comp linguistics - pseudoknots

View: New views
1 Messages — Rating Filter:   Alert me  

comp linguistics - pseudoknots

by jlynn-2 :: Rate this Message:

Reply to Author | View Threaded | Show Only this Message

My approach to finding RNA sructure, including pknots and triple helix
is a bit different:

I strictly search for structure ingnoring specific nt sequence by
writing formal grammars for what ever I'm looking for.

Simple examples are find a sequence that matches loops ((((::::)))),
pknots ((((::::[[[:::))))::)))) or even something
like a triple helix pknot:

mt plasmid DNA
(((::[[[:::{{{:::))):::]]]:::}}}
ATCAGAAAGCGTGGTCTGATGTTTTTTCACCA

platipus genome
(((::[[[::{{{:::))):::]]]:::}}}
CAAGTTCTATTGAGTTTTGGGGAGAAGGTCA

platipus genome
(((:::[[[:::{{{:::))):::]]]:::}}}
CACAGCTGATGATAAATGGTGGAGTCAGGATTA

Its obvious we get many "impossible" or ambiguous structures as
matches but as the complexity of the structure increases the
probability that the matched structure is something "real" increases.

Its essentially a way around the NP problem and for most H-type pknots
I can scan a complete viral genome in about 1-3 minutes - all grammars
seem to parse in O(n) time.

I like some feedback on the worth of such a method.

James Lynn
www.rnaparse.com

_______________________________________________
Bio-soft mailing list
Bio-soft@...
http://www.bio.net/biomail/listinfo/bio-soft