gbrowse_syn soruce_map configuration
|
View:
New views
10 Messages
—
Rating Filter:
Alert me
|
 |
gbrowse_syn soruce_map configuration
by Wes Barris
::
Rate this Message:
Hi,
I have a question about the "source_map" parameter for gbrowse_syn and how it relates to the "species" in the .aln file. The source_map example given in the documentation is: # example: # name conf. file description source_map = elegans elegans_synteny "C. elegans" remanei remanei_synteny "C. remanei" briggsae briggsae_synteny "C. briggsae" The above seems to imply that the following three gbrowse configuration files exist: elegans_synteny.conf remanei_synteny.conf briggsae_synteny.conf Is that correct? What is the purpose of "name" (column one)? Is that just a name internal to the gbrowse_syn configuration file that might be used in the examples line? Also, the example .aln file has lines in this form: wild_rice-3(+)/11552824-11552969 gctgttcacacctaggtctctcccat rice-3(+)/12788183-12788328 gctgttcacacctaggtctctcccat ************************** Do "wild_rice" and "rice" in these lines correspond to any of the columns in the "source_map" configuration? If not, what do they correspond to? -- Wes Barris <wes.barris@...> ------------------------------------------------------------------------------ Come build with us! The BlackBerry(R) Developer Conference in SF, CA is the only developer event you need to attend this year. Jumpstart your developing skills, take BlackBerry mobile applications to market and stay ahead of the curve. Join us from November 9 - 12, 2009. Register now! http://p.sf.net/sfu/devconference _______________________________________________ Gmod-gbrowse mailing list Gmod-gbrowse@... https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse |
|
|
Re: gbrowse_syn soruce_map configuration
by Sheldon McKay-3
::
Rate this Message:
Hi Wes,
Please see below. > I have a question about the "source_map" parameter for gbrowse_syn > and how it relates to the "species" in the .aln file. The source_map > example given in the documentation is: > > # example: > # name conf. file description > source_map = elegans elegans_synteny "C. elegans" > remanei remanei_synteny "C. remanei" > briggsae briggsae_synteny "C. briggsae" > > The above seems to imply that the following three gbrowse > configuration files exist: > > elegans_synteny.conf > remanei_synteny.conf > briggsae_synteny.conf > What is the purpose of "name" (column one)? Is that just a name > internal to the gbrowse_syn configuration file that might be used > in the examples line? The first column in the source_map option is the symbolic source name, the shorthand name by which gbrowse_syn refers to the data source for the individual species (or equivalent). It can be the same as the the species' configuration file but does not have to be. > > Also, the example .aln file has lines in this form: > > wild_rice-3(+)/11552824-11552969 gctgttcacacctaggtctctcccat > rice-3(+)/12788183-12788328 gctgttcacacctaggtctctcccat > ************************** > > Do "wild_rice" and "rice" in these lines correspond to any of > the columns in the "source_map" configuration? If not, what > do they correspond to? The first part of the sequence names correspond to the symbolic source name (column 1). Another note on names: Until we standardize metadata for the multiple sequence alignments, the sequence name has to be overloaded with the strand and coordinate range, making the "(+)/12788183-12788328" (for example) mandatory. Sheldon ------------------------------------------------------------------------------ Come build with us! The BlackBerry(R) Developer Conference in SF, CA is the only developer event you need to attend this year. Jumpstart your developing skills, take BlackBerry mobile applications to market and stay ahead of the curve. Join us from November 9 - 12, 2009. Register now! http://p.sf.net/sfu/devconference _______________________________________________ Gmod-gbrowse mailing list Gmod-gbrowse@... https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse |
|
|
Re: gbrowse_syn soruce_map configuration
by Chris Fields-5
::
Rate this Message:
On Oct 13, 2009, at 3:02 AM, Sheldon McKay wrote: > Hi Wes, > > Please see below. > >> ... >> Also, the example .aln file has lines in this form: >> >> wild_rice-3(+)/11552824-11552969 gctgttcacacctaggtctctcccat >> rice-3(+)/12788183-12788328 gctgttcacacctaggtctctcccat >> ************************** >> >> Do "wild_rice" and "rice" in these lines correspond to any of >> the columns in the "source_map" configuration? If not, what >> do they correspond to? > > The first part of the sequence names correspond to the symbolic source > name (column 1). Another note on names: Until we standardize metadata > for the multiple sequence alignments, the sequence name has to be > overloaded with the strand and coordinate range, making the > "(+)/12788183-12788328" (for example) mandatory. > > > Sheldon Is this something we should be standardizing within bioperl? It would be fairly easy to add a function to Bio::LocatableSeq to make this a bit easier, so let us know if you settle on a specific format. Also (just to point out not criticize), this is a bit different than what the NSE output is for other formats. Stockholm, for instance, flips start and end with - strand (from Rfam, middle sequence): ... AE010018.1/5094-5211 U......AUUCCUU....UAAA..ACAGUC.CUGUGAGGCUGU..CAAGG AE008488.1/6454-6322 U......AUUCCUU....UAAA..CCUGUC.CCGUGAGGCAGG..CAAGG AE014133.1/803283-803394 U......AUUCCUU....UAAC..ACUGUC.CCGUGAGGCAGG..CAAGG #=GC SS_cons ........< <<<<<<.........<<<<<<.......>>>>>>..>>>>> #=GC RF A......aaaCCUUU...UAAa..ucAGUC.CaGaGAGGCUga..AAAGG chris ------------------------------------------------------------------------------ Come build with us! The BlackBerry(R) Developer Conference in SF, CA is the only developer event you need to attend this year. Jumpstart your developing skills, take BlackBerry mobile applications to market and stay ahead of the curve. Join us from November 9 - 12, 2009. Register now! http://p.sf.net/sfu/devconference _______________________________________________ Gmod-gbrowse mailing list Gmod-gbrowse@... https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse |
|
|
Re: gbrowse_syn soruce_map configuration
by Sheldon McKay-3
::
Rate this Message:
Hi Chris,
I am not familiar with the NSE acronym but is the inverted start-end for (-) strand in the sequence ID standard amongst Bio::AlignIO modules or unique to Stockholm? It would be convenient to be able to use Bio::AlignIO->write_aln() output unmodified if that were possible. Also, could you explain in more detail how the LocatableSeq object could be used to help in the context of flat multiple sequence alignment files? Thanks, Sheldon >> The first part of the sequence names correspond to the symbolic source >> name (column 1). Another note on names: Until we standardize metadata >> for the multiple sequence alignments, the sequence name has to be >> overloaded with the strand and coordinate range, making the >> "(+)/12788183-12788328" (for example) mandatory. > Is this something we should be standardizing within bioperl? It would be > fairly easy to add a function to Bio::LocatableSeq to make this a bit > easier, so let us know if you settle on a specific format. > Also (just to point out not criticize), this is a bit different than what > the NSE output is for other formats. Stockholm, for instance, flips start > and end with - strand (from Rfam, middle sequence): ------------------------------------------------------------------------------ Come build with us! The BlackBerry(R) Developer Conference in SF, CA is the only developer event you need to attend this year. Jumpstart your developing skills, take BlackBerry mobile applications to market and stay ahead of the curve. Join us from November 9 - 12, 2009. Register now! http://p.sf.net/sfu/devconference _______________________________________________ Gmod-gbrowse mailing list Gmod-gbrowse@... https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse |
|
|
|
|
|
Re: gbrowse_syn soruce_map configuration
by Wes Barris
::
Rate this Message:
Sheldon McKay wrote:
>> Also, the example .aln file has lines in this form: >> >> wild_rice-3(+)/11552824-11552969 gctgttcacacctaggtctctcccat >> rice-3(+)/12788183-12788328 gctgttcacacctaggtctctcccat >> ************************** >> >> Do "wild_rice" and "rice" in these lines correspond to any of >> the columns in the "source_map" configuration? If not, what >> do they correspond to? > > The first part of the sequence names correspond to the symbolic source > name (column 1). Another note on names: Until we standardize metadata > for the multiple sequence alignments, the sequence name has to be > overloaded with the strand and coordinate range, making the > "(+)/12788183-12788328" (for example) mandatory. Hi Sheldon, To test this I changed all occurrences of "rice" to "ricx" in the oryza.synconf file and also did the same change on the .aln file. I reloaded the .aln file and tried to access the URL of gbrowse_syn. I get this error in the displayed page: Software error: Usage: GD::Image::colorAllocateAlpha(image, r, g, b, a) at /htdocs/gbrowse/gbrowse_syn.cgi line 515. These errors also appear in the apache error logs: [Wed Oct 14 08:54:13 2009] [error] [client 140.253.153.217] [Wed Oct 14 08:54:13 2009] gbrowse_syn.cgi: Use of uninitialized value in hash element at /usr/lib/perl5/site_perl/5.8.5/Bio/Graphics/Panel.pm line 1200., referer: https://www.biolives.csiro.au/perl/gbrowse_syn.cgi/test/?search_src=ricx;name=3:16050173..16064974 [Wed Oct 14 08:54:13 2009] [error] [client 140.253.153.217] [Wed Oct 14 08:54:13 2009] gbrowse_syn.cgi: Usage: GD::Image::colorAllocateAlpha(image, r, g, b, a) at /htdocs/gbrowse/gbrowse_syn.cgi line 515., referer: https://www.biolives.csiro.au/perl/gbrowse_syn.cgi/test/?search_src=ricx;name=3:16050173..16064974 The trimmed down .aln file I am using is: CLUSTAL W(1.81) multiple sequence alignment W(1.81) wild_ricx-3(+)/11552824-11552969 ttccgatccatcgtctaagataaaatacagagttgcccgcctctcccttcccacatcgac ricx-3(+)/12788183-12788328 ttccgatccatcgtctaagataaaatacagagttgcccgcctctcccttcccacatcggc ********************************************************** * wild_ricx-3(+)/11552824-11552969 attagcacggggagcttgcatggcaagcgagatcgatcgatgcatggacgcccccccccg ricx-3(+)/12788183-12788328 attagcacggggagcttgcatggcaagcgagatcgatcgatgcatggacgcccccccccg ************************************************************ wild_ricx-3(+)/11552824-11552969 gctgttcacacctaggtctctcccat ricx-3(+)/12788183-12788328 gctgttcacacctaggtctctcccat ************************** The .synconf file I am using is: [GENERAL] description = BLASTZ alignments for Oryza sativa # The synteny database join = dbi:mysql:database=umdbcm_synteny;host=biodata.sl.csiro.au;user=nobody # src symbolic src Description source_map = ricx rice "Domesic Rice (O. sativa)" wild_ricx wild_rice "Wild Rice" tmpimages = /gbrowse/tmp imagewidth = 800 stylesheet = /gbrowse/gbrowse.css cache time = 1 config_extension = conf # example searches to display examples = ricx 3:16050173..16064974 wild_ricx 3:1..400000 zoom levels = 5000 10000 25000 50000 100000 200000 400000 # species-specific databases [ricx] tracks = EG color = blue [wild_ricx] tracks = EG color = red I have not changed rice.conf or wild_rice.conf. -- Wes Barris <wes.barris@...> ------------------------------------------------------------------------------ Come build with us! The BlackBerry(R) Developer Conference in SF, CA is the only developer event you need to attend this year. Jumpstart your developing skills, take BlackBerry mobile applications to market and stay ahead of the curve. Join us from November 9 - 12, 2009. Register now! http://p.sf.net/sfu/devconference _______________________________________________ Gmod-gbrowse mailing list Gmod-gbrowse@... https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse |
|
|
Re: gbrowse_syn soruce_map configuration
by Chris Fields-5
::
Rate this Message:
On Oct 13, 2009, at 8:27 AM, Sheldon McKay wrote:
> Hi Chris, > > I am not familiar with the NSE acronym but is the inverted start-end > for (-) strand in the sequence ID standard amongst Bio::AlignIO > modules or unique to Stockholm? It would be convenient to be able to > use Bio::AlignIO->write_aln() output unmodified if that were possible. NSE = Name/Start-End Tag LocatableSeq method Name id() (if version() is defined, it's id().".".version() Start start() End end() This was recently modified to add version information, as noted above. There doesn't appear to be anything that would switch the start and end based on the strand, but this could be done in a backwards-compatible way. > Also, could you explain in more detail how the LocatableSeq object > could be used to help in the context of flat multiple sequence > alignment files? > > Thanks, > Sheldon A Bio::SimpleAlign has one or more Bio::LocatableSeq (each with start/ end/strand/display_id etc). When passed a SimpleAlign, Bio::AlignIO::foo::write_aln() in most cases calls get_nse() to generate a string with the relevant information ready to go. In some cases (stockholm, for instance) one is forced to generate the string on the fly, mainly b/c having strand == -1 doesn't flip the start/end in NSE output (in other words, start is always <= end). I'm not sure what the overall standard is for this, but the current situation with NSE is lossy so it makes sense to have the strand info represented somehow, either by flipping the start/end coordinates when needed or indicating the strand explicitly as you have it. chris ------------------------------------------------------------------------------ Come build with us! The BlackBerry(R) Developer Conference in SF, CA is the only developer event you need to attend this year. Jumpstart your developing skills, take BlackBerry mobile applications to market and stay ahead of the curve. Join us from November 9 - 12, 2009. Register now! http://p.sf.net/sfu/devconference _______________________________________________ Gmod-gbrowse mailing list Gmod-gbrowse@... https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse |
|
|
Re: gbrowse_syn soruce_map configuration
by Sheldon McKay-3
::
Rate this Message:
Hi Wes,
Granted that is not a very helpful error message but the issue is that the label for the species config stanza should be the same as the second column in the source map. eg) source_map = ricx rice "Domesic Rice (O. sativa)" wild_ricx wild_rice "Wild Rice" ... [rice] tracks = EG color = blue [wild_rice] tracks = EG color = red Also, another potential issue is, if you happen to be installing the rice example along with any other gbrowse_syn data sources, ensure that all are using the same extension for species config file (.conf or .syn), set using the config extension option. config_extension = conf The documentation for the main config file is here: http://gmod.org/wiki/GBrowse_syn_Configuration Sheldon On Tue, Oct 13, 2009 at 7:01 PM, Wes Barris <wes.barris@...> wrote: > Sheldon McKay wrote: > >>> Also, the example .aln file has lines in this form: >>> >>> wild_rice-3(+)/11552824-11552969 gctgttcacacctaggtctctcccat >>> rice-3(+)/12788183-12788328 gctgttcacacctaggtctctcccat >>> ************************** >>> >>> Do "wild_rice" and "rice" in these lines correspond to any of >>> the columns in the "source_map" configuration? If not, what >>> do they correspond to? >> >> The first part of the sequence names correspond to the symbolic source >> name (column 1). Another note on names: Until we standardize metadata >> for the multiple sequence alignments, the sequence name has to be >> overloaded with the strand and coordinate range, making the >> "(+)/12788183-12788328" (for example) mandatory. > > Hi Sheldon, > > To test this I changed all occurrences of "rice" to "ricx" in the > oryza.synconf file and also did the same change on the .aln file. > I reloaded the .aln file and tried to access the URL of gbrowse_syn. > I get this error in the displayed page: > > Software error: > > Usage: GD::Image::colorAllocateAlpha(image, r, g, b, a) at > /htdocs/gbrowse/gbrowse_syn.cgi line 515. > > These errors also appear in the apache error logs: > > [Wed Oct 14 08:54:13 2009] [error] [client 140.253.153.217] [Wed Oct 14 > 08:54:13 2009] gbrowse_syn.cgi: Use of uninitialized value in hash element > at /usr/lib/perl5/site_perl/5.8.5/Bio/Graphics/Panel.pm line 1200., referer: > https://www.biolives.csiro.au/perl/gbrowse_syn.cgi/test/?search_src=ricx;name=3:16050173..16064974 > [Wed Oct 14 08:54:13 2009] [error] [client 140.253.153.217] [Wed Oct 14 > 08:54:13 2009] gbrowse_syn.cgi: Usage: GD::Image::colorAllocateAlpha(image, > r, g, b, a) at /htdocs/gbrowse/gbrowse_syn.cgi line 515., referer: > https://www.biolives.csiro.au/perl/gbrowse_syn.cgi/test/?search_src=ricx;name=3:16050173..16064974 > > The trimmed down .aln file I am using is: > > CLUSTAL W(1.81) multiple sequence alignment W(1.81) > > > wild_ricx-3(+)/11552824-11552969 > ttccgatccatcgtctaagataaaatacagagttgcccgcctctcccttcccacatcgac > ricx-3(+)/12788183-12788328 > ttccgatccatcgtctaagataaaatacagagttgcccgcctctcccttcccacatcggc > > ********************************************************** * > > > wild_ricx-3(+)/11552824-11552969 > attagcacggggagcttgcatggcaagcgagatcgatcgatgcatggacgcccccccccg > ricx-3(+)/12788183-12788328 > attagcacggggagcttgcatggcaagcgagatcgatcgatgcatggacgcccccccccg > > ************************************************************ > > > wild_ricx-3(+)/11552824-11552969 gctgttcacacctaggtctctcccat > ricx-3(+)/12788183-12788328 gctgttcacacctaggtctctcccat > ************************** > > The .synconf file I am using is: > > [GENERAL] > description = BLASTZ alignments for Oryza sativa > > # The synteny database > join = > dbi:mysql:database=umdbcm_synteny;host=biodata.sl.csiro.au;user=nobody > > # src symbolic src Description > source_map = ricx rice "Domesic Rice (O. sativa)" > wild_ricx wild_rice "Wild Rice" > > tmpimages = /gbrowse/tmp > imagewidth = 800 > stylesheet = /gbrowse/gbrowse.css > cache time = 1 > > config_extension = conf > > # example searches to display > examples = ricx 3:16050173..16064974 > wild_ricx 3:1..400000 > > zoom levels = 5000 10000 25000 50000 100000 200000 400000 > > # species-specific databases > [ricx] > tracks = EG > color = blue > > [wild_ricx] > tracks = EG > color = red > > > I have not changed rice.conf or wild_rice.conf. > > -- > Wes Barris <wes.barris@...> > -- Sheldon McKay, PhD Cold Spring Harbor Laboratory Office/Mobile: 516-367-6998 / 203-893-1682 Sent from Milford, Connecticut, United States ------------------------------------------------------------------------------ Come build with us! The BlackBerry(R) Developer Conference in SF, CA is the only developer event you need to attend this year. Jumpstart your developing skills, take BlackBerry mobile applications to market and stay ahead of the curve. Join us from November 9 - 12, 2009. Register now! http://p.sf.net/sfu/devconference _______________________________________________ Gmod-gbrowse mailing list Gmod-gbrowse@... https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse |
|
|
Re: gbrowse_syn soruce_map configuration
by Wes Barris
::
Rate this Message:
Sheldon McKay wrote:
> Hi Wes, > > Granted that is not a very helpful error message but the issue is that > the label for the species config stanza should be the same as the > second column in the source map. Thanks Sheldon. I think that part of the confusion I was having was due to the difference in terminology between the configuration documentation and the tutorial: 1) The gbrowse_syn tutorial says the 1st column is the source but the configuration documentation says the 1st column is the name. Neither of these column headings are very descriptive. 2) The gbrowse_syn tutorial says the 2nd column is the symbolic source but the configuration documentation says the 2nd column is the "conf. file". Another thing that makes this hard is that the tutorial uses the same names for the values in the first two columns. As a result, one can't determine which column corresponds to what other locations in the configuration. I might suggest adding a more complete description to the configuration instructions under the "source_map" section which would read something like this: ------------------------- The value for "name" (the first column) is the symbolic name that gbrowse_syn users to identify each species. This value is also used in two other places in the gbrowse_syn configuration: 1) it is used as the species name in the "examples" directive 2) it is used as the species name in the .aln file The value for "conf. file" is the basename of the corresponding gbrowse .conf files. This value is also used to identify the species configuration stanzas at the bottom of the configuration file. ----------------------------- > eg) > source_map = ricx rice "Domesic Rice (O. sativa)" > wild_ricx wild_rice "Wild Rice" > > ... > [rice] > tracks = EG > color = blue > > [wild_rice] > tracks = EG > color = red > > Also, another potential issue is, if you happen to be installing the > rice example along with any other gbrowse_syn data sources, ensure > that all are using the same extension for species config file (.conf > or .syn), set using the config extension option. > > config_extension = conf > > The documentation for the main config file is here: > http://gmod.org/wiki/GBrowse_syn_Configuration > > Sheldon > > > On Tue, Oct 13, 2009 at 7:01 PM, Wes Barris <wes.barris@...> wrote: >> Sheldon McKay wrote: >> >>>> Also, the example .aln file has lines in this form: >>>> >>>> wild_rice-3(+)/11552824-11552969 gctgttcacacctaggtctctcccat >>>> rice-3(+)/12788183-12788328 gctgttcacacctaggtctctcccat >>>> ************************** >>>> >>>> Do "wild_rice" and "rice" in these lines correspond to any of >>>> the columns in the "source_map" configuration? If not, what >>>> do they correspond to? >>> The first part of the sequence names correspond to the symbolic source >>> name (column 1). Another note on names: Until we standardize metadata >>> for the multiple sequence alignments, the sequence name has to be >>> overloaded with the strand and coordinate range, making the >>> "(+)/12788183-12788328" (for example) mandatory. >> Hi Sheldon, >> >> To test this I changed all occurrences of "rice" to "ricx" in the >> oryza.synconf file and also did the same change on the .aln file. >> I reloaded the .aln file and tried to access the URL of gbrowse_syn. >> I get this error in the displayed page: >> >> Software error: >> >> Usage: GD::Image::colorAllocateAlpha(image, r, g, b, a) at >> /htdocs/gbrowse/gbrowse_syn.cgi line 515. >> >> These errors also appear in the apache error logs: >> >> [Wed Oct 14 08:54:13 2009] [error] [client 140.253.153.217] [Wed Oct 14 >> 08:54:13 2009] gbrowse_syn.cgi: Use of uninitialized value in hash element >> at /usr/lib/perl5/site_perl/5.8.5/Bio/Graphics/Panel.pm line 1200., referer: >> https://www.biolives.csiro.au/perl/gbrowse_syn.cgi/test/?search_src=ricx;name=3:16050173..16064974 >> [Wed Oct 14 08:54:13 2009] [error] [client 140.253.153.217] [Wed Oct 14 >> 08:54:13 2009] gbrowse_syn.cgi: Usage: GD::Image::colorAllocateAlpha(image, >> r, g, b, a) at /htdocs/gbrowse/gbrowse_syn.cgi line 515., referer: >> https://www.biolives.csiro.au/perl/gbrowse_syn.cgi/test/?search_src=ricx;name=3:16050173..16064974 >> >> The trimmed down .aln file I am using is: >> >> CLUSTAL W(1.81) multiple sequence alignment W(1.81) >> >> >> wild_ricx-3(+)/11552824-11552969 >> ttccgatccatcgtctaagataaaatacagagttgcccgcctctcccttcccacatcgac >> ricx-3(+)/12788183-12788328 >> ttccgatccatcgtctaagataaaatacagagttgcccgcctctcccttcccacatcggc >> >> ********************************************************** * >> >> >> wild_ricx-3(+)/11552824-11552969 >> attagcacggggagcttgcatggcaagcgagatcgatcgatgcatggacgcccccccccg >> ricx-3(+)/12788183-12788328 >> attagcacggggagcttgcatggcaagcgagatcgatcgatgcatggacgcccccccccg >> >> ************************************************************ >> >> >> wild_ricx-3(+)/11552824-11552969 gctgttcacacctaggtctctcccat >> ricx-3(+)/12788183-12788328 gctgttcacacctaggtctctcccat >> ************************** >> >> The .synconf file I am using is: >> >> [GENERAL] >> description = BLASTZ alignments for Oryza sativa >> >> # The synteny database >> join = >> dbi:mysql:database=umdbcm_synteny;host=biodata.sl.csiro.au;user=nobody >> >> # src symbolic src Description >> source_map = ricx rice "Domesic Rice (O. sativa)" >> wild_ricx wild_rice "Wild Rice" >> >> tmpimages = /gbrowse/tmp >> imagewidth = 800 >> stylesheet = /gbrowse/gbrowse.css >> cache time = 1 >> >> config_extension = conf >> >> # example searches to display >> examples = ricx 3:16050173..16064974 >> wild_ricx 3:1..400000 >> >> zoom levels = 5000 10000 25000 50000 100000 200000 400000 >> >> # species-specific databases >> [ricx] >> tracks = EG >> color = blue >> >> [wild_ricx] >> tracks = EG >> color = red >> >> >> I have not changed rice.conf or wild_rice.conf. >> >> -- >> Wes Barris <wes.barris@...> >> > > > -- Wes Barris <wes.barris@...> ------------------------------------------------------------------------------ Come build with us! The BlackBerry(R) Developer Conference in SF, CA is the only developer event you need to attend this year. Jumpstart your developing skills, take BlackBerry mobile applications to market and stay ahead of the curve. Join us from November 9 - 12, 2009. Register now! http://p.sf.net/sfu/devconference _______________________________________________ Gmod-gbrowse mailing list Gmod-gbrowse@... https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse |
|
|
Re: gbrowse_syn soruce_map configuration
by Sheldon McKay-3
::
Rate this Message:
Thanks Wes,
A fresh set of eyes is always good to have around. I added the suggested text to the documentation. Please note that any user is able, indeed welcome, to create an account on the GMOD wiki and update the pages if they find an area that could use some improvement. Sheldon On Wed, Oct 14, 2009 at 7:15 PM, Wes Barris <wes.barris@...> wrote: > Sheldon McKay wrote: >> >> Hi Wes, >> >> Granted that is not a very helpful error message but the issue is that >> the label for the species config stanza should be the same as the >> second column in the source map. > > Thanks Sheldon. I think that part of the confusion I was having > was due to the difference in terminology between the configuration > documentation and the tutorial: > > 1) The gbrowse_syn tutorial says the 1st column is the source > but the configuration documentation says the 1st column is the > name. Neither of these column headings are very descriptive. > > 2) The gbrowse_syn tutorial says the 2nd column is the symbolic source > but the configuration documentation says the 2nd column is the > "conf. file". > > Another thing that makes this hard is that the tutorial uses the > same names for the values in the first two columns. As a result, > one can't determine which column corresponds to what other locations > in the configuration. > > I might suggest adding a more complete description to the configuration > instructions under the "source_map" section which would read something > like this: > > ------------------------- > The value for "name" (the first column) is the symbolic name that > gbrowse_syn users to identify each species. This value is also > used in two other places in the gbrowse_syn configuration: > 1) it is used as the species name in the "examples" directive > 2) it is used as the species name in the .aln file > > The value for "conf. file" is the basename of the corresponding > gbrowse .conf files. This value is also used to identify the species > configuration stanzas at the bottom of the configuration file. > ----------------------------- > >> eg) >> source_map = ricx rice "Domesic Rice (O. sativa)" >> wild_ricx wild_rice "Wild Rice" >> >> ... >> [rice] >> tracks = EG >> color = blue >> >> [wild_rice] >> tracks = EG >> color = red >> >> Also, another potential issue is, if you happen to be installing the >> rice example along with any other gbrowse_syn data sources, ensure >> that all are using the same extension for species config file (.conf >> or .syn), set using the config extension option. >> >> config_extension = conf >> >> The documentation for the main config file is here: >> http://gmod.org/wiki/GBrowse_syn_Configuration >> >> Sheldon >> >> >> On Tue, Oct 13, 2009 at 7:01 PM, Wes Barris <wes.barris@...> wrote: >>> >>> Sheldon McKay wrote: >>> >>>>> Also, the example .aln file has lines in this form: >>>>> >>>>> wild_rice-3(+)/11552824-11552969 gctgttcacacctaggtctctcccat >>>>> rice-3(+)/12788183-12788328 gctgttcacacctaggtctctcccat >>>>> ************************** >>>>> >>>>> Do "wild_rice" and "rice" in these lines correspond to any of >>>>> the columns in the "source_map" configuration? If not, what >>>>> do they correspond to? >>>> >>>> The first part of the sequence names correspond to the symbolic source >>>> name (column 1). Another note on names: Until we standardize metadata >>>> for the multiple sequence alignments, the sequence name has to be >>>> overloaded with the strand and coordinate range, making the >>>> "(+)/12788183-12788328" (for example) mandatory. >>> >>> Hi Sheldon, >>> >>> To test this I changed all occurrences of "rice" to "ricx" in the >>> oryza.synconf file and also did the same change on the .aln file. >>> I reloaded the .aln file and tried to access the URL of gbrowse_syn. >>> I get this error in the displayed page: >>> >>> Software error: >>> >>> Usage: GD::Image::colorAllocateAlpha(image, r, g, b, a) at >>> /htdocs/gbrowse/gbrowse_syn.cgi line 515. >>> >>> These errors also appear in the apache error logs: >>> >>> [Wed Oct 14 08:54:13 2009] [error] [client 140.253.153.217] [Wed Oct 14 >>> 08:54:13 2009] gbrowse_syn.cgi: Use of uninitialized value in hash >>> element >>> at /usr/lib/perl5/site_perl/5.8.5/Bio/Graphics/Panel.pm line 1200., >>> referer: >>> >>> https://www.biolives.csiro.au/perl/gbrowse_syn.cgi/test/?search_src=ricx;name=3:16050173..16064974 >>> [Wed Oct 14 08:54:13 2009] [error] [client 140.253.153.217] [Wed Oct 14 >>> 08:54:13 2009] gbrowse_syn.cgi: Usage: >>> GD::Image::colorAllocateAlpha(image, >>> r, g, b, a) at /htdocs/gbrowse/gbrowse_syn.cgi line 515., referer: >>> >>> https://www.biolives.csiro.au/perl/gbrowse_syn.cgi/test/?search_src=ricx;name=3:16050173..16064974 >>> >>> The trimmed down .aln file I am using is: >>> >>> CLUSTAL W(1.81) multiple sequence alignment W(1.81) >>> >>> >>> wild_ricx-3(+)/11552824-11552969 >>> ttccgatccatcgtctaagataaaatacagagttgcccgcctctcccttcccacatcgac >>> ricx-3(+)/12788183-12788328 >>> ttccgatccatcgtctaagataaaatacagagttgcccgcctctcccttcccacatcggc >>> >>> ********************************************************** * >>> >>> >>> wild_ricx-3(+)/11552824-11552969 >>> attagcacggggagcttgcatggcaagcgagatcgatcgatgcatggacgcccccccccg >>> ricx-3(+)/12788183-12788328 >>> attagcacggggagcttgcatggcaagcgagatcgatcgatgcatggacgcccccccccg >>> >>> ************************************************************ >>> >>> >>> wild_ricx-3(+)/11552824-11552969 gctgttcacacctaggtctctcccat >>> ricx-3(+)/12788183-12788328 gctgttcacacctaggtctctcccat >>> ************************** >>> >>> The .synconf file I am using is: >>> >>> [GENERAL] >>> description = BLASTZ alignments for Oryza sativa >>> >>> # The synteny database >>> join = >>> dbi:mysql:database=umdbcm_synteny;host=biodata.sl.csiro.au;user=nobody >>> >>> # src symbolic src Description >>> source_map = ricx rice "Domesic Rice (O. sativa)" >>> wild_ricx wild_rice "Wild Rice" >>> >>> tmpimages = /gbrowse/tmp >>> imagewidth = 800 >>> stylesheet = /gbrowse/gbrowse.css >>> cache time = 1 >>> >>> config_extension = conf >>> >>> # example searches to display >>> examples = ricx 3:16050173..16064974 >>> wild_ricx 3:1..400000 >>> >>> zoom levels = 5000 10000 25000 50000 100000 200000 400000 >>> >>> # species-specific databases >>> [ricx] >>> tracks = EG >>> color = blue >>> >>> [wild_ricx] >>> tracks = EG >>> color = red >>> >>> >>> I have not changed rice.conf or wild_rice.conf. >>> >>> -- >>> Wes Barris <wes.barris@...> >>> >> >> >> > > > -- > Wes Barris <wes.barris@...> > -- Sheldon McKay, PhD Cold Spring Harbor Laboratory Office/Mobile: 516-367-6998 / 203-893-1682 Sent from Milford, Connecticut, United States ------------------------------------------------------------------------------ Come build with us! The BlackBerry(R) Developer Conference in SF, CA is the only developer event you need to attend this year. Jumpstart your developing skills, take BlackBerry mobile applications to market and stay ahead of the curve. Join us from November 9 - 12, 2009. Register now! http://p.sf.net/sfu/devconference _______________________________________________ Gmod-gbrowse mailing list Gmod-gbrowse@... https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse |
| Free embeddable forum powered by Nabble | Forum Help |
