > > >>
<br>> > > > > > > > > >> Bgal_fosmid . contig 1 120134 . . . ID=Bgal_fosmid;Name=Bgal_fosmid
<br>> > > > > > > > > >> # start gene g1
<br>> > > > > > > > > >> Bgal_fosmid AUGUSTUS gene 886 5381 0.13 + . ID=g1
<br>> > > > > > > > > >> Bgal_fosmid AUGUSTUS transcript 886 5381 0.13 + . ID=g1.t1;Parent=g1
<br>> > > > > > > > > >> Bgal_fosmid AUGUSTUS transcription_start_site 886 886 . + . Parent=g1.t1
<br>> > > > > > > > > >> Bgal_fosmid AUGUSTUS exon 886 1276 . + . Parent=g1.t1
<br>> > > > > > > > > >> Bgal_fosmid AUGUSTUS start_codon 1097 1099 . + 0 Parent=g1.t1
<br>> > > > > > > > > >> Bgal_fosmid AUGUSTUS intron 1277 1361 1 + . Parent=g1.t1
<br>> > > > > > > > > >> Bgal_fosmid AUGUSTUS intron 1458 1544 0.99 + . Parent=g1.t1
<br>> > > > > > > > > >> >>[g1 continues]
<br>> > > > > > > > > >>
<br>> > > > > > > > > >> # start gene g2
<br>> > > > > > > > > >> Bgal_fosmid AUGUSTUS gene 5496 7891 0.09 - . ID=g2
<br>> > > > > > > > > >> Bgal_fosmid AUGUSTUS transcript 5496 7891 0.09 - . ID=g2.t1;Parent=g2
<br>> > > > > > > > > >> Bgal_fosmid AUGUSTUS transcription_end_site 5496 5496 . - . Parent=g2.t1
<br>> > > > > > > > > >> Bgal_fosmid AUGUSTUS exon 5496 5792 . - . Parent=g2.t1
<br>> > > > > > > > > >> Bgal_fosmid AUGUSTUS stop_codon 5612 5614 . - 0 Parent=g2.t1
<br>> > > > > > > > > >> Bgal_fosmid AUGUSTUS intron 5793 5943 0.45 - . Parent=g2.t1
<br>> > > > > > > > > >> Bgal_fosmid AUGUSTUS intron 6065 6214 0.73 - . Parent=g2.t1
<br>> > > > > > > > > >> >>[g2 continues]
<br>> > > > > > > > > >>
<br>> > > > > > > > > >> # start gene g3
<br>> > > > > > > > > >> >>[continues]
<br>> > > > > > > > > >>
<br>> > > > > > > > > >> Now the problem is that I can't scroll or zoom! Do you have any idea what the problem is? Do I need to add more lines to .gff3 file to define other things? genes? ranges?
<br>> > > > > > > > > >>
<br>> > > > > > > > > >> Thanks,
<br>> > > > > > > > > >> Fariba
<br>> > > > > > > > > >>
<br>> > > > > > > > > >>
<br>> > > > > > > > > >>
<br>> > > > > > > > > >> --- On Wed, 12/2/09, Scott Cain <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697623&i=47" target="_top" rel="nofollow">scott@...</a>> wrote:
<br>> > > > > > > > > >>
<br>> > > > > > > > > >> From: Scott Cain <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697623&i=48" target="_top" rel="nofollow">scott@...</a>>
<br>> > > > > > > > > >> Subject: Re: [Gmod-gbrowse] A question about landmark region and adding Name and ID tags to attribute column
<br>> > > > > > > > > >> To: "Fariba M" <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697623&i=49" target="_top" rel="nofollow">fariba_mahdavifard@...</a>>
<br>> > > > > > > > > >> Cc: "Gbrowse (E-mail)" <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697623&i=50" target="_top" rel="nofollow">gmod-gbrowse@...</a>>
<br>> > > > > > > > > >> Date: Wednesday, December 2, 2009, 10:02 PM
<br>> > > > > > > > > >>
<br>> > > > > > > > > >> Hi Fariba,
<br>> > > > > > > > > >>
<br>> > > > > > > > > >> That's interesting: when I do a global search and replace for the
<br>> > > > > > > > > >> string 'ctgA' to 'ABC' in all of the GFF and FASTA files in the volvox
<br>> > > > > > > > > >> directory, and then search for 'ABC', it works exactly like it did
<br>> > > > > > > > > >> before I changed it. Are you sure you changed it in all of the data
<br>> > > > > > > > > >> files? I did this in vim:
<br>> > > > > > > > > >>
<br>> > > > > > > > > >> % s/ctgA/ABC/g
<br>> > > > > > > > > >>
<br>> > > > > > > > > >>
<br>> > > > > > > > > >> Scott
<br>> > > > > > > > > >>
<br>> > > > > > > > > >>
<br>> > > > > > > > > >> On Wed, Dec 2, 2009 at 1:20 PM, Fariba M <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697623&i=51" target="_top" rel="nofollow">fariba_mahdavifard@...</a>> wrote:
<br>> > > > > > > > > >> >
<br>> > > > > > > > > >> > Hi Scott,
<br>> > > > > > > > > >> >
<br>> > > > > > > > > >> > Now the volovox example works, but when I replace all the "ctgA" with another word like "ABC" in both .gff3 file and .conf file, it can't find "ABC"!! why is it like this?? It only works with "ctgA"! even when we don't have any "ctgA" in .gff3 and .conf, it still can find "ctgA"!
<br>> > > > > > > > > >> > I tried to unselect "Cache tracks" but no difference!
<br>> > > > > > > > > >> >
<br>> > > > > > > > > >> > Fariba
<br>> > > > > > > > > >> >
<br>> > > > > > > > > >> >
<br>> > > > > > > > > >> >
<br>> > > > > > > > > >> > --- On Wed, 12/2/09, Scott Cain <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697623&i=52" target="_top" rel="nofollow">scott@...</a>> wrote:
<br>> > > > > > > > > >> >
<br>> > > > > > > > > >> > From: Scott Cain <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697623&i=53" target="_top" rel="nofollow">scott@...</a>>
<br>> > > > > > > > > >> > Subject: Re: [Gmod-gbrowse] A question about landmark region and adding Name and ID tags to attribute column
<br>> > > > > > > > > >> > To: "Fariba M" <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697623&i=54" target="_top" rel="nofollow">fariba_mahdavifard@...</a>>
<br>> > > > > > > > > >> > Cc: "Gbrowse (E-mail)" <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697623&i=55" target="_top" rel="nofollow">gmod-gbrowse@...</a>>
<br>> > > > > > > > > >> > Date: Wednesday, December 2, 2009, 1:19 AM
<br>> > > > > > > > > >> >
<br>> > > > > > > > > >> > Hi Fariba,
<br>> > > > > > > > > >> >
<br>> > > > > > > > > >> > Please keep your responses on the GBrowse mailing list.
<br>> > > > > > > > > >> >
<br>> > > > > > > > > >> > If the tutorial isn't working, then we should try to address that
<br>> > > > > > > > > >> > problem before moving on to your own data. And if the tutorial isn't
<br>> > > > > > > > > >> > working, you should check first that the yeast chr 1 and 2 dataset is
<br>> > > > > > > > > >> > working. Assuming it is, now you have to figure out why the tutorial
<br>> > > > > > > > > >> > isn't working.
<br>> > > > > > > > > >> >
<br>> > > > > > > > > >> > First, you would be better off to use the tutorial at
<br>> > > > > > > > > >> > <a href="http://localhost/gbrowse/tutorial/tutorial.html " target="_top" rel="nofollow">http://localhost/gbrowse/tutorial/tutorial.html </a> That is, you should
<br>> > > > > > > > > >> > use the tutorial that was installed on your system when you installed
<br>> > > > > > > > > >> > GBrowse. It will be much more likely to have the correct paths to the
<br>> > > > > > > > > >> > various files you'll need.
<br>> > > > > > > > > >> >
<br>> > > > > > > > > >> > It sounds from what you've described below that you have the volvox
<br>> > > > > > > > > >> > conf file in the right place, because gbrowse appears to be reading
<br>> > > > > > > > > >> > it; otherwise you'd get an error message about being unable to find
<br>> > > > > > > > > >> > the conf file. Just to make sure, when you add a track to the volvox
<br>> > > > > > > > > >> > conf file (like the Motif track) and you reload the GBrowse page, is
<br>> > > > > > > > > >> > there a checkbox for the new track?
<br>> > > > > > > > > >> >
<br>> > > > > > > > > >> > Assuming that is the way it should be, the next question is whether
<br>> > > > > > > > > >> > the path to the volvox data directory at the top of the volvox conf
<br>> > > > > > > > > >> > file is correct.
<br>> > > > > > > > > >> >
<br>> > > > > > > > > >> > That is probably enough questions for one email. Let us know how it goes.
<br>> > > > > > > > > >> >
<br>> > > > > > > > > >> > Scott
<br>> > > > > > > > > >> >
<br>> > > > > > > > > >> >
<br>> > > > > > > > > >> > On Tue, Dec 1, 2009 at 4:07 PM, Fariba M <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697623&i=56" target="_top" rel="nofollow">fariba_mahdavifard@...</a>> wrote:
<br>> > > > > > > > > >> > >
<br>> > > > > > > > > >> > > Hi
<br>> > > > > > > > > >> > >
<br>> > > > > > > > > >> > > I still have problem with my dataset.
<br>> > > > > > > > > >> > > But I did EVERYTHING based on this tuturial <a href="http://v2.pseudomonas.com/gbrowse/tutorial/tutorial.html" target="_top" rel="nofollow">http://v2.pseudomonas.com/gbrowse/tutorial/tutorial.html</a> for volvox data, but it's not working when I have volvox1.gff3 and volvox2.gff3 !! I can't search for anything, even for volovx I always get this msg : "The landmark named [whatever] is not recognized. See the help pages for suggestions".
<br>> > > > > > > > > >> > >
<br>> > > > > > > > > >> > > Please let me know what I should do, I'm totally confused!
<br>> > > > > > > > > >> > >
<br>> > > > > > > > > >> > > Thanks.
<br>> > > > > > > > > >> > >
<br>> > > > > > > > > >> > >
<br>> > > > > > > > > >> > >
<br>> > > > > > > > > >> > >
<br>> > > > > > > > > >> > >
<br>> > > > > > > > > >> > > --- On Tue, 12/1/09, Scott Cain <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697623&i=57" target="_top" rel="nofollow">scott@...</a>> wrote:
<br>> > > > > > > > > >> > >
<br>> > > > > > > > > >> > > From: Scott Cain <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697623&i=58" target="_top" rel="nofollow">scott@...</a>>
<br>> > > > > > > > > >> > > Subject: Re: [Gmod-gbrowse] A question about landmark region and adding Name and ID tags to attribute column
<br>> > > > > > > > > >> > > To: "Fariba M" <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697623&i=59" target="_top" rel="nofollow">fariba_mahdavifard@...</a>>
<br>> > > > > > > > > >> > > Cc: <a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697623&i=60" target="_top" rel="nofollow">gmod-gbrowse@...</a>
<br>> > > > > > > > > >> > > Date: Tuesday, December 1, 2009, 9:36 PM
<br>> > > > > > > > > >> > >
<br>> > > > > > > > > >> > > Hi Fariba,
<br>> > > > > > > > > >> > >
<br>> > > > > > > > > >> > > Usually, problems with "landmark not found" are problems with the data. The most common problem is not having a GFF line for your reference sequence. For example, your data below refers to Bgal_fosmid. Is there a GFF line that defines what Bgal_fosmid is, like this:
<br>> > > > > > > > > >> > >
<br>> > > > > > > > > >> > > Bgal_fosmid . chromosome 1 120134 . . . ID=Bgal_fosmid;Name=Bgal_fosmid
<br>> > > > > > > > > >> > >
<br>> > > > > > > > > >> > > (The term chromosome can be replaced with any other sequence ontology term, like "fosmid").
<br>> > > > > > > > > >> > >
<br>> > > > > > > > > >> > > Scott
<br>> > > > > > > > > >> > >
<br>> > > > > > > > > >> > >
<br>> > > > > > > > > >> > >
<br>> > > > > > > > > >> > > On Mon, Nov 30, 2009 at 4:14 PM, Fariba M <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697623&i=61" target="_top" rel="nofollow">fariba_mahdavifard@...</a>> wrote:
<br>> > > > > > > > > >> > >>
<br>> > > > > > > > > >> > >> Hi all,
<br>> > > > > > > > > >> > >>
<br>> > > > > > > > > >> > >> I have a problem with gbrowse (although I'm not sure it's exactly gbrowse problem), I would be grateful if you can help me about that.
<br>> > > > > > > > > >> > >>
<br>> > > > > > > > > >> > >> I want to load the output file of "augustus" (which is a .gff3 file) in gbrowse. I installed GBrowse successfully following online instructions, I created a folder in the gbrowse database folder and placed the FASTA file and .gff3 file. I also created a .conf file in the conf folder that's basically the yeast.conf file but with the directory folder path changed. The problem is that I can't search and display the sequence. I always get this msg: "The landmark named [whatever] is not recognized. See the help pages for suggestions"
<br>> > > > > > > > > >> > >>
<br>> > > > > > > > > >> > >> This is the first part of my conf file:
<br>> > > > > > > > > >> > >> [GENERAL]
<br>> > > > > > > > > >> > >> description = Bgal Example Database
<br>> > > > > > > > > >> > >>
<br>> > > > > > > > > >> > >> db_adaptor = Bio::DB::SeqFeature::Store
<br>> > > > > > > > > >> > >> db_args = -adaptor memory
<br>> > > > > > > > > >> > >> -dsn /usr/local/apache/htdocs/gbrowse/databases/Bgal_test_agustus/Bgal_agustus_output.gff3
<br>> > > > > > > > > >> > >>
<br>> > > > > > > > > >> > >> I should mention that agustus predicted 9 genes, so my .gff3 file includes 9 section.
<br>> > > > > > > > > >> > >>
<br>> > > > > > > > > >> > >> This is the first few line of .gff3 file for g1 and g2:
<br>> > > > > > > > > >> > >> # start gene g1
<br>> > > > > > > > > >> > >> Bgal_fosmid AUGUSTUS gene 886 5381 0.13 + . g1 [Name??? ID???? ]
<br>> > > > > > > > > >> > >> Bgal_fosmid AUGUSTUS transcript 886 5381 0.13 + . g1.t1
<br>> > > > > > > > > >> > >> Bgal_fosmid AUGUSTUS tss 886 886 . + . transcript_id "g1.t1"; gene_id "g1";
<br>> > > > > > > > > >> > >> Bgal_fosmid AUGUSTUS exon 886 1276 . + . transcript_id "g1.t1"; gene_id "g1";
<br>> > > > > > > > > >> > >>
<br>> > > > > > > > > >> > >> # start gene g2
<br>> > > > > > > > > >> > >> Bgal_fosmid AUGUSTUS gene 5496 7891 0.09 - . [Name=Bgal_fosmid?; ID=Bgal_fosmid?]
<br>> > > > > > > > > >> > >> Bgal_fosmid AUGUSTUS transcript 5496 7891 0.09 - . g2.t1
<br>> > > > > > > > > >> > >> Bgal_fosmid AUGUSTUS tts 5496 5496 . - . transcript_id "g2.t1"; gene_id "g2";
<br>> > > > > > > > > >> > >>
<br>> > > > > > > > > >> > >> I know the problem is probably about Name and ID tags in the attribute column. But I don't know how I should modify .gff3 file to be correct here. It's not true if I just say Name=Bgal_fosmid; ID=Bgal_fosmid for all 9 genes, where should I give name and ID of genes?
<br>> > > > > > > > > >> > >>
<br>> > > > > > > > > >> > >>
<br>> > > > > > > > > >> > >> Thanks so much in advance.
<br>> > > > > > > > > >> > >> Fariba
<br>> > > > > > > > > >> > >>
<br>> > > > > > > > > >> > >>
<br>> > > > > > > > > >> > >>
<br>> > > > > > > > > >> > >>
<br>> > > > > > > > > >> > >> ------------------------------------------------------------------------------
<br>> > > > > > > > > >> > >> Join us December 9, 2009 for the Red Hat Virtual Experience,
<br>> > > > > > > > > >> > >> a free event focused on virtualization and cloud computing.
<br>> > > > > > > > > >> > >> Attend in-depth sessions from your desk. Your couch. Anywhere.
<br>> > > > > > > > > >> > >> <a href="http://p.sf.net/sfu/redhat-sfdev2dev" target="_top" rel="nofollow">http://p.sf.net/sfu/redhat-sfdev2dev</a><br>> > > > > > > > > >> > >> _______________________________________________
<br>> > > > > > > > > >> > >> Gmod-gbrowse mailing list
<br>> > > > > > > > > >> > >> <a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697623&i=62" target="_top" rel="nofollow">Gmod-gbrowse@...</a>
<br>> > > > > > > > > >> > >> <a href="https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse" target="_top" rel="nofollow">https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse</a><br>> > > > > > > > > >> > >>
<br>> > > > > > > > > >> > >
<br>> > > > > > > > > >> > >
<br>> > > > > > > > > >> > >
<br>> > > > > > > > > >> > > --
<br>> > > > > > > > > >> > > ------------------------------------------------------------------------
<br>> > > > > > > > > >> > > Scott Cain, Ph. D. scott at scottcain dot net
<br>> > > > > > > > > >> > > GMOD Coordinator (<a href="http://gmod.org/" target="_top" rel="nofollow">http://gmod.org/</a>) 216-392-3087
<br>> > > > > > > > > >> > > Ontario Institute for Cancer Research
<br>> > > > > > > > > >> > >
<br>> > > > > > > > > >> >
<br>> > > > > > > > > >> >
<br>> > > > > > > > > >> >
<br>> > > > > > > > > >> > --
<br>> > > > > > > > > >> > ------------------------------------------------------------------------
<br>> > > > > > > > > >> > Scott Cain, Ph. D. scott at scottcain dot net
<br>> > > > > > > > > >> > GMOD Coordinator (<a href="http://gmod.org/" target="_top" rel="nofollow">http://gmod.org/</a>) 216-392-3087
<br>> > > > > > > > > >> > Ontario Institute for Cancer Research
<br>> > > > > > > > > >> >
<br>> > > > > > > > > >>
<br>> > > > > > > > > >>
<br>> > > > > > > > > >>
<br>> > > > > > > > > >> --
<br>> > > > > > > > > >> ------------------------------------------------------------------------
<br>> > > > > > > > > >> Scott Cain, Ph. D. scott at scottcain dot net
<br>> > > > > > > > > >> GMOD Coordinator (<a href="http://gmod.org/" target="_top" rel="nofollow">http://gmod.org/</a>) 216-392-3087
<br>> > > > > > > > > >> Ontario Institute for Cancer Research
<br>> > > > > > > > > >>
<br>> > > > > > > > > >
<br>> > > > > > > > > >
<br>> > > > > > > > > >
<br>> > > > > > > > > > --
<br>> > > > > > > > > > ------------------------------------------------------------------------
<br>> > > > > > > > > > Scott Cain, Ph. D. scott at scottcain dot net
<br>> > > > > > > > > > GMOD Coordinator (<a href="http://gmod.org/" target="_top" rel="nofollow">http://gmod.org/</a>) 216-392-3087
<br>> > > > > > > > > > Ontario Institute for Cancer Research
<br>> > > > > > > > > >
<br>> > > > > > > > >
<br>> > > > > > > > >
<br>> > > > > > > > >
<br>> > > > > > > > > --
<br>> > > > > > > > > ------------------------------------------------------------------------
<br>> > > > > > > > > Scott Cain, Ph. D. scott at scottcain dot net
<br>> > > > > > > > > GMOD Coordinator (<a href="http://gmod.org/" target="_top" rel="nofollow">http://gmod.org/</a>) 216-392-3087
<br>> > > > > > > > > Ontario Institute for Cancer Research
<br>> > > > > > > > >
<br>> > > > > > > >
<br>> > > > > > > >
<br>> > > > > > > >
<br>> > > > > > > > --
<br>> > > > > > > > ------------------------------------------------------------------------
<br>> > > > > > > > Scott Cain, Ph. D. scott at scottcain dot net
<br>> > > > > > > > GMOD Coordinator (<a href="http://gmod.org/" target="_top" rel="nofollow">http://gmod.org/</a>) 216-392-3087
<br>> > > > > > > > Ontario Institute for Cancer Research
<br>> > > > > > > >
<br>> > > > > > >
<br>> > > > > > >
<br>> > > > > > >
<br>> > > > > > > --
<br>> > > > > > > ------------------------------------------------------------------------
<br>> > > > > > > Scott Cain, Ph. D. scott at scottcain dot net
<br>> > > > > > > GMOD Coordinator (<a href="http://gmod.org/" target="_top" rel="nofollow">http://gmod.org/</a>) 216-392-3087
<br>> > > > > > > Ontario Institute for Cancer Research
<br>> > > > > > >
<br>> > > > > >
<br>> > > > > >
<br>> > > > > >
<br>> > > > > > --
<br>> > > > > > ------------------------------------------------------------------------
<br>> > > > > > Scott Cain, Ph. D. scott at scottcain dot net
<br>> > > > > > GMOD Coordinator (<a href="http://gmod.org/" target="_top" rel="nofollow">http://gmod.org/</a>) 216-392-3087
<br>> > > > > > Ontario Institute for Cancer Research
<br>> > > > > >
<br>> > > > >
<br>> > > > >
<br>> > > > >
<br>> > > > > --
<br>> > > > > ------------------------------------------------------------------------
<br>> > > > > Scott Cain, Ph. D. scott at scottcain dot net
<br>> > > > > GMOD Coordinator (<a href="http://gmod.org/" target="_top" rel="nofollow">http://gmod.org/</a>) 216-392-3087
<br>> > > > > Ontario Institute for Cancer Research
<br>> > > > >
<br>> > > >
<br>> > > >
<br>> > > >
<br>> > > > --
<br>> > > > ------------------------------------------------------------------------
<br>> > > > Scott Cain, Ph. D. scott at scottcain dot net
<br>> > > > GMOD Coordinator (<a href="http://gmod.org/" target="_top" rel="nofollow">http://gmod.org/</a>) 216-392-3087
<br>> > > > Ontario Institute for Cancer Research
<br>> > > >
<br>> > >
<br>> > >
<br>> > >
<br>> > > --
<br>> > > ------------------------------------------------------------------------
<br>> > > Scott Cain, Ph. D. scott at scottcain dot net
<br>> > > GMOD Coordinator (<a href="http://gmod.org/" target="_top" rel="nofollow">http://gmod.org/</a>) 216-392-3087
<br>> > > Ontario Institute for Cancer Research
<br>> > >
<br>> >
<br>> >
<br>> >
<br>> > --
<br>> > ------------------------------------------------------------------------
<br>> > Scott Cain, Ph. D. scott at scottcain dot net
<br>> > GMOD Coordinator (<a href="http://gmod.org/" target="_top" rel="nofollow">http://gmod.org/</a>) 216-392-3087
<br>> > Ontario Institute for Cancer Research
<br>> >
<br>>
<br>>
<br>>
<br>> --
<br>> ------------------------------------------------------------------------
<br>> Scott Cain, Ph. D. scott at scottcain dot net
<br>> GMOD Coordinator (<a href="http://gmod.org/" target="_top" rel="nofollow">http://gmod.org/</a>) 216-392-3087
<br>> Ontario Institute for Cancer Research
<br>>
</div><br><br><br>--
<br>------------------------------------------------------------------------
<br>Scott Cain, Ph. D. scott at scottcain dot net
<br>GMOD Coordinator (<a href="http://gmod.org/" target="_top" rel="nofollow">http://gmod.org/</a>) 216-392-3087
<br>Ontario Institute for Cancer Research
<br><br>------------------------------------------------------------------------------
<br>Return on Information:
<br>Google Enterprise Search pays you back
<br>Get the facts.
<br><a href="http://p.sf.net/sfu/google-dev2dev" target="_top" rel="nofollow">http://p.sf.net/sfu/google-dev2dev</a><br>_______________________________________________
<br>Gmod-gbrowse mailing list
<br><a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697623&i=63" target="_top" rel="nofollow">Gmod-gbrowse@...</a>
<br><a href="https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse" target="_top" rel="nofollow">https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse</a><br><p>From forum: <a href="http://old.nabble.com/gmod-gbrowse-f3500.html" embed="fixTarget[3500]" target="_top" >gmod-gbrowse</a></p>tag:old.nabble.com,2006:post-26697529Re: gbrowse2 bioperl/bio-graphics libraries2009-12-08T09:32:10Z2009-12-08T09:32:10ZSean O'Keeffe-2Scott Cain wrote:
<div class='shrinkable-quote'><br>> Hi Sean,
<br>>
<br>> Executing `perl -V` should give you as the last bit of output the list
<br>> of directories in at @INC. This should include any paths added by the
<br>> environment variable PERL5LIB.
<br>>
<br>> Scott
<br>>
<br>>
<br>> On Tue, Dec 8, 2009 at 11:53 AM, Sean O'Keeffe <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697529&i=0" target="_top" rel="nofollow">okeeffe@...</a>> wrote:
<br>>
<br>>> Hi Folks,
<br>>> Is there a way to find out where gbrowse is looking for installed libraries?
<br>>> I'm trying to install Gbrowse2 on top of Gbrowse1.71b and keep getting
<br>>> errors below.
<br>>> (Both bioperl-live and bio-graphics have been checked out today and
<br>>> installed locally in /home/okeeffe where I have a local perl installed
<br>>> also - hence /home/okeeffe/bin/perl Build.PL)
<br>>>
<br>>> /home/okeeffe/bin/perl Build.PL
<br>>> --apachemodules=/project/gbrowse/httpd_internal/modules
<br>>> --cgibin=/project/gbrowse/httpd_internal/htdocs/gbrowse2/cgi-bin
<br>>> --conf=/project/gbrowse/httpd_internal/htdocs/gbrowse2/conf
<br>>> --htdocs=/project/gbrowse/httpd_internal/htdocs/gbrowse2/htdocs
<br>>> --databases=/project/gbrowse/httpd_internal/htdocs/gbrowse2/databases
<br>>> --tmp=/project/gbrowse/httpd_internal/htdocs/gbrowse2/tmp
<br>>> --portdemo=8080 --installconf=n --installetc=n --wwwuser=nobody
<br>>> --install_base=/home/okeeffe/lib/perl5
<br>>> Checking whether your kit is complete...
<br>>> Looks good
<br>>>
<br>>> Checking prerequisites...
<br>>> - ERROR: Bio::Root::Version is not installed
<br>>> - ERROR: Bio::Graphics is not installed
<br>>> * Optional prerequisite Safe::World is not installed
<br>>> * Optional prerequisite File::NFSLock is not installed
<br>>> * Optional prerequisite DBD::Pg is not installed
<br>>> * Optional prerequisite DB_File::Lock is not installed
<br>>>
<br>>> ERRORS/WARNINGS FOUND IN PREREQUISITES. You may wish to install the
<br>>> versions
<br>>> of the modules indicated above before proceeding with this installation
<br>>>
<br>>> cc -I/home/okeeffe/lib/perl5/5.8.8/x86_64-linux/CORE -fPIC -fpic -c
<br>>> -fno-strict-aliasing -pipe -Wdeclaration-after-statement
<br>>> -I/usr/local/include -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -O2 -o
<br>>> /tmp/compilet-1015242186.o /tmp/compilet-1015242186.c
<br>>> cc -shared -L/usr/local/lib -o /tmp/compilet-1015242186.so
<br>>> /tmp/compilet-1015242186.o
<br>>> NOTE: Run ./Build reconfig to change existing configuration.
<br>>> Deleting Build
<br>>> Removed previous script 'Build'
<br>>>
<br>>> Creating new 'Build' script for 'GBrowse' version '1.9971'
<br>>> Now run:
<br>>> ./Build test
<br>>> ./Build demo (optional)
<br>>> ./Build install (as superuser/administrator)
<br>>> -or-
<br>>> ./Build install_slave (optional, for slave installations)
<br>>>
<br>>> Other useful targets:
<br>>> ./Build reconfig (to reconfigure install locations)
<br>>> ./Build demostop (to stop the demo)
<br>>>
<br>>>
<br>>> ####
<br>>>
<br>>> Doing perl Build.PL just to see, gives me:
<br>>> Checking whether your kit is complete...
<br>>> Looks good
<br>>>
<br>>> Checking prerequisites...
<br>>> - ERROR: Couldn't find a $VERSION in prerequisite Bio::Graphics
<br>>> - ERROR: JSON is not installed
<br>>> - ERROR: Statistics::Descriptive is not installed
<br>>> * Optional prerequisite Safe::World is not installed
<br>>> * Optional prerequisite File::NFSLock is not installed
<br>>> * Optional prerequisite DBD::Pg is not installed
<br>>> * Optional prerequisite DB_File::Lock is not installed
<br>>> * Optional prerequisite FCGI is not installed
<br>>>
<br>>> Anyway I'd like to be able to find out where it's finding/not finding
<br>>> said versions
<br>>> Thanks.
<br>>>
<br>>>
<br>>> ------------------------------------------------------------------------------
<br>>> Return on Information:
<br>>> Google Enterprise Search pays you back
<br>>> Get the facts.
<br>>> <a href="http://p.sf.net/sfu/google-dev2dev" target="_top" rel="nofollow">http://p.sf.net/sfu/google-dev2dev</a><br>>> _______________________________________________
<br>>> Gmod-gbrowse mailing list
<br>>> <a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697529&i=1" target="_top" rel="nofollow">Gmod-gbrowse@...</a>
<br>>> <a href="https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse" target="_top" rel="nofollow">https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse</a><br>>>
<br>>>
<br>>
<br>>
<br>>
<br>>
</div>Indeed, thanks Scott.
<br>& running a setenv to change the PERL5LIB now gives me success.
<br>However, now both test and install return:
<br> ./Build install
<br>NOTE: Run ./Build reconfig to change existing configuration.
<br>cc -I/amd/dolce/1/home/abt_vin/okeeffe/Gbrowse2/libalign
<br>-I/home/okeeffe/lib/perl5/5.8.8/x86_64-linux/CORE -DXS_VERSION="1.9971"
<br>-DVERSION="1.9971" -fPIC -fpic -c -fno-strict-aliasing -pipe
<br>-Wdeclaration-after-statement -I/usr/local/include -D_LARGEFILE_SOURCE
<br>-D_FILE_OFFSET_BITS=64 -O2 -o lib/Bio/Graphics/Browser2/CAlign.o
<br>lib/Bio/Graphics/Browser2/CAlign.c
<br>lib/Bio/Graphics/Browser2/CAlign.c: In function
<br>'boot_Bio__Graphics__Browser2__CAlign':
<br>lib/Bio/Graphics/Browser2/CAlign.c:299: error: 'PL_unitcheckav'
<br>undeclared (first use in this function)
<br>lib/Bio/Graphics/Browser2/CAlign.c:299: error: (Each undeclared
<br>identifier is reported only once
<br>lib/Bio/Graphics/Browser2/CAlign.c:299: error: for each function it
<br>appears in.)
<br>error building lib/Bio/Graphics/Browser2/CAlign.o from
<br>'lib/Bio/Graphics/Browser2/CAlign.c' at
<br>/home/okeeffe/lib/perl5/site_perl/5.8.8/ExtUtils/CBuilder/Base.pm line 110.
<br><br><br>------------------------------------------------------------------------------
<br>Return on Information:
<br>Google Enterprise Search pays you back
<br>Get the facts.
<br><a href="http://p.sf.net/sfu/google-dev2dev" target="_top" rel="nofollow">http://p.sf.net/sfu/google-dev2dev</a><br>_______________________________________________
<br>Gmod-gbrowse mailing list
<br><a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697529&i=2" target="_top" rel="nofollow">Gmod-gbrowse@...</a>
<br><a href="https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse" target="_top" rel="nofollow">https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse</a><br><p>From forum: <a href="http://old.nabble.com/gmod-gbrowse-f3500.html" embed="fixTarget[3500]" target="_top" >gmod-gbrowse</a></p>tag:old.nabble.com,2006:post-26697261Re: gbrowse2 bioperl/bio-graphics libraries2009-12-08T09:12:36Z2009-12-08T09:12:36ZScott Cain-4Hi Sean,
<br><br>Executing `perl -V` should give you as the last bit of output the list
<br>of directories in at @INC. This should include any paths added by the
<br>environment variable PERL5LIB.
<br><br>Scott
<br><br><br>On Tue, Dec 8, 2009 at 11:53 AM, Sean O'Keeffe <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697261&i=0" target="_top" rel="nofollow">okeeffe@...</a>> wrote:
<div class='shrinkable-quote'><br>> Hi Folks,
<br>> Is there a way to find out where gbrowse is looking for installed libraries?
<br>> I'm trying to install Gbrowse2 on top of Gbrowse1.71b and keep getting
<br>> errors below.
<br>> (Both bioperl-live and bio-graphics have been checked out today and
<br>> installed locally in /home/okeeffe where I have a local perl installed
<br>> also - hence /home/okeeffe/bin/perl Build.PL)
<br>>
<br>> /home/okeeffe/bin/perl Build.PL
<br>> --apachemodules=/project/gbrowse/httpd_internal/modules
<br>> --cgibin=/project/gbrowse/httpd_internal/htdocs/gbrowse2/cgi-bin
<br>> --conf=/project/gbrowse/httpd_internal/htdocs/gbrowse2/conf
<br>> --htdocs=/project/gbrowse/httpd_internal/htdocs/gbrowse2/htdocs
<br>> --databases=/project/gbrowse/httpd_internal/htdocs/gbrowse2/databases
<br>> --tmp=/project/gbrowse/httpd_internal/htdocs/gbrowse2/tmp
<br>> --portdemo=8080 --installconf=n --installetc=n --wwwuser=nobody
<br>> --install_base=/home/okeeffe/lib/perl5
<br>> Checking whether your kit is complete...
<br>> Looks good
<br>>
<br>> Checking prerequisites...
<br>> - ERROR: Bio::Root::Version is not installed
<br>> - ERROR: Bio::Graphics is not installed
<br>> * Optional prerequisite Safe::World is not installed
<br>> * Optional prerequisite File::NFSLock is not installed
<br>> * Optional prerequisite DBD::Pg is not installed
<br>> * Optional prerequisite DB_File::Lock is not installed
<br>>
<br>> ERRORS/WARNINGS FOUND IN PREREQUISITES. You may wish to install the
<br>> versions
<br>> of the modules indicated above before proceeding with this installation
<br>>
<br>> cc -I/home/okeeffe/lib/perl5/5.8.8/x86_64-linux/CORE -fPIC -fpic -c
<br>> -fno-strict-aliasing -pipe -Wdeclaration-after-statement
<br>> -I/usr/local/include -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -O2 -o
<br>> /tmp/compilet-1015242186.o /tmp/compilet-1015242186.c
<br>> cc -shared -L/usr/local/lib -o /tmp/compilet-1015242186.so
<br>> /tmp/compilet-1015242186.o
<br>> NOTE: Run ./Build reconfig to change existing configuration.
<br>> Deleting Build
<br>> Removed previous script 'Build'
<br>>
<br>> Creating new 'Build' script for 'GBrowse' version '1.9971'
<br>> Now run:
<br>> ./Build test
<br>> ./Build demo (optional)
<br>> ./Build install (as superuser/administrator)
<br>> -or-
<br>> ./Build install_slave (optional, for slave installations)
<br>>
<br>> Other useful targets:
<br>> ./Build reconfig (to reconfigure install locations)
<br>> ./Build demostop (to stop the demo)
<br>>
<br>>
<br>> ####
<br>>
<br>> Doing perl Build.PL just to see, gives me:
<br>> Checking whether your kit is complete...
<br>> Looks good
<br>>
<br>> Checking prerequisites...
<br>> - ERROR: Couldn't find a $VERSION in prerequisite Bio::Graphics
<br>> - ERROR: JSON is not installed
<br>> - ERROR: Statistics::Descriptive is not installed
<br>> * Optional prerequisite Safe::World is not installed
<br>> * Optional prerequisite File::NFSLock is not installed
<br>> * Optional prerequisite DBD::Pg is not installed
<br>> * Optional prerequisite DB_File::Lock is not installed
<br>> * Optional prerequisite FCGI is not installed
<br>>
<br>> Anyway I'd like to be able to find out where it's finding/not finding
<br>> said versions
<br>> Thanks.
<br>>
<br>>
<br>> ------------------------------------------------------------------------------
<br>> Return on Information:
<br>> Google Enterprise Search pays you back
<br>> Get the facts.
<br>> <a href="http://p.sf.net/sfu/google-dev2dev" target="_top" rel="nofollow">http://p.sf.net/sfu/google-dev2dev</a><br>> _______________________________________________
<br>> Gmod-gbrowse mailing list
<br>> <a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697261&i=1" target="_top" rel="nofollow">Gmod-gbrowse@...</a>
<br>> <a href="https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse" target="_top" rel="nofollow">https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse</a><br>>
</div><br><br><br>--
<br>------------------------------------------------------------------------
<br>Scott Cain, Ph. D. scott at scottcain dot net
<br>GMOD Coordinator (<a href="http://gmod.org/" target="_top" rel="nofollow">http://gmod.org/</a>) 216-392-3087
<br>Ontario Institute for Cancer Research
<br><br>------------------------------------------------------------------------------
<br>Return on Information:
<br>Google Enterprise Search pays you back
<br>Get the facts.
<br><a href="http://p.sf.net/sfu/google-dev2dev" target="_top" rel="nofollow">http://p.sf.net/sfu/google-dev2dev</a><br>_______________________________________________
<br>Gmod-gbrowse mailing list
<br><a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26697261&i=2" target="_top" rel="nofollow">Gmod-gbrowse@...</a>
<br><a href="https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse" target="_top" rel="nofollow">https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse</a><br><p>From forum: <a href="http://old.nabble.com/gmod-gbrowse-f3500.html" embed="fixTarget[3500]" target="_top" >gmod-gbrowse</a></p>tag:old.nabble.com,2006:post-26696934gbrowse2 bioperl/bio-graphics libraries2009-12-08T08:53:16Z2009-12-08T08:53:16ZSean O'Keeffe-2Hi Folks,
<br>Is there a way to find out where gbrowse is looking for installed libraries?
<br>I'm trying to install Gbrowse2 on top of Gbrowse1.71b and keep getting
<br>errors below.
<br>(Both bioperl-live and bio-graphics have been checked out today and
<br>installed locally in /home/okeeffe where I have a local perl installed
<br>also - hence /home/okeeffe/bin/perl Build.PL)
<br><br>/home/okeeffe/bin/perl Build.PL
<br>--apachemodules=/project/gbrowse/httpd_internal/modules
<br>--cgibin=/project/gbrowse/httpd_internal/htdocs/gbrowse2/cgi-bin
<br>--conf=/project/gbrowse/httpd_internal/htdocs/gbrowse2/conf
<br>--htdocs=/project/gbrowse/httpd_internal/htdocs/gbrowse2/htdocs
<br>--databases=/project/gbrowse/httpd_internal/htdocs/gbrowse2/databases
<br>--tmp=/project/gbrowse/httpd_internal/htdocs/gbrowse2/tmp
<br>--portdemo=8080 --installconf=n --installetc=n --wwwuser=nobody
<br>--install_base=/home/okeeffe/lib/perl5
<br>Checking whether your kit is complete...
<br>Looks good
<br><br>Checking prerequisites...
<br> - ERROR: Bio::Root::Version is not installed
<br> - ERROR: Bio::Graphics is not installed
<br> * Optional prerequisite Safe::World is not installed
<br> * Optional prerequisite File::NFSLock is not installed
<br> * Optional prerequisite DBD::Pg is not installed
<br> * Optional prerequisite DB_File::Lock is not installed
<br><br>ERRORS/WARNINGS FOUND IN PREREQUISITES. You may wish to install the
<br>versions
<br>of the modules indicated above before proceeding with this installation
<br><br>cc -I/home/okeeffe/lib/perl5/5.8.8/x86_64-linux/CORE -fPIC -fpic -c
<br>-fno-strict-aliasing -pipe -Wdeclaration-after-statement
<br>-I/usr/local/include -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -O2 -o
<br>/tmp/compilet-1015242186.o /tmp/compilet-1015242186.c
<br>cc -shared -L/usr/local/lib -o /tmp/compilet-1015242186.so
<br>/tmp/compilet-1015242186.o
<br>NOTE: Run ./Build reconfig to change existing configuration.
<br>Deleting Build
<br>Removed previous script 'Build'
<br><br>Creating new 'Build' script for 'GBrowse' version '1.9971'
<br>Now run:
<br> ./Build test
<br> ./Build demo (optional)
<br> ./Build install (as superuser/administrator)
<br> -or-
<br> ./Build install_slave (optional, for slave installations)
<br><br>Other useful targets:
<br> ./Build reconfig (to reconfigure install locations)
<br> ./Build demostop (to stop the demo)
<br><br><br>####
<br><br>Doing perl Build.PL just to see, gives me:
<br>Checking whether your kit is complete...
<br>Looks good
<br><br>Checking prerequisites...
<br> - ERROR: Couldn't find a $VERSION in prerequisite Bio::Graphics
<br> - ERROR: JSON is not installed
<br> - ERROR: Statistics::Descriptive is not installed
<br> * Optional prerequisite Safe::World is not installed
<br> * Optional prerequisite File::NFSLock is not installed
<br> * Optional prerequisite DBD::Pg is not installed
<br> * Optional prerequisite DB_File::Lock is not installed
<br> * Optional prerequisite FCGI is not installed
<br><br>Anyway I'd like to be able to find out where it's finding/not finding
<br>said versions
<br>Thanks.
<br><br><br>------------------------------------------------------------------------------
<br>Return on Information:
<br>Google Enterprise Search pays you back
<br>Get the facts.
<br><a href="http://p.sf.net/sfu/google-dev2dev" target="_top" rel="nofollow">http://p.sf.net/sfu/google-dev2dev</a><br>_______________________________________________
<br>Gmod-gbrowse mailing list
<br><a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26696934&i=0" target="_top" rel="nofollow">Gmod-gbrowse@...</a>
<br><a href="https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse" target="_top" rel="nofollow">https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse</a><br><p>From forum: <a href="http://old.nabble.com/gmod-gbrowse-f3500.html" embed="fixTarget[3500]" target="_top" >gmod-gbrowse</a></p>tag:old.nabble.com,2006:post-26694263Re: Can't see BAM wiggle in GBrowse22009-12-08T05:34:05Z2009-12-08T05:34:05ZLincoln Stein-3Hi Steve,<div><br></div><div>If you have assigned multiple tracks to one BAM file, then I'm afraid you will have to upgrade Bio::SamTools from CPAN (to version 1.08). Versions 1.07 and earlier had a bug when running multiple tracks off the same file.</div>
<div><br></div><div>Lincoln<br><br><div class="gmail_quote">On Tue, Dec 8, 2009 at 8:29 AM, Steve Taylor <span dir="ltr"><<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26694263&i=0" target="_top" rel="nofollow">stephen.taylor@...</a>></span> wrote:<br>
<blockquote class="gmail_quote" style="margin:0 0 0 .8ex;border-left:1px #ccc solid;padding-left:1ex;">Hi,<br>
<br>
The attached PNG is at 50kb. You can see that there are only reads for some of the peaks. Also sometime the read glyphs are coloured white, so practically invisible. Is this a bug or a feature? <br>
Thanks again,<br>
<br>
Steve<br>
<br>
<br>
<blockquote class="gmail_quote" style="margin:0 0 0 .8ex;border-left:1px #ccc solid;padding-left:1ex"><div class="im">
What does your configuration stanza look like? The recent fixes to Bio::Graphics fix a problem in the display of the wiggles as high resolution images (SVGs) but not on the browser itself.<br>
<br>
Lincoln<br>
<br></div><div><div></div><div class="h5">
On Thu, Dec 3, 2009 at 6:42 AM, Steve Taylor <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26694263&i=1" target="_top" rel="nofollow">stephen.taylor@...</a> <mailto:<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26694263&i=2" target="_top" rel="nofollow">stephen.taylor@...</a>>> wrote:<br>
<br>
Hi,<br>
<br>
I am trying to load a bam file (bowtie.bam) into GBrowse2 (version<br>
1.995) but when I zoom into these regions in GBrowse I just get an<br>
empty track (it shows a scale but no wiggle graphic, see attached).<br>
I have also made sure the .bai file is present in the directory.<br>
<br>
There is definitely data in the bam file since if I do<br>
samtools view bowtie.bam | grep chr<br>
<br>
I get<br>
<br>
GAII02_0008:7:1:47:132#0/1 0 chr7 106395372 255<br>
51M * 0<br>
0CCAGCTACTGTACATAGGAATGACAAGGTTATAGAAAACTGCCACAACAAC BCC:B@CBA9>BBC7B<8AB?<@BB;:38>A9:%9BA>%%86AB97%;@A7 XA:i:0<br>
MD:Z:38G7G4 NM:i:2<br>
GAII02_0008:7:1:47:132#0/1 16 chr18 7926800 255 51M<br>
* 0 0<br>
GTTGTTGTGGCAGTTTTCTATAACCTTGTCATTCCTATGTACAGTAGCTGG 7A@;%79BA68%%>AB9%:9A>83:;BB@<?BA8<B7CBB>9ABC@B:CCB XA:i:0<br>
MD:Z:4C7C38 NM:i:2<br>
etc<br>
<br>
<br>
I get a couple of errors in the log:<br>
<br>
[error] Use of uninitialized value in concatenation (.) or string<br>
at<br>
/usr/lib64/perl5/site_perl/5.8.8/x86_64-linux-thread-multi/Bio/Graphics/Browser2/Render/HTML.pm<br>
line 137<br>
[error] which: no inkscape in (/sbin:/usr/sbin:/bin:/usr/bin)<br>
<br>
Which may be relevant.<br>
<br>
We have samtools 0.1.7a installed.<br>
<br>
Can anyone suggest what I could try next?<br>
<br>
Kind regards and thanks,<br>
<br>
Steve<br>
<br>
<br>
------------------------------------------------------------------------------<br>
Join us December 9, 2009 for the Red Hat Virtual Experience,<br>
a free event focused on virtualization and cloud computing.<br>
Attend in-depth sessions from your desk. Your couch. Anywhere.<br>
<a href="http://p.sf.net/sfu/redhat-sfdev2dev" target="_blank" rel="nofollow">http://p.sf.net/sfu/redhat-sfdev2dev</a><br>
_______________________________________________<br>
Gmod-gbrowse mailing list<br>
<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26694263&i=3" target="_top" rel="nofollow">Gmod-gbrowse@...</a><br></div></div>
<mailto:<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26694263&i=4" target="_top" rel="nofollow">Gmod-gbrowse@...</a>><div class="im"><br>
<a href="https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse" target="_blank" rel="nofollow">https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse</a><br>
<br>
<br>
<br>
<br>
-- <br>
Lincoln D. Stein<br>
Director, Informatics and Biocomputing Platform<br>
Ontario Institute for Cancer Research<br>
101 College St., Suite 800<br>
Toronto, ON, Canada M5G0A3<br>
416 673-8514<br></div>
Assistant: Renata Musa <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26694263&i=5" target="_top" rel="nofollow">Renata.Musa@...</a> <mailto:<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26694263&i=6" target="_top" rel="nofollow">Renata.Musa@...</a>>><br>
</blockquote>
<br>
<br>
</blockquote></div><br><br clear="all"><br>-- <br>Lincoln D. Stein<br>Director, Informatics and Biocomputing Platform<br>Ontario Institute for Cancer Research<br>101 College St., Suite 800<br>Toronto, ON, Canada M5G0A3<br>
416 673-8514<br>Assistant: Renata Musa <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26694263&i=7" target="_top" rel="nofollow">Renata.Musa@...</a>><br>
</div>
<br />------------------------------------------------------------------------------
<br>Return on Information:
<br>Google Enterprise Search pays you back
<br>Get the facts.
<br><a href="http://p.sf.net/sfu/google-dev2dev" target="_top" rel="nofollow">http://p.sf.net/sfu/google-dev2dev</a><br><br />_______________________________________________
<br>Gmod-gbrowse mailing list
<br><a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26694263&i=8" target="_top" rel="nofollow">Gmod-gbrowse@...</a>
<br><a href="https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse" target="_top" rel="nofollow">https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse</a><br><p>From forum: <a href="http://old.nabble.com/gmod-gbrowse-f3500.html" embed="fixTarget[3500]" target="_top" >gmod-gbrowse</a></p>tag:old.nabble.com,2006:post-26694399Re: Can't see BAM wiggle in GBrowse22009-12-08T05:29:45Z2009-12-08T05:29:45ZStephen Taylor-5Hi,
<br><br>The attached PNG is at 50kb. You can see that there are only reads for some of the peaks. Also sometime the read glyphs are coloured white, so practically invisible. Is this a bug or a feature?
<br><br>Thanks again,
<br><br>Steve
<br><br><div class='shrinkable-quote'><div class='shrinkable-quote'><br>> What does your configuration stanza look like? The recent fixes to
<br>> Bio::Graphics fix a problem in the display of the wiggles as high
<br>> resolution images (SVGs) but not on the browser itself.
<br>>
<br>> Lincoln
<br>>
<br>> On Thu, Dec 3, 2009 at 6:42 AM, Steve Taylor
<br>> <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26694399&i=0" target="_top" rel="nofollow">stephen.taylor@...</a> <mailto:<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26694399&i=1" target="_top" rel="nofollow">stephen.taylor@...</a>>> wrote:
<br>>
<br>> Hi,
<br>>
<br>> I am trying to load a bam file (bowtie.bam) into GBrowse2 (version
<br>> 1.995) but when I zoom into these regions in GBrowse I just get an
<br>> empty track (it shows a scale but no wiggle graphic, see attached).
<br>> I have also made sure the .bai file is present in the directory.
<br>>
<br>> There is definitely data in the bam file since if I do
<br>> samtools view bowtie.bam | grep chr
<br>>
<br>> I get
<br>>
<br>> GAII02_0008:7:1:47:132#0/1 0 chr7 106395372 255
<br>> 51M * 0
<br>> 0CCAGCTACTGTACATAGGAATGACAAGGTTATAGAAAACTGCCACAACAAC
<br>> BCC:B@CBA9>BBC7B<8AB?<@BB;:38>A9:%9BA>%%86AB97%;@A7 XA:i:0
<br>> MD:Z:38G7G4 NM:i:2
<br>> GAII02_0008:7:1:47:132#0/1 16 chr18 7926800 255 51M
<br>> * 0 0
<br>> GTTGTTGTGGCAGTTTTCTATAACCTTGTCATTCCTATGTACAGTAGCTGG
<br>> 7A@;%79BA68%%>AB9%:9A>83:;BB@<?BA8<B7CBB>9ABC@B:CCB XA:i:0
<br>> MD:Z:4C7C38 NM:i:2
<br>> etc
<br>>
<br>>
<br>> I get a couple of errors in the log:
<br>>
<br>> [error] Use of uninitialized value in concatenation (.) or string
<br>> at
<br>> /usr/lib64/perl5/site_perl/5.8.8/x86_64-linux-thread-multi/Bio/Graphics/Browser2/Render/HTML.pm
<br>> line 137
<br>> [error] which: no inkscape in (/sbin:/usr/sbin:/bin:/usr/bin)
<br>>
<br>> Which may be relevant.
<br>>
<br>> We have samtools 0.1.7a installed.
<br>>
<br>> Can anyone suggest what I could try next?
<br>>
<br>> Kind regards and thanks,
<br>>
<br>> Steve
<br>>
<br>>
<br>> ------------------------------------------------------------------------------
<br>> Join us December 9, 2009 for the Red Hat Virtual Experience,
<br>> a free event focused on virtualization and cloud computing.
<br>> Attend in-depth sessions from your desk. Your couch. Anywhere.
<br>> <a href="http://p.sf.net/sfu/redhat-sfdev2dev" target="_top" rel="nofollow">http://p.sf.net/sfu/redhat-sfdev2dev</a><br>> _______________________________________________
<br>> Gmod-gbrowse mailing list
<br>> <a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26694399&i=2" target="_top" rel="nofollow">Gmod-gbrowse@...</a>
<br>> <mailto:<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26694399&i=3" target="_top" rel="nofollow">Gmod-gbrowse@...</a>>
<br>> <a href="https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse" target="_top" rel="nofollow">https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse</a><br>>
<br>>
<br>>
<br>>
<br>> --
<br>> Lincoln D. Stein
<br>> Director, Informatics and Biocomputing Platform
<br>> Ontario Institute for Cancer Research
<br>> 101 College St., Suite 800
<br>> Toronto, ON, Canada M5G0A3
<br>> 416 673-8514
<br>> Assistant: Renata Musa <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26694399&i=4" target="_top" rel="nofollow">Renata.Musa@...</a>
<br>> <mailto:<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26694399&i=5" target="_top" rel="nofollow">Renata.Musa@...</a>>>
</div></div><br><br /> <br />------------------------------------------------------------------------------
<br>Return on Information:
<br>Google Enterprise Search pays you back
<br>Get the facts.
<br><a href="http://p.sf.net/sfu/google-dev2dev" target="_top" rel="nofollow">http://p.sf.net/sfu/google-dev2dev</a><br><br />_______________________________________________
<br>Gmod-gbrowse mailing list
<br><a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26694399&i=6" target="_top" rel="nofollow">Gmod-gbrowse@...</a>
<br><a href="https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse" target="_top" rel="nofollow">https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse</a><br><div class="small"><br/><img src="http://old.nabble.com/images/icon_attachment.gif" > <strong>reads.PNG</strong> (9K) <a href="http://old.nabble.com/attachment/26694399/0/reads.PNG" target="_top">Download Attachment</a></div><p>From forum: <a href="http://old.nabble.com/gmod-gbrowse-f3500.html" embed="fixTarget[3500]" target="_top" >gmod-gbrowse</a></p>tag:old.nabble.com,2006:post-26693872Re: Errors while installing gbrowse22009-12-08T05:26:03Z2009-12-08T05:26:03ZLincoln Stein-3Hi Wes,<div><br></div><div>You may need to use --install_base to change the location of the libraries as well:</div><div><br></div><div>perl Build.PL --apachemodules=/htdocs/apache-httpd/lib \<br> --cgibin=/htdocs/gbrowse2/cgi-bin \<br>
--conf=/htdocs/gbrowse2/conf \<br> --htdocs=/htdocs/gbrowse2/htdocs \<br> --databases=/htdocs/gbrowse2/databases \<br> --tmp=/htdocs/gbrowse2/tmp \<br> --portdemo=8080 \<br>
--installconf=n \<br> --installetc=n \<br> --wwwuser=nobody \<br></div><div> --install_base=/usr/share/gbrowse2/lib</div><div><br></div><div>When you initially start, do you have a directory named /htdocs? I'm not sure where the chcon errors are coming from - I will need to test on an SELinux system.</div>
<div><br></div><div>The .new paths are mystifying. I will try to figure this out.</div><div><br></div><div>Lincoln</div><div><br><div class="gmail_quote">On Tue, Dec 8, 2009 at 12:15 AM, Wes Barris <span dir="ltr"><<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26693872&i=0" target="_top" rel="nofollow">wes.barris@...</a>></span> wrote:<br>
<blockquote class="gmail_quote" style="margin:0 0 0 .8ex;border-left:1px #ccc solid;padding-left:1ex;">I am installing gbrowse2 on a system that is currently running gbrowse1.71b.<br>
I have checked out revision 22338 of gbrowse2. This is my Build.PL command:<br>
<br>
perl Build.PL --apachemodules=/htdocs/apache-httpd/lib \<br>
--cgibin=/htdocs/gbrowse2/cgi-bin \<br>
--conf=/htdocs/gbrowse2/conf \<br>
--htdocs=/htdocs/gbrowse2/htdocs \<br>
--databases=/htdocs/gbrowse2/databases \<br>
--tmp=/htdocs/gbrowse2/tmp \<br>
--portdemo=8080 \<br>
--installconf=n \<br>
--installetc=n \<br>
--wwwuser=nobody<br>
<br>
./Build test succeeds.<br>
<br>
The install step has some errors:<br>
<br>
sudo ./Build install uninst=1<br>
.<br>
.<br>
.<br>
*** SELinux detected -- fixing permissions ***<br>
/usr/bin/chcon: /htdocs/gbrowse2/htdocs/i: No such file or directory<br>
/usr/bin/chcon: failed to change context of /htdocs/gbrowse2/tmp to root:object_r:httpd_sys_content_rw_t: Invalid argument<br>
Use of uninitialized value in concatenation (.) or string at /usr/local/src/bioinformatics/gbrowse2/Generic-Genome-Browser/install_util/GBrowseInstall.pm line 419, <GEN173> line 28.<br>
/usr/bin/chcon: too few arguments<br>
Try `/usr/bin/chcon --help' for more information.<br>
<br>
***INSTALLATION COMPLETE***<br>
Load <a href="http://localhost/htdocs" target="_blank" rel="nofollow">http://localhost/htdocs</a> for demo and documentation<br>
<br>
I don't know whether the above errors are preventing the database<br>
directory from being created:<br>
<br>
wes@bioweb> pwd<br>
/htdocs/gbrowse2<br>
wes@bioweb> ls -la<br>
total 44<br>
drwxr-xr-x 6 wes root 4096 Dec 8 15:04 .<br>
drwxr-xr-x 20 root root 4096 Sep 28 13:33 ..<br>
drwxr-xr-x 2 root root 4096 Dec 8 15:04 cgi-bin<br>
drwxr-xr-x 6 root root 4096 Dec 8 15:04 conf<br>
drwxr-xr-x 6 root root 4096 Dec 8 15:04 htdocs<br>
drwxr-xr-x 2 nobody nobody 4096 Dec 8 15:04 tmp<br>
wes@bioweb> ls -l htdocs/i<br>
lrwxrwxrwx 1 nobody root 27 Dec 8 15:04 htdocs/i -> /htdocs/gbrowse2/tmp/images<br>
wes@bioweb> ls -dZ tmp<br>
drwxr-xr-x nobody nobody root:object_r:file_t tmp<br>
wes@bioweb><br>
<br>
Many of the config files have a '.new' extension:<br>
<br>
wes@bioweb> ls -l conf<br>
total 124<br>
-r--r--r-- 1 root root 1636 Dec 4 08:34 detail_select_menu.conf<br>
-r--r--r-- 1 root root 2711 Dec 4 08:34 enzymes.txt<br>
-r--r--r-- 1 root root 4305 Dec 4 08:34 GBrowse.conf<br>
drwxr-xr-x 2 root root 4096 Dec 8 15:04 languages<br>
-r--r--r-- 1 root root 1398 Dec 4 08:34 log4perl.conf<br>
drwxr-xr-x 2 root root 4096 Dec 8 15:04 MobyServices<br>
drwxr-xr-x 2 root root 4096 Dec 8 15:04 plugins<br>
-r--r--r-- 1 root root 3285 Dec 4 08:34 pop_demo.conf<br>
-r--r--r-- 1 root root 304 Dec 4 08:34 slave_preload.conf.new<br>
-r--r--r-- 1 root root 1822 Dec 4 08:34 submitter_plugin.conf<br>
drwxr-xr-x 2 root root 4096 Dec 8 15:04 themes<br>
-r--r--r-- 1 root root 7099 Dec 4 08:34 yeast_chr1+2.conf.new<br>
-r--r--r-- 1 root root 7165 Dec 4 08:34 yeast_renderfarm.conf.new<br>
-r--r--r-- 1 root root 3854 Dec 4 08:34 yeast_simple.conf.new<br>
<br>
Same problem with the plugins directory:<br>
<br>
wes@bioweb> ls -l conf/plugins<br>
total 336<br>
-r--r--r-- 1 root root 13442 Dec 4 08:34 Aligner.pm.new<br>
-r--r--r-- 1 root root 7680 Dec 4 08:34 AlignTwoSequences.pm.new<br>
-r--r--r-- 1 root root 5208 Dec 4 08:34 AttributeHiliter.pm.new<br>
-r--r--r-- 1 root root 9593 Dec 4 08:34 BatchDumper.pm.new<br>
-r--r--r-- 1 root root 5608 Dec 4 08:34 Blat.pm.new<br>
-r--r--r-- 1 root root 6828 Dec 4 08:34 CMapDumper.pm.new<br>
-r--r--r-- 1 root root 3678 Dec 4 08:34 CreateBlastDB.pm.new<br>
-r--r--r-- 1 root root 8532 Dec 4 08:34 FastaDumper.pm.new<br>
-r--r--r-- 1 root root 3351 Dec 4 08:34 FBTableDumper.pm.new<br>
-r--r--r-- 1 root root 3577 Dec 4 08:34 FilterTest.pm.new<br>
-r--r--r-- 1 root root 4198 Dec 4 08:34 GeneFinder.pm.new<br>
-r--r--r-- 1 root root 4938 Dec 4 08:34 OligoFinder.pm.new<br>
-r--r--r-- 1 root root 39755 Dec 4 08:34 PrimerDesigner.pm.new<br>
-r--r--r-- 1 root root 8310 Dec 4 08:34 ProteinDumper.pm.new<br>
-r--r--r-- 1 root root 3364 Dec 4 08:34 RandomGene.pm.new<br>
-r--r--r-- 1 root root 4853 Dec 4 08:34 RestrictionAnnotator.pm.new<br>
-r--r--r-- 1 root root 8529 Dec 4 08:34 SequenceDumper.pm.new<br>
-r--r--r-- 1 root root 2722 Dec 4 08:34 SimpleTrackFinder.pm.new<br>
-r--r--r-- 1 root root 2497 Dec 4 08:34 SinWave.pm.new<br>
-r--r--r-- 1 root root 4404 Dec 4 08:34 SourceTrackFinder.pm.new<br>
-r--r--r-- 1 root root 18287 Dec 4 08:34 Spectrogram.pm.new<br>
-r--r--r-- 1 root root 5363 Dec 4 08:34 Submitter.pm.new<br>
-r--r--r-- 1 root root 388 Dec 4 08:34 TestFinder.pm.new<br>
-r--r--r-- 1 root root 608 Dec 4 08:34 test.pm.new<br>
-r--r--r-- 1 root root 6422 Dec 4 08:34 TrackDumper.pm.new<br>
<br>
<br>
--<br>
Wes Barris <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26693872&i=1" target="_top" rel="nofollow">wes.barris@...</a>><br>
<br>
------------------------------------------------------------------------------<br>
Return on Information:<br>
Google Enterprise Search pays you back<br>
Get the facts.<br>
<a href="http://p.sf.net/sfu/google-dev2dev" target="_blank" rel="nofollow">http://p.sf.net/sfu/google-dev2dev</a><br>
_______________________________________________<br>
Gmod-gbrowse mailing list<br>
<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26693872&i=2" target="_top" rel="nofollow">Gmod-gbrowse@...</a><br>
<a href="https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse" target="_blank" rel="nofollow">https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse</a><br>
</blockquote></div><br><br clear="all"><br>-- <br>Lincoln D. Stein<br>Director, Informatics and Biocomputing Platform<br>Ontario Institute for Cancer Research<br>101 College St., Suite 800<br>Toronto, ON, Canada M5G0A3<br>
416 673-8514<br>Assistant: Renata Musa <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26693872&i=3" target="_top" rel="nofollow">Renata.Musa@...</a>><br>
</div>
<br />------------------------------------------------------------------------------
<br>Return on Information:
<br>Google Enterprise Search pays you back
<br>Get the facts.
<br><a href="http://p.sf.net/sfu/google-dev2dev" target="_top" rel="nofollow">http://p.sf.net/sfu/google-dev2dev</a><br><br />_______________________________________________
<br>Gmod-gbrowse mailing list
<br><a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26693872&i=4" target="_top" rel="nofollow">Gmod-gbrowse@...</a>
<br><a href="https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse" target="_top" rel="nofollow">https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse</a><br><p>From forum: <a href="http://old.nabble.com/gmod-gbrowse-f3500.html" embed="fixTarget[3500]" target="_top" >gmod-gbrowse</a></p>tag:old.nabble.com,2006:post-26688870Errors while installing gbrowse22009-12-07T21:15:28Z2009-12-07T21:15:28ZWes BarrisI am installing gbrowse2 on a system that is currently running gbrowse1.71b.
<br>I have checked out revision 22338 of gbrowse2. This is my Build.PL command:
<br><br>perl Build.PL --apachemodules=/htdocs/apache-httpd/lib \
<br> --cgibin=/htdocs/gbrowse2/cgi-bin \
<br> --conf=/htdocs/gbrowse2/conf \
<br> --htdocs=/htdocs/gbrowse2/htdocs \
<br> --databases=/htdocs/gbrowse2/databases \
<br> --tmp=/htdocs/gbrowse2/tmp \
<br> --portdemo=8080 \
<br> --installconf=n \
<br> --installetc=n \
<br> --wwwuser=nobody
<br><br>./Build test succeeds.
<br><br>The install step has some errors:
<br><br>sudo ./Build install uninst=1
<br>.
<br>.
<br>.
<br>*** SELinux detected -- fixing permissions ***
<br>/usr/bin/chcon: /htdocs/gbrowse2/htdocs/i: No such file or directory
<br>/usr/bin/chcon: failed to change context of /htdocs/gbrowse2/tmp to root:object_r:httpd_sys_content_rw_t: Invalid argument
<br>Use of uninitialized value in concatenation (.) or string at /usr/local/src/bioinformatics/gbrowse2/Generic-Genome-Browser/install_util/GBrowseInstall.pm line 419, <GEN173> line 28.
<br>/usr/bin/chcon: too few arguments
<br>Try `/usr/bin/chcon --help' for more information.
<br><br>***INSTALLATION COMPLETE***
<br>Load <a href="http://localhost/htdocs" target="_top" rel="nofollow">http://localhost/htdocs</a> for demo and documentation
<br><br>I don't know whether the above errors are preventing the database
<br>directory from being created:
<br><br>wes@bioweb> pwd
<br>/htdocs/gbrowse2
<br>wes@bioweb> ls -la
<br>total 44
<br>drwxr-xr-x 6 wes root 4096 Dec 8 15:04 .
<br>drwxr-xr-x 20 root root 4096 Sep 28 13:33 ..
<br>drwxr-xr-x 2 root root 4096 Dec 8 15:04 cgi-bin
<br>drwxr-xr-x 6 root root 4096 Dec 8 15:04 conf
<br>drwxr-xr-x 6 root root 4096 Dec 8 15:04 htdocs
<br>drwxr-xr-x 2 nobody nobody 4096 Dec 8 15:04 tmp
<br>wes@bioweb> ls -l htdocs/i
<br>lrwxrwxrwx 1 nobody root 27 Dec 8 15:04 htdocs/i -> /htdocs/gbrowse2/tmp/images
<br>wes@bioweb> ls -dZ tmp
<br>drwxr-xr-x nobody nobody root:object_r:file_t tmp
<br>wes@bioweb>
<br><br>Many of the config files have a '.new' extension:
<br><br>wes@bioweb> ls -l conf
<br>total 124
<br>-r--r--r-- 1 root root 1636 Dec 4 08:34 detail_select_menu.conf
<br>-r--r--r-- 1 root root 2711 Dec 4 08:34 enzymes.txt
<br>-r--r--r-- 1 root root 4305 Dec 4 08:34 GBrowse.conf
<br>drwxr-xr-x 2 root root 4096 Dec 8 15:04 languages
<br>-r--r--r-- 1 root root 1398 Dec 4 08:34 log4perl.conf
<br>drwxr-xr-x 2 root root 4096 Dec 8 15:04 MobyServices
<br>drwxr-xr-x 2 root root 4096 Dec 8 15:04 plugins
<br>-r--r--r-- 1 root root 3285 Dec 4 08:34 pop_demo.conf
<br>-r--r--r-- 1 root root 304 Dec 4 08:34 slave_preload.conf.new
<br>-r--r--r-- 1 root root 1822 Dec 4 08:34 submitter_plugin.conf
<br>drwxr-xr-x 2 root root 4096 Dec 8 15:04 themes
<br>-r--r--r-- 1 root root 7099 Dec 4 08:34 yeast_chr1+2.conf.new
<br>-r--r--r-- 1 root root 7165 Dec 4 08:34 yeast_renderfarm.conf.new
<br>-r--r--r-- 1 root root 3854 Dec 4 08:34 yeast_simple.conf.new
<br><br>Same problem with the plugins directory:
<br><br>wes@bioweb> ls -l conf/plugins
<br>total 336
<br>-r--r--r-- 1 root root 13442 Dec 4 08:34 Aligner.pm.new
<br>-r--r--r-- 1 root root 7680 Dec 4 08:34 AlignTwoSequences.pm.new
<br>-r--r--r-- 1 root root 5208 Dec 4 08:34 AttributeHiliter.pm.new
<br>-r--r--r-- 1 root root 9593 Dec 4 08:34 BatchDumper.pm.new
<br>-r--r--r-- 1 root root 5608 Dec 4 08:34 Blat.pm.new
<br>-r--r--r-- 1 root root 6828 Dec 4 08:34 CMapDumper.pm.new
<br>-r--r--r-- 1 root root 3678 Dec 4 08:34 CreateBlastDB.pm.new
<br>-r--r--r-- 1 root root 8532 Dec 4 08:34 FastaDumper.pm.new
<br>-r--r--r-- 1 root root 3351 Dec 4 08:34 FBTableDumper.pm.new
<br>-r--r--r-- 1 root root 3577 Dec 4 08:34 FilterTest.pm.new
<br>-r--r--r-- 1 root root 4198 Dec 4 08:34 GeneFinder.pm.new
<br>-r--r--r-- 1 root root 4938 Dec 4 08:34 OligoFinder.pm.new
<br>-r--r--r-- 1 root root 39755 Dec 4 08:34 PrimerDesigner.pm.new
<br>-r--r--r-- 1 root root 8310 Dec 4 08:34 ProteinDumper.pm.new
<br>-r--r--r-- 1 root root 3364 Dec 4 08:34 RandomGene.pm.new
<br>-r--r--r-- 1 root root 4853 Dec 4 08:34 RestrictionAnnotator.pm.new
<br>-r--r--r-- 1 root root 8529 Dec 4 08:34 SequenceDumper.pm.new
<br>-r--r--r-- 1 root root 2722 Dec 4 08:34 SimpleTrackFinder.pm.new
<br>-r--r--r-- 1 root root 2497 Dec 4 08:34 SinWave.pm.new
<br>-r--r--r-- 1 root root 4404 Dec 4 08:34 SourceTrackFinder.pm.new
<br>-r--r--r-- 1 root root 18287 Dec 4 08:34 Spectrogram.pm.new
<br>-r--r--r-- 1 root root 5363 Dec 4 08:34 Submitter.pm.new
<br>-r--r--r-- 1 root root 388 Dec 4 08:34 TestFinder.pm.new
<br>-r--r--r-- 1 root root 608 Dec 4 08:34 test.pm.new
<br>-r--r--r-- 1 root root 6422 Dec 4 08:34 TrackDumper.pm.new
<br><br><br>--
<br>Wes Barris <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26688870&i=0" target="_top" rel="nofollow">wes.barris@...</a>>
<br><br>------------------------------------------------------------------------------
<br>Return on Information:
<br>Google Enterprise Search pays you back
<br>Get the facts.
<br><a href="http://p.sf.net/sfu/google-dev2dev" target="_top" rel="nofollow">http://p.sf.net/sfu/google-dev2dev</a><br>_______________________________________________
<br>Gmod-gbrowse mailing list
<br><a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26688870&i=1" target="_top" rel="nofollow">Gmod-gbrowse@...</a>
<br><a href="https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse" target="_top" rel="nofollow">https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse</a><br><p>From forum: <a href="http://old.nabble.com/gmod-gbrowse-f3500.html" embed="fixTarget[3500]" target="_top" >gmod-gbrowse</a></p>tag:old.nabble.com,2006:post-26688766Re: gbrowse2 error when using a database2009-12-07T21:00:17Z2009-12-07T21:00:17ZWes BarrisLincoln Stein wrote:
<br>> Awfully sorry about this. I think that what's happening is that you
<br>> installed gbrowse2 on top of the gbrowse1 libraries, or vice-versa.
<br><br>I should mention that this did happen months ago when I first tried.
<br>Previously, a default gbrowse2 installation would break an existing
<br>gbrowse1 installation. However, this time, the gbrowse2 installation
<br>did not affect the existing gbrowse1 installation -- so I thought
<br>that part of it has been fixed. My existing gbrowse1.71b installation
<br>continues to run without errors.
<br><div class='shrinkable-quote'><br>> The
<br>> latest CPAN release was supposed to fix this. What I do is to install
<br>> the library to a distinct directory, and set PERL5LIB in Apache's config
<br>> to point to it.
<br>>
<br>> I'm just about to release a new-and-improved version to CPAN, and before
<br>> I do it I'm going to do a few typical installs to make sure it's not a
<br>> rocky process. Any details about the problems you encountered during the
<br>> install would be very helpful.
<br>>
<br>> Lincoln
<br>>
<br>> On Mon, Dec 7, 2009 at 8:39 PM, Wes Barris <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26688766&i=0" target="_top" rel="nofollow">wes.barris@...</a>> wrote:
<br>>
<br>> I have just installed gbrowse2 on a Linux (CentOS) system. After much
<br>> work I got the provided examples (yeast, pop_demo) to work. When I
<br>> configure a .conf file to use a mysql database the browser shows an
<br>> empty window and I see this error in the apache error log:
<br>>
<br>> [Tue Dec 08 11:28:22 2009] [error] [client 140.253.153.217] Can't
<br>> locate object method "method" via package
<br>> "Bio::DB::SeqFeature::Segment" at
<br>> /usr/lib/perl5/site_perl/5.8.5/i386-linux-thread-multi/Bio/Graphics/Karyotype.pm
<br>> line 343.
<br>>
<br>> I know that the mysql database is ok because it is part of a working
<br>> gbrowse 1.7 system.
<br>>
<br>> Here is my .conf file:
<br>>
<br>> [GENERAL]
<br>> description = Bovine Genome Assembly (UMD v3.0)
<br>> initial landmark = BTA1:50000000..50900000
<br>> examples = BTA1:50000000..50900000
<br>>
<br>> [btauUMD3:database]
<br>> db_adaptor = Bio::DB::SeqFeature::Store
<br>> db_args = -adaptor DBI::mysql
<br>> -dsn
<br>> dbi:mysql:database=btauUMD3;host=xxxxxx.xx.csiro.au
<br>> <<a href="http://xxxxxx.xx.csiro.au" target="_top" rel="nofollow">http://xxxxxx.xx.csiro.au</a>>
<br>> user = nobody
<br>> pass =
<br>>
<br>>
<br>> # Default glyph settings
<br>> [TRACK DEFAULTS]
<br>> glyph = generic
<br>> database = btauUMD3
<br>> height = 8
<br>> bgcolor = cyan
<br>> fgcolor = black
<br>> label density = 25
<br>> bump density = 100
<br>>
<br>> ### TRACK CONFIGURATION ####
<br>> # the remainder of the sections configure individual tracks
<br>>
<br>> [UMDContig]
<br>> feature = contig:umd
<br>> glyph = box
<br>> key = Genome assembly contigs (UMD)
<br>> citation = University of Maryland contigs placed on chromosomes.
<br>>
<br>>
<br>> --
<br>> Wes Barris <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26688766&i=1" target="_top" rel="nofollow">wes.barris@...</a>>
<br>>
<br>> ------------------------------------------------------------------------------
<br>> Return on Information:
<br>> Google Enterprise Search pays you back
<br>> Get the facts.
<br>> <a href="http://p.sf.net/sfu/google-dev2dev" target="_top" rel="nofollow">http://p.sf.net/sfu/google-dev2dev</a><br>> _______________________________________________
<br>> Gmod-gbrowse mailing list
<br>> <a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26688766&i=2" target="_top" rel="nofollow">Gmod-gbrowse@...</a>
<br>> <mailto:<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26688766&i=3" target="_top" rel="nofollow">Gmod-gbrowse@...</a>>
<br>> <a href="https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse" target="_top" rel="nofollow">https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse</a><br>>
<br>>
<br>>
<br>>
<br>> --
<br>> Lincoln D. Stein
<br>> Director, Informatics and Biocomputing Platform
<br>> Ontario Institute for Cancer Research
<br>> 101 College St., Suite 800
<br>> Toronto, ON, Canada M5G0A3
<br>> 416 673-8514
<br>> Assistant: Renata Musa <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26688766&i=4" target="_top" rel="nofollow">Renata.Musa@...</a>
<br>> <mailto:<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26688766&i=5" target="_top" rel="nofollow">Renata.Musa@...</a>>>
</div><br><br>--
<br>Wes Barris <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26688766&i=6" target="_top" rel="nofollow">wes.barris@...</a>>
<br><br>------------------------------------------------------------------------------
<br>Return on Information:
<br>Google Enterprise Search pays you back
<br>Get the facts.
<br><a href="http://p.sf.net/sfu/google-dev2dev" target="_top" rel="nofollow">http://p.sf.net/sfu/google-dev2dev</a><br>_______________________________________________
<br>Gmod-gbrowse mailing list
<br><a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26688766&i=7" target="_top" rel="nofollow">Gmod-gbrowse@...</a>
<br><a href="https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse" target="_top" rel="nofollow">https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse</a><br><p>From forum: <a href="http://old.nabble.com/gmod-gbrowse-f3500.html" embed="fixTarget[3500]" target="_top" >gmod-gbrowse</a></p>tag:old.nabble.com,2006:post-26688730[SPAM] As it is, she may hardly be termed as such. But Catholic Sp2009-12-07T20:56:12Z2009-12-07T20:56:12ZNgvyen MarzeEd, until mass is again daily said within these consecrated walls, and
<br>finally until San Carlos of Carmelo is again a worthier Carmel, "for the
<br>greater honor and glory of God" and the praises of His Virgin Mother
<br>once more are sung about this smiling valley where the Christian Indian
<br>children gathered the beautiful wild flowers of the blooming meadows to
<br>adorn the hallowed shrines, ere chimed the Angelus at evenings mellow
<br>glow. Chapter IX Reverend Raymond M. Mestres of Monterey Writes
<br>Historical Drama--"Fray Junipero" Beautiful among beautiful historical
<br>dramas is the mission play "Fray Junipero" written by Reverend Raymond
<br>Mestres, pastor of San Carlos Church (Capilla Real de San Carlos) of
<br>Monterey. Many men and women have undertaken to write about mission
<br>times, but we may safely assert that this good priest so unassuming in
<br>what he does, is above all qualified to handle this subject, being first
<br>of all a religious, a native of Barcelona, the Metropolis of the
<br>Province of Catalonia, which can claim Junipero Serra and so many of the
<br>early Spanish missionaries, explorers and settlers, and being too an
<br>artist and scholar in every way acquainted with the history of the
<br>missions, having made it a special study during his twenty-seven years
<br>of residence (as a priest) in four mission towns of California,
<br>twenty-one of which have been spent in that chief of mission towns,
<br>Monterey. Unbiased, careful of detail and true to history, while not
<br>wanting in artistic setting "Fray Junipero" carries the audience in Act
<br>I back to the College of Fernando, when Junipero Serra received his
<br>commission to come to California as Father Pre
<br><br /> <br />------------------------------------------------------------------------------
<br>Return on Information:
<br>Google Enterprise Search pays you back
<br>Get the facts.
<br><a href="http://p.sf.net/sfu/google-dev2dev" target="_top" rel="nofollow">http://p.sf.net/sfu/google-dev2dev</a><br><br />_______________________________________________
<br>Gmod-das2-cmts mailing list
<br><a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26688730&i=0" target="_top" rel="nofollow">Gmod-das2-cmts@...</a>
<br><a href="https://lists.sourceforge.net/lists/listinfo/gmod-das2-cmts" target="_top" rel="nofollow">https://lists.sourceforge.net/lists/listinfo/gmod-das2-cmts</a><br><div class="small"><br/><img src="http://old.nabble.com/images/icon_attachment.gif" > <strong>embrown.jpg</strong> (11K) <a href="http://old.nabble.com/attachment/26688730/0/embrown.jpg" target="_top">Download Attachment</a></div><p>From forum: <a href="http://old.nabble.com/gmod-das2-cmts-f3498.html" embed="fixTarget[3498]" target="_top" >gmod-das2-cmts</a></p>tag:old.nabble.com,2006:post-26688731Re: gbrowse2 error when using a database2009-12-07T20:55:52Z2009-12-07T20:55:52ZWes BarrisLincoln Stein wrote:
<div class='shrinkable-quote'><br>> Awfully sorry about this. I think that what's happening is that you
<br>> installed gbrowse2 on top of the gbrowse1 libraries, or vice-versa. The
<br>> latest CPAN release was supposed to fix this. What I do is to install
<br>> the library to a distinct directory, and set PERL5LIB in Apache's config
<br>> to point to it.
<br>>
<br>> I'm just about to release a new-and-improved version to CPAN, and before
<br>> I do it I'm going to do a few typical installs to make sure it's not a
<br>> rocky process. Any details about the problems you encountered during the
<br>> install would be very helpful.
</div><br>Hi Lincoln,
<br><br>I'll start a separate thread for the various installation issues that
<br>I encountered (so that they don't get lost in this thread).
<br><div class='shrinkable-quote'><br>> Lincoln
<br>>
<br>> On Mon, Dec 7, 2009 at 8:39 PM, Wes Barris <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26688731&i=0" target="_top" rel="nofollow">wes.barris@...</a>> wrote:
<br>>
<br>> I have just installed gbrowse2 on a Linux (CentOS) system. After much
<br>> work I got the provided examples (yeast, pop_demo) to work. When I
<br>> configure a .conf file to use a mysql database the browser shows an
<br>> empty window and I see this error in the apache error log:
<br>>
<br>> [Tue Dec 08 11:28:22 2009] [error] [client 140.253.153.217] Can't
<br>> locate object method "method" via package
<br>> "Bio::DB::SeqFeature::Segment" at
<br>> /usr/lib/perl5/site_perl/5.8.5/i386-linux-thread-multi/Bio/Graphics/Karyotype.pm
<br>> line 343.
<br>>
<br>> I know that the mysql database is ok because it is part of a working
<br>> gbrowse 1.7 system.
<br>>
<br>> Here is my .conf file:
<br>>
<br>> [GENERAL]
<br>> description = Bovine Genome Assembly (UMD v3.0)
<br>> initial landmark = BTA1:50000000..50900000
<br>> examples = BTA1:50000000..50900000
<br>>
<br>> [btauUMD3:database]
<br>> db_adaptor = Bio::DB::SeqFeature::Store
<br>> db_args = -adaptor DBI::mysql
<br>> -dsn
<br>> dbi:mysql:database=btauUMD3;host=xxxxxx.xx.csiro.au
<br>> <<a href="http://xxxxxx.xx.csiro.au" target="_top" rel="nofollow">http://xxxxxx.xx.csiro.au</a>>
<br>> user = nobody
<br>> pass =
<br>>
<br>>
<br>> # Default glyph settings
<br>> [TRACK DEFAULTS]
<br>> glyph = generic
<br>> database = btauUMD3
<br>> height = 8
<br>> bgcolor = cyan
<br>> fgcolor = black
<br>> label density = 25
<br>> bump density = 100
<br>>
<br>> ### TRACK CONFIGURATION ####
<br>> # the remainder of the sections configure individual tracks
<br>>
<br>> [UMDContig]
<br>> feature = contig:umd
<br>> glyph = box
<br>> key = Genome assembly contigs (UMD)
<br>> citation = University of Maryland contigs placed on chromosomes.
<br>>
<br>>
<br>> --
<br>> Wes Barris <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26688731&i=1" target="_top" rel="nofollow">wes.barris@...</a>>
<br>>
<br>> ------------------------------------------------------------------------------
<br>> Return on Information:
<br>> Google Enterprise Search pays you back
<br>> Get the facts.
<br>> <a href="http://p.sf.net/sfu/google-dev2dev" target="_top" rel="nofollow">http://p.sf.net/sfu/google-dev2dev</a><br>> _______________________________________________
<br>> Gmod-gbrowse mailing list
<br>> <a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26688731&i=2" target="_top" rel="nofollow">Gmod-gbrowse@...</a>
<br>> <mailto:<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26688731&i=3" target="_top" rel="nofollow">Gmod-gbrowse@...</a>>
<br>> <a href="https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse" target="_top" rel="nofollow">https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse</a><br>>
<br>>
<br>>
<br>>
<br>> --
<br>> Lincoln D. Stein
<br>> Director, Informatics and Biocomputing Platform
<br>> Ontario Institute for Cancer Research
<br>> 101 College St., Suite 800
<br>> Toronto, ON, Canada M5G0A3
<br>> 416 673-8514
<br>> Assistant: Renata Musa <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26688731&i=4" target="_top" rel="nofollow">Renata.Musa@...</a>
<br>> <mailto:<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26688731&i=5" target="_top" rel="nofollow">Renata.Musa@...</a>>>
</div><br><br>--
<br>Wes Barris <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26688731&i=6" target="_top" rel="nofollow">wes.barris@...</a>>
<br><br>------------------------------------------------------------------------------
<br>Return on Information:
<br>Google Enterprise Search pays you back
<br>Get the facts.
<br><a href="http://p.sf.net/sfu/google-dev2dev" target="_top" rel="nofollow">http://p.sf.net/sfu/google-dev2dev</a><br>_______________________________________________
<br>Gmod-gbrowse mailing list
<br><a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26688731&i=7" target="_top" rel="nofollow">Gmod-gbrowse@...</a>
<br><a href="https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse" target="_top" rel="nofollow">https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse</a><br><p>From forum: <a href="http://old.nabble.com/gmod-gbrowse-f3500.html" embed="fixTarget[3500]" target="_top" >gmod-gbrowse</a></p>tag:old.nabble.com,2006:post-26687664Re: gbrowse2 error when using a database2009-12-07T18:12:12Z2009-12-07T18:12:12ZLincoln Stein-3Awfully sorry about this. I think that what's happening is that you installed gbrowse2 on top of the gbrowse1 libraries, or vice-versa. The latest CPAN release was supposed to fix this. What I do is to install the library to a distinct directory, and set PERL5LIB in Apache's config to point to it.<br>
<br>I'm just about to release a new-and-improved version to CPAN, and before I do it I'm going to do a few typical installs to make sure it's not a rocky process. Any details about the problems you encountered during the install would be very helpful.<br>
<br>Lincoln<br><br><div class="gmail_quote">On Mon, Dec 7, 2009 at 8:39 PM, Wes Barris <span dir="ltr"><<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26687664&i=0" target="_top" rel="nofollow">wes.barris@...</a>></span> wrote:<br><blockquote class="gmail_quote" style="border-left: 1px solid rgb(204, 204, 204); margin: 0pt 0pt 0pt 0.8ex; padding-left: 1ex;">
I have just installed gbrowse2 on a Linux (CentOS) system. After much<br>
work I got the provided examples (yeast, pop_demo) to work. When I<br>
configure a .conf file to use a mysql database the browser shows an<br>
empty window and I see this error in the apache error log:<br>
<br>
[Tue Dec 08 11:28:22 2009] [error] [client 140.253.153.217] Can't locate object method "method" via package "Bio::DB::SeqFeature::Segment" at<br>
/usr/lib/perl5/site_perl/5.8.5/i386-linux-thread-multi/Bio/Graphics/Karyotype.pm line 343.<br>
<br>
I know that the mysql database is ok because it is part of a working<br>
gbrowse 1.7 system.<br>
<br>
Here is my .conf file:<br>
<br>
[GENERAL]<br>
description = Bovine Genome Assembly (UMD v3.0)<br>
initial landmark = BTA1:50000000..50900000<br>
examples = BTA1:50000000..50900000<br>
<br>
[btauUMD3:database]<br>
db_adaptor = Bio::DB::SeqFeature::Store<br>
db_args = -adaptor DBI::mysql<br>
-dsn dbi:mysql:database=btauUMD3;host=<a href="http://xxxxxx.xx.csiro.au" target="_blank" rel="nofollow">xxxxxx.xx.csiro.au</a><br>
user = nobody<br>
pass =<br>
<br>
<br>
# Default glyph settings<br>
[TRACK DEFAULTS]<br>
glyph = generic<br>
database = btauUMD3<br>
height = 8<br>
bgcolor = cyan<br>
fgcolor = black<br>
label density = 25<br>
bump density = 100<br>
<br>
### TRACK CONFIGURATION ####<br>
# the remainder of the sections configure individual tracks<br>
<br>
[UMDContig]<br>
feature = contig:umd<br>
glyph = box<br>
key = Genome assembly contigs (UMD)<br>
citation = University of Maryland contigs placed on chromosomes.<br>
<br>
<br>
--<br>
Wes Barris <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26687664&i=1" target="_top" rel="nofollow">wes.barris@...</a>><br>
<br>
------------------------------------------------------------------------------<br>
Return on Information:<br>
Google Enterprise Search pays you back<br>
Get the facts.<br>
<a href="http://p.sf.net/sfu/google-dev2dev" target="_blank" rel="nofollow">http://p.sf.net/sfu/google-dev2dev</a><br>
_______________________________________________<br>
Gmod-gbrowse mailing list<br>
<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26687664&i=2" target="_top" rel="nofollow">Gmod-gbrowse@...</a><br>
<a href="https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse" target="_blank" rel="nofollow">https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse</a><br>
</blockquote></div><br><br clear="all"><br>-- <br>Lincoln D. Stein<br>Director, Informatics and Biocomputing Platform<br>Ontario Institute for Cancer Research<br>101 College St., Suite 800<br>Toronto, ON, Canada M5G0A3<br>
416 673-8514<br>Assistant: Renata Musa <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26687664&i=3" target="_top" rel="nofollow">Renata.Musa@...</a>><br>
<br />------------------------------------------------------------------------------
<br>Return on Information:
<br>Google Enterprise Search pays you back
<br>Get the facts.
<br><a href="http://p.sf.net/sfu/google-dev2dev" target="_top" rel="nofollow">http://p.sf.net/sfu/google-dev2dev</a><br><br />_______________________________________________
<br>Gmod-gbrowse mailing list
<br><a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26687664&i=4" target="_top" rel="nofollow">Gmod-gbrowse@...</a>
<br><a href="https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse" target="_top" rel="nofollow">https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse</a><br><p>From forum: <a href="http://old.nabble.com/gmod-gbrowse-f3500.html" embed="fixTarget[3500]" target="_top" >gmod-gbrowse</a></p>tag:old.nabble.com,2006:post-26687627gbrowse2 error when using a database2009-12-07T17:39:52Z2009-12-07T17:39:52ZWes BarrisI have just installed gbrowse2 on a Linux (CentOS) system. After much
<br>work I got the provided examples (yeast, pop_demo) to work. When I
<br>configure a .conf file to use a mysql database the browser shows an
<br>empty window and I see this error in the apache error log:
<br><br>[Tue Dec 08 11:28:22 2009] [error] [client 140.253.153.217] Can't locate object method "method" via package "Bio::DB::SeqFeature::Segment" at
<br>/usr/lib/perl5/site_perl/5.8.5/i386-linux-thread-multi/Bio/Graphics/Karyotype.pm line 343.
<br><br>I know that the mysql database is ok because it is part of a working
<br>gbrowse 1.7 system.
<br><br>Here is my .conf file:
<br><br>[GENERAL]
<br>description = Bovine Genome Assembly (UMD v3.0)
<br>initial landmark = BTA1:50000000..50900000
<br>examples = BTA1:50000000..50900000
<br><br>[btauUMD3:database]
<br>db_adaptor = Bio::DB::SeqFeature::Store
<br>db_args = -adaptor DBI::mysql
<br> -dsn dbi:mysql:database=btauUMD3;host=xxxxxx.xx.csiro.au
<br>user = nobody
<br>pass =
<br><br><br># Default glyph settings
<br>[TRACK DEFAULTS]
<br>glyph = generic
<br>database = btauUMD3
<br>height = 8
<br>bgcolor = cyan
<br>fgcolor = black
<br>label density = 25
<br>bump density = 100
<br><br>### TRACK CONFIGURATION ####
<br># the remainder of the sections configure individual tracks
<br><br>[UMDContig]
<br>feature = contig:umd
<br>glyph = box
<br>key = Genome assembly contigs (UMD)
<br>citation = University of Maryland contigs placed on chromosomes.
<br><br><br>--
<br>Wes Barris <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26687627&i=0" target="_top" rel="nofollow">wes.barris@...</a>>
<br><br>------------------------------------------------------------------------------
<br>Return on Information:
<br>Google Enterprise Search pays you back
<br>Get the facts.
<br><a href="http://p.sf.net/sfu/google-dev2dev" target="_top" rel="nofollow">http://p.sf.net/sfu/google-dev2dev</a><br>_______________________________________________
<br>Gmod-gbrowse mailing list
<br><a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26687627&i=1" target="_top" rel="nofollow">Gmod-gbrowse@...</a>
<br><a href="https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse" target="_top" rel="nofollow">https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse</a><br><p>From forum: <a href="http://old.nabble.com/gmod-gbrowse-f3500.html" embed="fixTarget[3500]" target="_top" >gmod-gbrowse</a></p>tag:old.nabble.com,2006:post-26684306Re: cgi-bin error2009-12-07T13:15:19Z2009-12-07T13:15:19ZScott Cain-4Hi Xuning,
<br><br>GBrowse wasn't configured properly when it was installed. The first
<br>question I have is whether you want to use an Apache that you
<br>installed by hand and put in /usr/loca/apache or if you want to use
<br>the Apache that comes with the OS? If there is not a server at
<br>/usr/local/apache, then you should delete that directory, as it is
<br>confusing the install: it assumes that if you installed apache by
<br>hand, then you must want to use it to run GBrowse and will offer those
<br>directories as the default locations for files to be installed.
<br><br>For your specific questions:
<br><br>1. GBrowse parses the url portion after "gbrowse" as part of its
<br>parameter list. So in the example you gave, it will see "yeast" and
<br>look for a file named yeast.conf in the configuration directory.
<br><br>2. GBrowse is trying to make a directory, but because GBrowse wasn't
<br>properly configured, it isn't trying to make it in the correct place.
<br><br>You will need to reinstall making sure to supply the correct directory
<br>paths for your server.
<br><br>Scott
<br><br><br>On Mon, Dec 7, 2009 at 3:13 PM, Xuning Wang <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26684306&i=0" target="_top" rel="nofollow">xuning@...</a>> wrote:
<div class='shrinkable-quote'><br>> Hi:
<br>>
<br>> I installed gbrowse and can see the Welcome to the Generic Genome
<br>> Browser page. But when I created on the yeast URL
<br>> (<a href="http://localhost/cgi-bin/gbrowse/yeast" target="_top" rel="nofollow">http://localhost/cgi-bin/gbrowse/yeast</a><br>> <<a href="https://tryppro.rockefeller.edu/cgi-bin/gbrowse/yeast" target="_top" rel="nofollow">https://tryppro.rockefeller.edu/cgi-bin/gbrowse/yeast</a>>) on the page, I
<br>> got this error:
<br>>
<br>>
<br>> Internal Server Error
<br>>
<br>> The server encountered an internal error or misconfiguration and was
<br>> unable to complete your request.
<br>>
<br>> I looked at the apache log, it has errors like this:
<br>> mkdir /usr/local/apache/htdocs//gbrowse: Permission denied at
<br>> /Library/Perl/5.10.0/darwin-thread-multi-2level/Bio/Graphics/Browser.pm
<br>> line 1707, referer: <a href="http://localhost/gbrowse/" target="_top" rel="nofollow">http://localhost/gbrowse/</a><br>> [Mon Dec 07 14:55:54 2009] [error] [client 129.85.176.58] Premature end
<br>> of script headers: gbrowse, referer: <a href="http://localhost/gbrowse/" target="_top" rel="nofollow">http://localhost/gbrowse/</a><br>>
<br>> What I don't understand are:
<br>> (1) When the URL <a href="http://localhost/cgi-bin/gbrowse/yeast" target="_top" rel="nofollow">http://localhost/cgi-bin/gbrowse/yeast</a><br>> <<a href="https://tryppro.rockefeller.edu/cgi-bin/gbrowse/yeast" target="_top" rel="nofollow">https://tryppro.rockefeller.edu/cgi-bin/gbrowse/yeast</a>> is clicked, does
<br>> it mean to call the script named "yeast" in .../cgi-bin/gbrowse
<br>> directory? There is no such script and no gbrowse directory under
<br>> cgi-bin. It seems to make sense to me that it does not mean to call such
<br>> as script, since the volvox tutorial does not involve copying a cgi
<br>> script volvox to the directory either. The volvox example does not work
<br>> for me either. Could you explain how this link works?
<br>>
<br>> (2) Why the apache log indicates the program is trying to create
<br>> /usr/local/apache/htdocs//gbrowse which already exists?
<br>>
<br>> I have put a cgi script say test.cgi in ../cgi-bin/ directory and tested
<br>> it from web as <a href="http://localhost/cgi-bin/test.cgi" target="_top" rel="nofollow">http://localhost/cgi-bin/test.cgi</a> and it works fine,
<br>> indicating the apache understands the cgi-bin path.
<br>>
<br>> In any case, please suggest how to solve the problem.
<br>>
<br>> OS info:
<br>> ProductName: Mac OS X
<br>> ProductVersion: 10.6.1
<br>>
<br>> Thank you very much.
<br>>
<br>> Xuning Wang
<br>> Rockefeller Unviersity
<br>>
<br>>
<br>> ------------------------------------------------------------------------------
<br>> Join us December 9, 2009 for the Red Hat Virtual Experience,
<br>> a free event focused on virtualization and cloud computing.
<br>> Attend in-depth sessions from your desk. Your couch. Anywhere.
<br>> <a href="http://p.sf.net/sfu/redhat-sfdev2dev" target="_top" rel="nofollow">http://p.sf.net/sfu/redhat-sfdev2dev</a><br>> _______________________________________________
<br>> Gmod-gbrowse mailing list
<br>> <a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26684306&i=1" target="_top" rel="nofollow">Gmod-gbrowse@...</a>
<br>> <a href="https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse" target="_top" rel="nofollow">https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse</a><br>>
</div><br><br><br>--
<br>------------------------------------------------------------------------
<br>Scott Cain, Ph. D. scott at scottcain dot net
<br>GMOD Coordinator (<a href="http://gmod.org/" target="_top" rel="nofollow">http://gmod.org/</a>) 216-392-3087
<br>Ontario Institute for Cancer Research
<br><br>------------------------------------------------------------------------------
<br>Join us December 9, 2009 for the Red Hat Virtual Experience,
<br>a free event focused on virtualization and cloud computing.
<br>Attend in-depth sessions from your desk. Your couch. Anywhere.
<br><a href="http://p.sf.net/sfu/redhat-sfdev2dev" target="_top" rel="nofollow">http://p.sf.net/sfu/redhat-sfdev2dev</a><br>_______________________________________________
<br>Gmod-gbrowse mailing list
<br><a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26684306&i=2" target="_top" rel="nofollow">Gmod-gbrowse@...</a>
<br><a href="https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse" target="_top" rel="nofollow">https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse</a><br><p>From forum: <a href="http://old.nabble.com/gmod-gbrowse-f3500.html" embed="fixTarget[3500]" target="_top" >gmod-gbrowse</a></p>tag:old.nabble.com,2006:post-26684216Re: gbrowse22009-12-07T13:10:08Z2009-12-07T13:10:08Zmanoj-samantaMakes sense.
<br><br>Thanks again,
<br>Manoj
<br><p>From forum: <a href="http://old.nabble.com/gmod-gbrowse-f3500.html" embed="fixTarget[3500]" target="_top" >gmod-gbrowse</a></p>tag:old.nabble.com,2006:post-26684050Re: gbrowse22009-12-07T12:58:13Z2009-12-07T12:58:13ZScott Cain-4Hi Manoj,
<br><br>I don't have any control over FlyBase or WormBase, so I can't tell you
<br>what they are thinking. My observation though is that they are both
<br>run by competent people, who tend to be a little conservative, which,
<br>when you have a large user base, is a very good thing. Working a new
<br>genome browser into an existing web framework is not a trivial
<br>undertaking.
<br><br>As for JBrowse-ish features in GBrowse2: the two applications are
<br>architecturally very different, and adding something like click and
<br>drag to GBrowse2 would require even more rewiring than is already
<br>being done for the GBrowse1->GBrowse2 transition. Additionally, the
<br>first iteration of JBrowse was essentially GBrowse1 with pregenerated
<br>image tiles, so that it would work like Google Maps. That ends up
<br>being impractical for a variety of reasons.
<br><br>Scott
<br><br>On Mon, Dec 7, 2009 at 3:18 PM, manoj-samanta
<br><<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26684050&i=0" target="_top" rel="nofollow">manoj.samanta@...</a>> wrote:
<div class='shrinkable-quote'><br>>
<br>> Hi Scott,
<br>>
<br>>
<br>> Thank you for your prompt reply. I have two quick questions.
<br>>
<br>> i) Why didn't flybase and wormbase implement gbrowse2 on their own websites
<br>> yet? Are they waiting for official release?
<br>>
<br>> ii) Why didn't you guys include jbrowse-like features (drag and move) in
<br>> gbrowse2? Is it overhead issue, because gbrowse needs to deal with large
<br>> amount of data, or is it just related to number of developers being
<br>> available?
<br>>
<br>> Thank you,
<br>> Manoj
<br>>
<br>>
<br>>
<br>>
<br>>
<br>>
<br>> Scott Cain-4 wrote:
<br>>>
<br>>> Hello Manoj,
<br>>>
<br>>> No, JBrowse and GBrowse2 are different (at one point, what is now
<br>>> JBrowse was referred to as GBrowse3 though).
<br>>>
<br>>> A few sites:
<br>>>
<br>>> <a href="http://www.modencode.org/Genomes.shtml" target="_top" rel="nofollow">http://www.modencode.org/Genomes.shtml</a><br>>> <a href="http://gb2.fungalgenomes.org/gb2/gbrowse/neurospora_crassa_OR74A_7/" target="_top" rel="nofollow">http://gb2.fungalgenomes.org/gb2/gbrowse/neurospora_crassa_OR74A_7/</a><br>>>
<br>>> There are at least a few others, though the ones I am aware of are not
<br>>> public (for that matter, I'm not sure that the fungal genomes GBrowse2
<br>>> is "public", but I did find it with google).
<br>>>
<br>>> Scott
<br>>>
<br>>>
<br>>> On Mon, Dec 7, 2009 at 2:38 PM, manoj-samanta
<br>>> <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26684050&i=1" target="_top" rel="nofollow">manoj.samanta@...</a>> wrote:
<br>>>>
<br>>>> Hello all,
<br>>>>
<br>>>> Would you please direct me to few websites that implemented gbrowse2? I
<br>>>> presume it is not the same as jbrowse (<a href="http://jbrowse.org/genomes/dmel/" target="_top" rel="nofollow">http://jbrowse.org/genomes/dmel/</a>),
<br>>>> right?
<br>>>>
<br>>>> Thank you,
<br>>>> Manoj
<br>>>> --
<br>>>> View this message in context:
<br>>>> <a href="http://old.nabble.com/gbrowse2-tp26682843p26682843.html" target="_top" rel="nofollow">http://old.nabble.com/gbrowse2-tp26682843p26682843.html</a><br>>>> Sent from the gmod-gbrowse mailing list archive at Nabble.com.
<br>>>>
<br>>>>
<br>>>> ------------------------------------------------------------------------------
<br>>>> Join us December 9, 2009 for the Red Hat Virtual Experience,
<br>>>> a free event focused on virtualization and cloud computing.
<br>>>> Attend in-depth sessions from your desk. Your couch. Anywhere.
<br>>>> <a href="http://p.sf.net/sfu/redhat-sfdev2dev" target="_top" rel="nofollow">http://p.sf.net/sfu/redhat-sfdev2dev</a><br>>>> _______________________________________________
<br>>>> Gmod-gbrowse mailing list
<br>>>> <a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26684050&i=2" target="_top" rel="nofollow">Gmod-gbrowse@...</a>
<br>>>> <a href="https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse" target="_top" rel="nofollow">https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse</a><br>>>>
<br>>>
<br>>>
<br>>>
<br>>> --
<br>>> ------------------------------------------------------------------------
<br>>> Scott Cain, Ph. D. scott at scottcain
<br>>> dot net
<br>>> GMOD Coordinator (<a href="http://gmod.org/" target="_top" rel="nofollow">http://gmod.org/</a>) 216-392-3087
<br>>> Ontario Institute for Cancer Research
<br>>>
<br>>> ------------------------------------------------------------------------------
<br>>> Join us December 9, 2009 for the Red Hat Virtual Experience,
<br>>> a free event focused on virtualization and cloud computing.
<br>>> Attend in-depth sessions from your desk. Your couch. Anywhere.
<br>>> <a href="http://p.sf.net/sfu/redhat-sfdev2dev" target="_top" rel="nofollow">http://p.sf.net/sfu/redhat-sfdev2dev</a><br>>> _______________________________________________
<br>>> Gmod-gbrowse mailing list
<br>>> <a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26684050&i=3" target="_top" rel="nofollow">Gmod-gbrowse@...</a>
<br>>> <a href="https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse" target="_top" rel="nofollow">https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse</a><br>>>
<br>>>
<br>>
<br>> --
<br>> View this message in context: <a href="http://old.nabble.com/gbrowse2-tp26682843p26683446.html" target="_top" rel="nofollow">http://old.nabble.com/gbrowse2-tp26682843p26683446.html</a><br>> Sent from the gmod-gbrowse mailing list archive at Nabble.com.
<br>>
<br>>
<br>> ------------------------------------------------------------------------------
<br>> Join us December 9, 2009 for the Red Hat Virtual Experience,
<br>> a free event focused on virtualization and cloud computing.
<br>> Attend in-depth sessions from your desk. Your couch. Anywhere.
<br>> <a href="http://p.sf.net/sfu/redhat-sfdev2dev" target="_top" rel="nofollow">http://p.sf.net/sfu/redhat-sfdev2dev</a><br>> _______________________________________________
<br>> Gmod-gbrowse mailing list
<br>> <a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26684050&i=4" target="_top" rel="nofollow">Gmod-gbrowse@...</a>
<br>> <a href="https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse" target="_top" rel="nofollow">https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse</a><br>>
</div><br><br><br>--
<br>------------------------------------------------------------------------
<br>Scott Cain, Ph. D. scott at scottcain dot net
<br>GMOD Coordinator (<a href="http://gmod.org/" target="_top" rel="nofollow">http://gmod.org/</a>) 216-392-3087
<br>Ontario Institute for Cancer Research
<br><br>------------------------------------------------------------------------------
<br>Join us December 9, 2009 for the Red Hat Virtual Experience,
<br>a free event focused on virtualization and cloud computing.
<br>Attend in-depth sessions from your desk. Your couch. Anywhere.
<br><a href="http://p.sf.net/sfu/redhat-sfdev2dev" target="_top" rel="nofollow">http://p.sf.net/sfu/redhat-sfdev2dev</a><br>_______________________________________________
<br>Gmod-gbrowse mailing list
<br><a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26684050&i=5" target="_top" rel="nofollow">Gmod-gbrowse@...</a>
<br><a href="https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse" target="_top" rel="nofollow">https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse</a><br><p>From forum: <a href="http://old.nabble.com/gmod-gbrowse-f3500.html" embed="fixTarget[3500]" target="_top" >gmod-gbrowse</a></p>tag:old.nabble.com,2006:post-26683446Re: gbrowse22009-12-07T12:18:46Z2009-12-07T12:18:46Zmanoj-samantaHi Scott,
<br><br><br>Thank you for your prompt reply. I have two quick questions.
<br><br>i) Why didn't flybase and wormbase implement gbrowse2 on their own websites yet? Are they waiting for official release?
<br><br>ii) Why didn't you guys include jbrowse-like features (drag and move) in gbrowse2? Is it overhead issue, because gbrowse needs to deal with large amount of data, or is it just related to number of developers being available?
<br><br>Thank you,
<br>Manoj
<br><br><br><br><br><br><blockquote class="quote light-black dark-border-color"><div class="quote light-border-color">
<div class="quote-author" style="font-weight: bold;">Scott Cain-4 wrote:</div>
<div class="quote-message shrinkable-quote">Hello Manoj,
<br><br>No, JBrowse and GBrowse2 are different (at one point, what is now
<br>JBrowse was referred to as GBrowse3 though).
<br><br>A few sites:
<br><br><a href="http://www.modencode.org/Genomes.shtml" target="_top" rel="nofollow">http://www.modencode.org/Genomes.shtml</a><br><a href="http://gb2.fungalgenomes.org/gb2/gbrowse/neurospora_crassa_OR74A_7/" target="_top" rel="nofollow">http://gb2.fungalgenomes.org/gb2/gbrowse/neurospora_crassa_OR74A_7/</a><br><br>There are at least a few others, though the ones I am aware of are not
<br>public (for that matter, I'm not sure that the fungal genomes GBrowse2
<br>is "public", but I did find it with google).
<br><br>Scott
<br><br><br>On Mon, Dec 7, 2009 at 2:38 PM, manoj-samanta
<br><manoj.samanta@systemix.org> wrote:
<br>>
<br>> Hello all,
<br>>
<br>> Would you please direct me to few websites that implemented gbrowse2? I
<br>> presume it is not the same as jbrowse (<a href="http://jbrowse.org/genomes/dmel/" target="_top" rel="nofollow">http://jbrowse.org/genomes/dmel/</a>),
<br>> right?
<br>>
<br>> Thank you,
<br>> Manoj
<br>> --
<br>> View this message in context: <a href="http://old.nabble.com/gbrowse2-tp26682843p26682843.html" target="_top" rel="nofollow">http://old.nabble.com/gbrowse2-tp26682843p26682843.html</a><br>> Sent from the gmod-gbrowse mailing list archive at Nabble.com.
<br>>
<br>>
<br>> ------------------------------------------------------------------------------
<br>> Join us December 9, 2009 for the Red Hat Virtual Experience,
<br>> a free event focused on virtualization and cloud computing.
<br>> Attend in-depth sessions from your desk. Your couch. Anywhere.
<br>> <a href="http://p.sf.net/sfu/redhat-sfdev2dev" target="_top" rel="nofollow">http://p.sf.net/sfu/redhat-sfdev2dev</a><br>> _______________________________________________
<br>> Gmod-gbrowse mailing list
<br>> Gmod-gbrowse@lists.sourceforge.net
<br>> <a href="https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse" target="_top" rel="nofollow">https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse</a><br>>
<br><br><br><br>--
<br>------------------------------------------------------------------------
<br>Scott Cain, Ph. D. scott at scottcain dot net
<br>GMOD Coordinator (<a href="http://gmod.org/" target="_top" rel="nofollow">http://gmod.org/</a>) 216-392-3087
<br>Ontario Institute for Cancer Research
<br><br>------------------------------------------------------------------------------
<br>Join us December 9, 2009 for the Red Hat Virtual Experience,
<br>a free event focused on virtualization and cloud computing.
<br>Attend in-depth sessions from your desk. Your couch. Anywhere.
<br><a href="http://p.sf.net/sfu/redhat-sfdev2dev" target="_top" rel="nofollow">http://p.sf.net/sfu/redhat-sfdev2dev</a><br>_______________________________________________
<br>Gmod-gbrowse mailing list
<br>Gmod-gbrowse@lists.sourceforge.net
<br><a href="https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse" target="_top" rel="nofollow">https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse</a></div>
</div></blockquote>
<p>From forum: <a href="http://old.nabble.com/gmod-gbrowse-f3500.html" embed="fixTarget[3500]" target="_top" >gmod-gbrowse</a></p>tag:old.nabble.com,2006:post-26683935cgi-bin error2009-12-07T12:13:38Z2009-12-07T12:13:38ZXuning WangHi:
<br><br>I installed gbrowse and can see the Welcome to the Generic Genome
<br>Browser page. But when I created on the yeast URL
<br>(<a href="http://localhost/cgi-bin/gbrowse/yeast" target="_top" rel="nofollow">http://localhost/cgi-bin/gbrowse/yeast</a>
<br><<a href="https://tryppro.rockefeller.edu/cgi-bin/gbrowse/yeast" target="_top" rel="nofollow">https://tryppro.rockefeller.edu/cgi-bin/gbrowse/yeast</a>>) on the page, I
<br>got this error:
<br><br><br> Internal Server Error
<br><br>The server encountered an internal error or misconfiguration and was
<br>unable to complete your request.
<br><br>I looked at the apache log, it has errors like this:
<br>mkdir /usr/local/apache/htdocs//gbrowse: Permission denied at
<br>/Library/Perl/5.10.0/darwin-thread-multi-2level/Bio/Graphics/Browser.pm
<br>line 1707, referer: <a href="http://localhost/gbrowse/" target="_top" rel="nofollow">http://localhost/gbrowse/</a><br>[Mon Dec 07 14:55:54 2009] [error] [client 129.85.176.58] Premature end
<br>of script headers: gbrowse, referer: <a href="http://localhost/gbrowse/" target="_top" rel="nofollow">http://localhost/gbrowse/</a><br><br>What I don't understand are:
<br>(1) When the URL <a href="http://localhost/cgi-bin/gbrowse/yeast" target="_top" rel="nofollow">http://localhost/cgi-bin/gbrowse/yeast</a>
<br><<a href="https://tryppro.rockefeller.edu/cgi-bin/gbrowse/yeast" target="_top" rel="nofollow">https://tryppro.rockefeller.edu/cgi-bin/gbrowse/yeast</a>> is clicked, does
<br>it mean to call the script named "yeast" in .../cgi-bin/gbrowse
<br>directory? There is no such script and no gbrowse directory under
<br>cgi-bin. It seems to make sense to me that it does not mean to call such
<br>as script, since the volvox tutorial does not involve copying a cgi
<br>script volvox to the directory either. The volvox example does not work
<br>for me either. Could you explain how this link works?
<br><br>(2) Why the apache log indicates the program is trying to create
<br>/usr/local/apache/htdocs//gbrowse which already exists?
<br><br>I have put a cgi script say test.cgi in ../cgi-bin/ directory and tested
<br>it from web as <a href="http://localhost/cgi-bin/test.cgi" target="_top" rel="nofollow">http://localhost/cgi-bin/test.cgi</a> and it works fine,
<br>indicating the apache understands the cgi-bin path.
<br><br>In any case, please suggest how to solve the problem.
<br><br>OS info:
<br>ProductName: Mac OS X
<br>ProductVersion: 10.6.1
<br><br>Thank you very much.
<br><br>Xuning Wang
<br>Rockefeller Unviersity
<br><br><br>------------------------------------------------------------------------------
<br>Join us December 9, 2009 for the Red Hat Virtual Experience,
<br>a free event focused on virtualization and cloud computing.
<br>Attend in-depth sessions from your desk. Your couch. Anywhere.
<br><a href="http://p.sf.net/sfu/redhat-sfdev2dev" target="_top" rel="nofollow">http://p.sf.net/sfu/redhat-sfdev2dev</a><br>_______________________________________________
<br>Gmod-gbrowse mailing list
<br><a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26683935&i=0" target="_top" rel="nofollow">Gmod-gbrowse@...</a>
<br><a href="https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse" target="_top" rel="nofollow">https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse</a><br><p>From forum: <a href="http://old.nabble.com/gmod-gbrowse-f3500.html" embed="fixTarget[3500]" target="_top" >gmod-gbrowse</a></p>tag:old.nabble.com,2006:post-26683009Re: gbrowse22009-12-07T11:49:59Z2009-12-07T11:49:59ZScott Cain-4Hello Manoj,
<br><br>No, JBrowse and GBrowse2 are different (at one point, what is now
<br>JBrowse was referred to as GBrowse3 though).
<br><br>A few sites:
<br><br><a href="http://www.modencode.org/Genomes.shtml" target="_top" rel="nofollow">http://www.modencode.org/Genomes.shtml</a><br><a href="http://gb2.fungalgenomes.org/gb2/gbrowse/neurospora_crassa_OR74A_7/" target="_top" rel="nofollow">http://gb2.fungalgenomes.org/gb2/gbrowse/neurospora_crassa_OR74A_7/</a><br><br>There are at least a few others, though the ones I am aware of are not
<br>public (for that matter, I'm not sure that the fungal genomes GBrowse2
<br>is "public", but I did find it with google).
<br><br>Scott
<br><br><br>On Mon, Dec 7, 2009 at 2:38 PM, manoj-samanta
<br><<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26683009&i=0" target="_top" rel="nofollow">manoj.samanta@...</a>> wrote:
<div class='shrinkable-quote'><br>>
<br>> Hello all,
<br>>
<br>> Would you please direct me to few websites that implemented gbrowse2? I
<br>> presume it is not the same as jbrowse (<a href="http://jbrowse.org/genomes/dmel/" target="_top" rel="nofollow">http://jbrowse.org/genomes/dmel/</a>),
<br>> right?
<br>>
<br>> Thank you,
<br>> Manoj
<br>> --
<br>> View this message in context: <a href="http://old.nabble.com/gbrowse2-tp26682843p26682843.html" target="_top" rel="nofollow">http://old.nabble.com/gbrowse2-tp26682843p26682843.html</a><br>> Sent from the gmod-gbrowse mailing list archive at Nabble.com.
<br>>
<br>>
<br>> ------------------------------------------------------------------------------
<br>> Join us December 9, 2009 for the Red Hat Virtual Experience,
<br>> a free event focused on virtualization and cloud computing.
<br>> Attend in-depth sessions from your desk. Your couch. Anywhere.
<br>> <a href="http://p.sf.net/sfu/redhat-sfdev2dev" target="_top" rel="nofollow">http://p.sf.net/sfu/redhat-sfdev2dev</a><br>> _______________________________________________
<br>> Gmod-gbrowse mailing list
<br>> <a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26683009&i=1" target="_top" rel="nofollow">Gmod-gbrowse@...</a>
<br>> <a href="https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse" target="_top" rel="nofollow">https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse</a><br>>
</div><br><br><br>--
<br>------------------------------------------------------------------------
<br>Scott Cain, Ph. D. scott at scottcain dot net
<br>GMOD Coordinator (<a href="http://gmod.org/" target="_top" rel="nofollow">http://gmod.org/</a>) 216-392-3087
<br>Ontario Institute for Cancer Research
<br><br>------------------------------------------------------------------------------
<br>Join us December 9, 2009 for the Red Hat Virtual Experience,
<br>a free event focused on virtualization and cloud computing.
<br>Attend in-depth sessions from your desk. Your couch. Anywhere.
<br><a href="http://p.sf.net/sfu/redhat-sfdev2dev" target="_top" rel="nofollow">http://p.sf.net/sfu/redhat-sfdev2dev</a><br>_______________________________________________
<br>Gmod-gbrowse mailing list
<br><a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26683009&i=2" target="_top" rel="nofollow">Gmod-gbrowse@...</a>
<br><a href="https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse" target="_top" rel="nofollow">https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse</a><br><p>From forum: <a href="http://old.nabble.com/gmod-gbrowse-f3500.html" embed="fixTarget[3500]" target="_top" >gmod-gbrowse</a></p>tag:old.nabble.com,2006:post-26682980Re: gbrowse22009-12-07T11:49:36Z2009-12-07T11:49:36Zmanoj-samantaGot my answer -
<br><br><a href="http://modencode.oicr.on.ca/cgi-bin/gb2/gbrowse/worm/" target="_top" rel="nofollow">http://modencode.oicr.on.ca/cgi-bin/gb2/gbrowse/worm/</a><br><br><a href="http://modencode.oicr.on.ca/cgi-bin/gb2/gbrowse/fly/" target="_top" rel="nofollow">http://modencode.oicr.on.ca/cgi-bin/gb2/gbrowse/fly/</a><br><br>Anything else?<p>From forum: <a href="http://old.nabble.com/gmod-gbrowse-f3500.html" embed="fixTarget[3500]" target="_top" >gmod-gbrowse</a></p>tag:old.nabble.com,2006:post-26682843gbrowse22009-12-07T11:38:52Z2009-12-07T11:38:52Zmanoj-samantaHello all,
<br><br>Would you please direct me to few websites that implemented gbrowse2? I presume it is not the same as jbrowse (<a href="http://jbrowse.org/genomes/dmel/" target="_top" rel="nofollow">http://jbrowse.org/genomes/dmel/</a>), right?
<br><br>Thank you,
<br>Manoj<p>From forum: <a href="http://old.nabble.com/gmod-gbrowse-f3500.html" embed="fixTarget[3500]" target="_top" >gmod-gbrowse</a></p>tag:old.nabble.com,2006:post-26681904SF.net SVN: gmod:[22334] schema/trunk/chado/MANIFEST2009-12-07T10:37:06Z2009-12-07T10:37:06ZscottcainRevision: 22334
<br> <a href="http://gmod.svn.sourceforge.net/gmod/?rev=22334&view=rev" target="_top" rel="nofollow">http://gmod.svn.sourceforge.net/gmod/?rev=22334&view=rev</a><br>Author: scottcain
<br>Date: 2009-12-07 18:37:06 +0000 (Mon, 07 Dec 2009)
<br><br>Log Message:
<br>-----------
<br>Removing gmod_load_gff3.pl (the cdbi loader) from the MANIFEST
<br><br>Modified Paths:
<br>--------------
<br> schema/trunk/chado/MANIFEST
<br><br>Modified: schema/trunk/chado/MANIFEST
<br>===================================================================
<br>--- schema/trunk/chado/MANIFEST 2009-12-07 16:40:55 UTC (rev 22333)
<br>+++ schema/trunk/chado/MANIFEST 2009-12-07 18:37:06 UTC (rev 22334)
<br>@@ -170,7 +170,7 @@
<br> lib/Bio/GMOD/SeqUtils.pm
<br> LICENSE
<br> load/bin/bulk_load_gff3.PLS
<br>-load/bin/load_gff3.PLS
<br>+#load/bin/load_gff3.PLS
<br> load/Build.PL
<br> load/etc/chap.obo
<br> load/etc/extra.sql
<br><br><br>This was sent by the SourceForge.net collaborative development platform, the world's largest Open Source development site.
<br><br>------------------------------------------------------------------------------
<br>Join us December 9, 2009 for the Red Hat Virtual Experience,
<br>a free event focused on virtualization and cloud computing.
<br>Attend in-depth sessions from your desk. Your couch. Anywhere.
<br><a href="http://p.sf.net/sfu/redhat-sfdev2dev" target="_top" rel="nofollow">http://p.sf.net/sfu/redhat-sfdev2dev</a><br>_______________________________________________
<br>Gmod-schema-cmts mailing list
<br><a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26681904&i=0" target="_top" rel="nofollow">Gmod-schema-cmts@...</a>
<br><a href="https://lists.sourceforge.net/lists/listinfo/gmod-schema-cmts" target="_top" rel="nofollow">https://lists.sourceforge.net/lists/listinfo/gmod-schema-cmts</a><br><p>From forum: <a href="http://old.nabble.com/gmod-schema-cmts-f3507.html" embed="fixTarget[3507]" target="_top" >gmod-schema-cmts</a></p>tag:old.nabble.com,2006:post-26680005Re: GBrowse2 - intermittently truncated read track for NGS data2009-12-07T08:46:12Z2009-12-07T08:46:12ZLincoln Stein-3Hi Scott, et al.,<div><br></div><div>There is indeed a bug in the previous Bio-SamTools distribution that causes database reads to fail when the same database is open on multiple tracks. Please upgrade to Bio-SamTools 1.08 if you have this problem.</div>
<div><br></div><div>Lincoln<br><br><div class="gmail_quote">On Sun, Dec 6, 2009 at 5:33 PM, Lincoln Stein <span dir="ltr"><<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26680005&i=0" target="_top" rel="nofollow">lincoln.stein@...</a>></span> wrote:<br><blockquote class="gmail_quote" style="margin:0 0 0 .8ex;border-left:1px #ccc solid;padding-left:1ex;">
Hi Scott,<div><br></div><div>Your truncation problems have now unexpectedly appeared on my local version of GBrowse. Are you still free of the problem?</div><div><br></div><div><font color="#888888">Lincoln</font><div><div>
</div><div class="h5"><br><br><div class="gmail_quote">On Mon, Nov 16, 2009 at 10:05 AM, Scott Perry <span dir="ltr"><<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26680005&i=1" target="_top" rel="nofollow">scperry@...</a>></span> wrote:<br>
<blockquote class="gmail_quote" style="margin:0 0 0 .8ex;border-left:1px #ccc solid;padding-left:1ex">Hi Lincoln,<br><br>I did not make any changes to the BAM locations, and I'm not accessing anything via NFS. I just remembered that I do have a second (older) version of Bioperl installed as a component of the Ensembl perl API. If I wasn't careful the first time around, I might have run through part of the GBrowse install process with the older Bioperl location prepended to PERL5LIB. I suspect that this might explain the truncated tracks. It has been a few days without seeing the issue, so I think all is well.<br>
<br>Thanks again,<br><font color="#888888"><br>-Scott</font><div><div></div><div><br><br><br><div class="gmail_quote">On Mon, Nov 16, 2009 at 10:31 AM, Lincoln Stein <span dir="ltr"><<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26680005&i=2" target="_top" rel="nofollow">lincoln.stein@...</a>></span> wrote:<br>
<blockquote class="gmail_quote" style="border-left:1px solid rgb(204, 204, 204);margin:0pt 0pt 0pt 0.8ex;padding-left:1ex">Hi Scott,<br><br>Glad to hear it's working now. Did anything else change, such as the location of the BAM files or the way an NFS-mounted filesystem is mounted? Please let me know if the mysterious problem reappears.<br>
<font color="#888888">
<br>Lincoln</font><div><div></div><div><br><br><div class="gmail_quote">On Sat, Nov 14, 2009 at 2:18 PM, Scott Perry <span dir="ltr"><<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26680005&i=3" target="_top" rel="nofollow">scperry@...</a>></span> wrote:<br>
<blockquote class="gmail_quote" style="border-left:1px solid rgb(204, 204, 204);margin:0pt 0pt 0pt 0.8ex;padding-left:1ex">
Hi Lincoln,<br>
<br>
Thank you for the patch files. I tried reverting to my old config files in order to capture the debugging info, and the mysterious track truncations seemed to have disappeared. I even added several duplicate BAM-related tracks and attempted to induce the issue, but everything seems to be working ok now. I reinstalled Bioperl and GBrowse yesterday, and it might have fixed the underlying issue.<br>
<br>
If the problem recurs, I'll apply the patches and get back to you with the debugging logs.<br>
<br>
Thanks again,<br>
<br>
-Scott<br>
<br>
Lincoln Stein wrote:<br>
<blockquote class="gmail_quote" style="border-left:1px solid rgb(204, 204, 204);margin:0pt 0pt 0pt 0.8ex;padding-left:1ex"><div>
Hi Scott,<br>
<br>
Please find enclosed two patch files. One is for Bio::SamTools and the other is for GBrowse2. Both were generated from recent svn's and should go in cleanly.<br>
<br>
These will turn on a small number of debugging statements that should help me pinpoint at what level in the code the truncation is occurring. Please run the browser until the truncation problem occurs and send me a representative set of log file entries from a case where it doesn't truncate and another representative from when it does.<br>
<br>
Thanks for your willingness to help with this.<br>
<br>
Lincoln<br>
<br></div><div><div></div><div>
On Thu, Nov 12, 2009 at 1:32 AM, Scott Perry <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26680005&i=4" target="_top" rel="nofollow">scperry@...</a> <mailto:<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26680005&i=5" target="_top" rel="nofollow">scperry@...</a>>> wrote:<br>
<br>
Hello,<br>
<br>
I recently installed GBrowse2, Bio::DB:Sam, and Samtools from svn,<br>
and I have noticed an intermittent issue with the read-related tracks.<br>
<br>
When I try to view a BWA-generated alignment in GBrowse, the read<br>
track and read coverage tracks are occasionally truncated (see<br>
attachment). No errors show up in the Apache error log, although I<br>
have noticed a few gbrowse-related segfaults in /var/log/messages.<br>
GBrowse does not appear to segfault every time the tracks appear<br>
truncated, though.<br>
<br>
I added an additional read track to my config to illustrate the<br>
problem. Sometimes the tracks appear in their entirety, while<br>
subsequent clicks on the 'search' button will eventually lead to<br>
the appearance of partial tracks..<br>
<br>
The problem occurs more often when viewing a region of about<br>
20,000bp or greater, although I have seen it occur in smaller<br>
regions as well.<br>
<br>
Is there any sort of debugging mode that I can enable in order to<br>
isolate the problem?<br>
<br>
Thanks,<br>
<br>
-Scott<br>
<br>
------------------------------------------------------------------------------<br>
Let Crystal Reports handle the reporting - Free Crystal Reports<br>
2008 30-Day<br>
trial. Simplify your report design, integration and deployment -<br>
and focus on<br>
what you do best, core application coding. Discover what's new with<br>
Crystal Reports now. <a href="http://p.sf.net/sfu/bobj-july" target="_blank" rel="nofollow">http://p.sf.net/sfu/bobj-july</a><br>
_______________________________________________<br>
Gmod-gbrowse mailing list<br>
<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26680005&i=6" target="_top" rel="nofollow">Gmod-gbrowse@...</a><br></div></div>
<mailto:<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26680005&i=7" target="_top" rel="nofollow">Gmod-gbrowse@...</a>><div><br>
<a href="https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse" target="_blank" rel="nofollow">https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse</a><br>
<br>
<br>
<br>
<br>
-- <br>
Lincoln D. Stein<br>
Director, Informatics and Biocomputing Platform<br>
Ontario Institute for Cancer Research<br>
101 College St., Suite 800<br>
Toronto, ON, Canada M5G0A3<br>
416 673-8514<br></div>
Assistant: Renata Musa <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26680005&i=8" target="_top" rel="nofollow">Renata.Musa@...</a> <mailto:<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26680005&i=9" target="_top" rel="nofollow">Renata.Musa@...</a>>><br>
</blockquote>
<br>
</blockquote></div><br><br clear="all"><br>-- <br>Lincoln D. Stein<br>Director, Informatics and Biocomputing Platform<br>Ontario Institute for Cancer Research<br>101 College St., Suite 800<br>Toronto, ON, Canada M5G0A3<br>
416 673-8514<br>Assistant: Renata Musa <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26680005&i=10" target="_top" rel="nofollow">Renata.Musa@...</a>><br>
</div></div></blockquote></div><br>
</div></div></blockquote></div><br><br clear="all"><br>-- <br>Lincoln D. Stein<br>Director, Informatics and Biocomputing Platform<br>Ontario Institute for Cancer Research<br>101 College St., Suite 800<br>Toronto, ON, Canada M5G0A3<br>
416 673-8514<br>Assistant: Renata Musa <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26680005&i=11" target="_top" rel="nofollow">Renata.Musa@...</a>><br>
</div></div></div>
</blockquote></div><br><br clear="all"><br>-- <br>Lincoln D. Stein<br>Director, Informatics and Biocomputing Platform<br>Ontario Institute for Cancer Research<br>101 College St., Suite 800<br>Toronto, ON, Canada M5G0A3<br>
416 673-8514<br>Assistant: Renata Musa <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26680005&i=12" target="_top" rel="nofollow">Renata.Musa@...</a>><br>
</div>
<br />------------------------------------------------------------------------------
<br>Join us December 9, 2009 for the Red Hat Virtual Experience,
<br>a free event focused on virtualization and cloud computing.
<br>Attend in-depth sessions from your desk. Your couch. Anywhere.
<br><a href="http://p.sf.net/sfu/redhat-sfdev2dev" target="_top" rel="nofollow">http://p.sf.net/sfu/redhat-sfdev2dev</a><br />_______________________________________________
<br>Gmod-gbrowse mailing list
<br><a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26680005&i=13" target="_top" rel="nofollow">Gmod-gbrowse@...</a>
<br><a href="https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse" target="_top" rel="nofollow">https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse</a><br><p>From forum: <a href="http://old.nabble.com/gmod-gbrowse-f3500.html" embed="fixTarget[3500]" target="_top" >gmod-gbrowse</a></p>tag:old.nabble.com,2006:post-26675022be increased to two inches, and a single mat only will be req2009-12-07T02:00:38Z2009-12-07T02:00:38ZHayslip-2Observing that when you increase one lining to have the dung in
<br>readiness for the next; each lining not being calculated to last more
<br>than a month or five weeks; though the back one will not want renewing
<br>quite so often as the front. When you apply the second front lining, it
<br>will be necessary to bore the bed with a hedge-stake or mop-stick,
<br>making five holes to a three-light box; that is, one under each hill,
<br>and two under the bars: bore them straight rather better than half way
<br>up the bed, so that when the second back lining is applied, holes may
<br><br /> <br />------------------------------------------------------------------------------
<br>Join us December 9, 2009 for the Red Hat Virtual Experience,
<br>a free event focused on virtualization and cloud computing.
<br>Attend in-depth sessions from your desk. Your couch. Anywhere.
<br><a href="http://p.sf.net/sfu/redhat-sfdev2dev" target="_top" rel="nofollow">http://p.sf.net/sfu/redhat-sfdev2dev</a><br />_______________________________________________
<br>Gmod-schema-cmts mailing list
<br><a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26675022&i=0" target="_top" rel="nofollow">Gmod-schema-cmts@...</a>
<br><a href="https://lists.sourceforge.net/lists/listinfo/gmod-schema-cmts" target="_top" rel="nofollow">https://lists.sourceforge.net/lists/listinfo/gmod-schema-cmts</a><br><div class="small"><br/><img src="http://old.nabble.com/images/icon_attachment.gif" > <strong>interlocking.jpg</strong> (12K) <a href="http://old.nabble.com/attachment/26675022/0/interlocking.jpg" target="_top">Download Attachment</a></div><p>From forum: <a href="http://old.nabble.com/gmod-schema-cmts-f3507.html" embed="fixTarget[3507]" target="_top" >gmod-schema-cmts</a></p>tag:old.nabble.com,2006:post-26674579SAM reads2009-12-07T01:20:05Z2009-12-07T01:20:05ZKeiran Raine<html><body style="word-wrap: break-word; -webkit-nbsp-mode: space; -webkit-line-break: after-white-space; ">Hi,<div><br></div><div>Is there an option to only show the sequence for a base in the read where it <span class="Apple-style-span" style="text-decoration: underline;">does not</span> match the reference? I was thinking that this may improve performance at high resolution when you have a high read depth.</div><div><br></div><div>Regards,<br><div apple-content-edited="true"><span class="Apple-style-span" style="border-collapse: separate; color: rgb(0, 0, 0); font-family: Helvetica; font-size: 12px; font-style: normal; font-variant: normal; font-weight: normal; letter-spacing: normal; line-height: normal; orphans: 2; text-align: auto; text-indent: 0px; text-transform: none; white-space: normal; widows: 2; word-spacing: 0px; -webkit-border-horizontal-spacing: 0px; -webkit-border-vertical-spacing: 0px; -webkit-text-decorations-in-effect: none; -webkit-text-size-adjust: auto; -webkit-text-stroke-width: 0; "><div style="word-wrap: break-word; -webkit-nbsp-mode: space; -webkit-line-break: after-white-space; "><span class="Apple-style-span" style="border-collapse: separate; color: rgb(0, 0, 0); font-family: Helvetica; font-size: 12px; font-style: normal; font-variant: normal; font-weight: normal; letter-spacing: normal; line-height: normal; orphans: 2; text-indent: 0px; text-transform: none; white-space: normal; widows: 2; word-spacing: 0px; -webkit-border-horizontal-spacing: 0px; -webkit-border-vertical-spacing: 0px; -webkit-text-decorations-in-effect: none; -webkit-text-size-adjust: auto; -webkit-text-stroke-width: 0px; "><div style="word-wrap: break-word; -webkit-nbsp-mode: space; -webkit-line-break: after-white-space; "><span class="Apple-style-span" style="border-collapse: separate; color: rgb(0, 0, 0); font-family: Helvetica; font-size: 12px; font-style: normal; font-variant: normal; font-weight: normal; letter-spacing: normal; line-height: normal; orphans: 2; text-indent: 0px; text-transform: none; white-space: normal; widows: 2; word-spacing: 0px; -webkit-border-horizontal-spacing: 0px; -webkit-border-vertical-spacing: 0px; -webkit-text-decorations-in-effect: none; -webkit-text-size-adjust: auto; -webkit-text-stroke-width: 0px; "><span class="Apple-style-span" style="border-collapse: separate; color: rgb(0, 0, 0); font-family: Helvetica; font-size: 12px; font-style: normal; font-variant: normal; font-weight: normal; letter-spacing: normal; line-height: normal; orphans: 2; text-indent: 0px; text-transform: none; white-space: normal; widows: 2; word-spacing: 0px; -webkit-border-horizontal-spacing: 0px; -webkit-border-vertical-spacing: 0px; -webkit-text-decorations-in-effect: none; -webkit-text-size-adjust: auto; -webkit-text-stroke-width: 0px; "><div style="word-wrap: break-word; -webkit-nbsp-mode: space; -webkit-line-break: after-white-space; "><span class="Apple-style-span" style="border-collapse: separate; color: rgb(0, 0, 0); font-family: Helvetica; font-size: 12px; font-style: normal; font-variant: normal; font-weight: normal; letter-spacing: normal; line-height: normal; orphans: 2; text-indent: 0px; text-transform: none; white-space: normal; widows: 2; word-spacing: 0px; -webkit-border-horizontal-spacing: 0px; -webkit-border-vertical-spacing: 0px; -webkit-text-decorations-in-effect: none; -webkit-text-size-adjust: auto; -webkit-text-stroke-width: 0px; "><div style="word-wrap: break-word; -webkit-nbsp-mode: space; -webkit-line-break: after-white-space; "><div><br></div><div>Keiran Raine</div><div>Senior Computer Biologist</div><div>The Cancer Genome Project</div><div>Ext: 2100</div><div><a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26674579&i=0" target="_top" rel="nofollow">kr2@...</a></div><div><br></div></div></span>The Wellcome Trust Sanger Institute is operated by Genome Research <br>Limited, a charity registered in England with number 1021457 and a <br>company registered in England with number 2742969, whose registered <br>office is 215 Euston Road, London, NW1 2BE. </div></span><br class="Apple-interchange-newline"></span><br class="Apple-interchange-newline"></div></span></div></span> </div><br></div>
<br>
--
The Wellcome Trust Sanger Institute is operated by Genome Research
Limited, a charity registered in England with number 1021457 and a
compa
ny registered in England with number 2742969, whose registered
office is 2
15 Euston Road, London, NW1 2BE.
<br>
</body></html><br />------------------------------------------------------------------------------
<br>Join us December 9, 2009 for the Red Hat Virtual Experience,
<br>a free event focused on virtualization and cloud computing.
<br>Attend in-depth sessions from your desk. Your couch. Anywhere.
<br><a href="http://p.sf.net/sfu/redhat-sfdev2dev" target="_top" rel="nofollow">http://p.sf.net/sfu/redhat-sfdev2dev</a><br />_______________________________________________
<br>Gmod-gbrowse mailing list
<br><a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26674579&i=1" target="_top" rel="nofollow">Gmod-gbrowse@...</a>
<br><a href="https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse" target="_top" rel="nofollow">https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse</a><br><p>From forum: <a href="http://old.nabble.com/gmod-gbrowse-f3500.html" embed="fixTarget[3500]" target="_top" >gmod-gbrowse</a></p>tag:old.nabble.com,2006:post-26672300Re: directionality in SAM reads2009-12-06T20:17:08Z2009-12-06T20:17:08ZWes BarrisLincoln Stein wrote:
<br>> Yes, you need a new version of Bio::Graphics. The coloration of the
<br>> mismatches is screwed up -- it compares the forward strand to the
<br>> reverse strand of the read.
<br><br>Thanks. Upgrading to 1.993 fixed it.
<br><div class='shrinkable-quote'><br>> Lincoln
<br>>
<br>> On Sun, Dec 6, 2009 at 10:25 PM, Wes Barris <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26672300&i=0" target="_top" rel="nofollow">wes.barris@...</a>> wrote:
<br>>
<br>> Lincoln Stein wrote:
<br>>
<br>> Hi,
<br>>
<br>> At low mag (no letters) you can turn on directional arrows, but
<br>> the arrows disappear when you zoom in to baes. The easiest thing
<br>> to do is to use a callback to change the background color for +
<br>> and -. I'm working on the base display today and this weekend,
<br>> and may be able to do the capital letters thing for you then.
<br>>
<br>>
<br>> I want to display the reads in different colors depending on the strand
<br>> information. I just upgraded to samtools-0.1.7a and Bio-SamTools-1.07.
<br>> When I display the reads all looks good on the positive strand.
<br>> However,
<br>> the coloring of the negative strand reads is all messed up. I have
<br>> attached an image which will show what I mean. Here is my track
<br>> definition:
<br>>
<br>> [READS]
<br>> feature = match
<br>> glyph = segments
<br>> bgcolor = sub {
<br>> my $feature = shift;
<br>> my $strand = $feature->strand;
<br>> return ($strand == 1 ? 'blue' : 'orange');
<br>> }
<br>> fgcolor = sub {
<br>> my $feature = shift;
<br>> my $strand = $feature->strand;
<br>> return ($strand == 1 ? 'blue' : 'orange');
<br>> }
<br>> draw_target = 1
<br>> show_mismatch = 1
<br>> mismatch_color = red
<br>> height = 3
<br>> label = 0
<br>> key = Read Alignment (slow for large regions)
<br>>
<br>> and my db lines:
<br>>
<br>> db_adaptor = Bio::DB::Sam
<br>> db_args = -bam /work/bw/bill/T58/BTA1.bam
<br>> -fasta /data/blat/btauUMD/3/BTA1.fa
<br>>
<br>> I am using Gbrowse 1.71b.
<br>>
<br>> Lincoln
<br>>
<br>>
<br>> On Wed, Nov 11, 2009 at 11:26 AM, Nicole Washington
<br>> <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26672300&i=1" target="_top" rel="nofollow">NLWashington@...</a> <mailto:<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26672300&i=2" target="_top" rel="nofollow">NLWashington@...</a>>
<br>> <mailto:<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26672300&i=3" target="_top" rel="nofollow">NLWashington@...</a> <mailto:<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26672300&i=4" target="_top" rel="nofollow">NLWashington@...</a>>>> wrote:
<br>>
<br>> Hello,
<br>>
<br>> Can the reads in SAM format display strandedness information? I
<br>> know in tview the reads will show capital letters for forward
<br>> strand, and small letters for reverse. I don't think this
<br>> happens
<br>> in gbrowse. Also, at the view where the reads turn from letters
<br>> into blocks, can the reads show directionality arrows? Changing
<br>> "stranded=1" doesn't seem to accomplish this.
<br>>
<br>> Nicole
<br>>
<br>>
<br>>
<br>>
<br>> --
<br>> Lincoln D. Stein
<br>> Director, Informatics and Biocomputing Platform
<br>> Ontario Institute for Cancer Research
<br>> 101 College St., Suite 800
<br>> Toronto, ON, Canada M5G0A3
<br>> 416 673-8514
<br>> Assistant: Renata Musa <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26672300&i=5" target="_top" rel="nofollow">Renata.Musa@...</a>
<br>> <mailto:<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26672300&i=6" target="_top" rel="nofollow">Renata.Musa@...</a>> <mailto:<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26672300&i=7" target="_top" rel="nofollow">Renata.Musa@...</a>
<br>> <mailto:<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26672300&i=8" target="_top" rel="nofollow">Renata.Musa@...</a>>>>
<br>>
<br>>
<br>>
<br>> --
<br>> Wes Barris <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26672300&i=9" target="_top" rel="nofollow">wes.barris@...</a>>
<br>>
<br>>
<br>>
<br>>
<br>> --
<br>> Lincoln D. Stein
<br>> Director, Informatics and Biocomputing Platform
<br>> Ontario Institute for Cancer Research
<br>> 101 College St., Suite 800
<br>> Toronto, ON, Canada M5G0A3
<br>> 416 673-8514
<br>> Assistant: Renata Musa <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26672300&i=10" target="_top" rel="nofollow">Renata.Musa@...</a>
<br>> <mailto:<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26672300&i=11" target="_top" rel="nofollow">Renata.Musa@...</a>>>
</div><br><br>--
<br>Wes Barris <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26672300&i=12" target="_top" rel="nofollow">wes.barris@...</a>>
<br><br>------------------------------------------------------------------------------
<br>Join us December 9, 2009 for the Red Hat Virtual Experience,
<br>a free event focused on virtualization and cloud computing.
<br>Attend in-depth sessions from your desk. Your couch. Anywhere.
<br><a href="http://p.sf.net/sfu/redhat-sfdev2dev" target="_top" rel="nofollow">http://p.sf.net/sfu/redhat-sfdev2dev</a><br>_______________________________________________
<br>Gmod-gbrowse mailing list
<br><a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26672300&i=13" target="_top" rel="nofollow">Gmod-gbrowse@...</a>
<br><a href="https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse" target="_top" rel="nofollow">https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse</a><br><p>From forum: <a href="http://old.nabble.com/gmod-gbrowse-f3500.html" embed="fixTarget[3500]" target="_top" >gmod-gbrowse</a></p>tag:old.nabble.com,2006:post-26672233Re: text onto generic feature2009-12-06T20:02:31Z2009-12-06T20:02:31ZScott Cain-4If you want to use the allele_tower glyph, it is currently in the
<br>stable branch of the gbrowse svn. I thought the plan was to move them
<br>to Bio-Graphics, but that hasn't happened yet.
<br><br>Scott
<br><br><br>On Sun, Dec 6, 2009 at 10:45 PM, Scott Cain <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26672233&i=0" target="_top" rel="nofollow">scott@...</a>> wrote:
<div class='shrinkable-quote'><br>> Hi Keiran,
<br>>
<br>> Funny--I was trying to figure out if a snow was a feature type that I
<br>> had never heard of :-)
<br>>
<br>> Are the snps going to be displayed by themselves or in the context of
<br>> a gene, where you want the just the snp base to look different? If
<br>> the former, you should look at the snp specific glyphs, like
<br>> allele_tower. I thought that glyph was in the Bio::Graphics
<br>> distribution, but it doesn't appear to be in svn right now; I'll try
<br>> to sort that out tomorrow.
<br>>
<br>> If you'd like to do the latter, the only way I could see that working
<br>> would be to use the segments glyph (or one of it's children) and
<br>> supplying a full sequence for the containing feature with the snp and
<br>> supply the show_mismatch and draw_target options, and the mismatched
<br>> sequence (the snp) will show up in a different color.
<br>>
<br>> Scott
<br>>
<br>> On Sat, Dec 5, 2009 at 11:07 AM, Keiran Raine <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26672233&i=1" target="_top" rel="nofollow">kr2@...</a>> wrote:
<br>>> Hi Scott,
<br>>> I think I'm missing something here, mainly how I load the sequence change
<br>>> via a gff3 file. This is an example of the data I want to display:
<br>>> 1 CAVEMAN_PD2125 sub 12853938 12853938 8.5e-01 + .
<br>>> Name=PD2125(T>C);Dbxref=dbSNP:rs4989043
<br>>> All of the events are single base snp/variations (not 'snow' as the
<br>>> predictive text on my phone sent yesterday). I'm guessing I need to add
<br>>> another attribute to column 9 but I can't figure out if there is a
<br>>> predefined one that the loader will understand.
<br>>> I don't need the glyph to change the colour of the feature as we have
<br>>> predefined these based on the scores and a callback, I just want to show the
<br>>> sequence within the feature e.g.
<br>>> ##gff3
<br>>> 1 CAVEMAN_PD2125 sub 12853938 12853938 8.5e-01 + .
<br>>> Name=PD2125(T>C);Dbxref=dbSNP:rs4989043;seq=c
<br>>> ##conf for track
<br>>> seq = sub { my $f = shift;
<br>>> my ($seq) = $f->attributes('seq');
<br>>> return $seq;
<br>>> }
<br>>>
<br>>> Does this make sense?
<br>>> Thanks,
<br>>>
<br>>> Keiran Raine
<br>>> Senior Computer Biologist
<br>>> The Cancer Genome Project
<br>>> Ext: 2100
<br>>> <a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26672233&i=2" target="_top" rel="nofollow">kr2@...</a>
<br>>> The Wellcome Trust Sanger Institute is operated by Genome Research
<br>>> Limited, a charity registered in England with number 1021457 and a
<br>>> company registered in England with number 2742969, whose registered
<br>>> office is 215 Euston Road, London, NW1 2BE.
<br>>>
<br>>>
<br>>> On 4 Dec 2009, at 18:32, Scott Cain wrote:
<br>>>
<br>>> Where do you want the text to be? At the location of the variant
<br>>> base? If so, the generic glyph can't do that. The segments glyph can
<br>>> show mismatches. You'll need the draw_target and show_mismatch
<br>>> options.
<br>>>
<br>>> Scott
<br>>>
<br>>>
<br>>> On Fri, Dec 4, 2009 at 1:23 PM, Keiran Raine <<a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26672233&i=3" target="_top" rel="nofollow">kr2@...</a>> wrote:
<br>>>
<br>>> Hi,
<br>>>
<br>>> Simple question but will save me time
<br>>>
<br>>> If I have a generic glyph defined, what tag (e.g. from the stranded,
<br>>>
<br>>> bgcolor, fgcolor section) in the track config do I put my callback to
<br>>>
<br>>> display text for a variant base.
<br>>>
<br>>> Thanks
<br>>>
<br>>>
<br>>> Keiran Raine
<br>>>
<br>>> Senior Computer Biologist
<br>>>
<br>>> The Cancer Genome Project
<br>>>
<br>>> Ext: 2100
<br>>>
<br>>> <a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26672233&i=4" target="_top" rel="nofollow">kr2@...</a>
<br>>>
<br>>> The Wellcome Trust Sanger Institute is operated by Genome Research
<br>>>
<br>>> Limited, a charity registered in England with number 1021457 and a
<br>>>
<br>>> company registered in England with number 2742969, whose registered
<br>>>
<br>>> office is 215 Euston Road, London, NW1 2BE.
<br>>>
<br>>>
<br>>>
<br>>>
<br>>>
<br>>> --
<br>>>
<br>>> The Wellcome Trust Sanger Institute is operated by Genome Research
<br>>>
<br>>> Limited, a charity registered in England with number 1021457 and a
<br>>>
<br>>> company registered in England with number 2742969, whose registered
<br>>>
<br>>> office is 215 Euston Road, London, NW1 2BE.
<br>>>
<br>>> ------------------------------------------------------------------------------
<br>>>
<br>>> Join us December 9, 2009 for the Red Hat Virtual Experience,
<br>>>
<br>>> a free event focused on virtualization and cloud computing.
<br>>>
<br>>> Attend in-depth sessions from your desk. Your couch. Anywhere.
<br>>>
<br>>> <a href="http://p.sf.net/sfu/redhat-sfdev2dev" target="_top" rel="nofollow">http://p.sf.net/sfu/redhat-sfdev2dev</a><br>>>
<br>>> _______________________________________________
<br>>>
<br>>> Gmod-gbrowse mailing list
<br>>>
<br>>> <a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26672233&i=5" target="_top" rel="nofollow">Gmod-gbrowse@...</a>
<br>>>
<br>>> <a href="https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse" target="_top" rel="nofollow">https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse</a><br>>>
<br>>>
<br>>>
<br>>>
<br>>> --
<br>>> ------------------------------------------------------------------------
<br>>> Scott Cain, Ph. D. scott at scottcain dot
<br>>> net
<br>>> GMOD Coordinator (<a href="http://gmod.org/" target="_top" rel="nofollow">http://gmod.org/</a>) 216-392-3087
<br>>> Ontario Institute for Cancer Research
<br>>>
<br>>>
<br>>> -- The Wellcome Trust Sanger Institute is operated by Genome Research
<br>>> Limited, a charity registered in England with number 1021457 and a company
<br>>> registered in England with number 2742969, whose registered office is 215
<br>>> Euston Road, London, NW1 2BE.
<br>>>
<br>>
<br>>
<br>>
<br>> --
<br>> ------------------------------------------------------------------------
<br>> Scott Cain, Ph. D. scott at scottcain dot net
<br>> GMOD Coordinator (<a href="http://gmod.org/" target="_top" rel="nofollow">http://gmod.org/</a>) 216-392-3087
<br>> Ontario Institute for Cancer Research
<br>>
</div><br><br><br>--
<br>------------------------------------------------------------------------
<br>Scott Cain, Ph. D. scott at scottcain dot net
<br>GMOD Coordinator (<a href="http://gmod.org/" target="_top" rel="nofollow">http://gmod.org/</a>) 216-392-3087
<br>Ontario Institute for Cancer Research
<br><br>------------------------------------------------------------------------------
<br>Join us December 9, 2009 for the Red Hat Virtual Experience,
<br>a free event focused on virtualization and cloud computing.
<br>Attend in-depth sessions from your desk. Your couch. Anywhere.
<br><a href="http://p.sf.net/sfu/redhat-sfdev2dev" target="_top" rel="nofollow">http://p.sf.net/sfu/redhat-sfdev2dev</a><br>_______________________________________________
<br>Gmod-gbrowse mailing list
<br><a href="http://old.nabble.com/user/SendEmail.jtp?type=post&post=26672233&i=6" target="_top" rel="nofollow">Gmod-gbrowse@...</a>
<br><a href="https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse" target="_top" rel="nofollow">https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse</a><br><p>From forum: <a href="http://old.nabble.com/gmod-gbrowse-f3500.html" embed="fixTarget[3500]" target="_top" >gmod-gbrowse</a></p>