Nabble - gmod-gbrowse

Re: gff3 loading error

2009-11-22T14:41:45Z

Matthew Conte wrote:
> Hi Wes,
>
> Were you (or anyone else) able to track down this problem? I'm running
> into this error when running bp_seqfeature_load.pl
> <http://bp_seqfeature_load.pl> after upgrading to bioperl 1.6 from 1.5.
> I can point to my 1.5 install to get bp_seqfeature_load.pl
> <http://bp_seqfeature_load.pl> to run, but I figured I'd mention you're
> not the only one seeing this.

Hi Matt,

I was never able to solve that problem. In my case, I had to back down
from bioperl-live and reinstall bioperl-1.6 which works fine for me.

Sorry.

> -Matt
>
> On Sun, Oct 4, 2009 at 11:47 PM, Wes Barris <wes.barris@...> wrote:
>
> Hi,
>
> I just updated bioperl-live on our system. Now, I can no longer load
> a .gff3 file using bp_seqfeature_load.pl
> <http://bp_seqfeature_load.pl>. When I try, I get these
> errors:
>
> wes@biodata> bp_seqfeature_load.pl <http://bp_seqfeature_load.pl> -d
> rachel -f -c junk.gff3 *-*.gff3
> DBD::mysql::db do failed: BLOB/TEXT column 'tag' used in key
> specification without a key length at
> /usr/lib/perl5/site_perl/5.8.5/Bio/DB/SeqFeature/Store/DBI/mysql.pm
> <http://mysql.pm> line 450.
>
> -------------------- EXCEPTION --------------------
> MSG: BLOB/TEXT column 'tag' used in key specification without a key
> length
> STACK Bio::DB::SeqFeature::Store::DBI::mysql::_create_table
> /usr/lib/perl5/site_perl/5.8.5/Bio/DB/SeqFeature/Store/DBI/mysql.pm:450
> <http://mysql.pm:450>
> STACK Bio::DB::SeqFeature::Store::DBI::mysql::_init_database
> /usr/lib/perl5/site_perl/5.8.5/Bio/DB/SeqFeature/Store/DBI/mysql.pm:425
> <http://mysql.pm:425>
> STACK Bio::DB::SeqFeature::Store::init_database
> /usr/lib/perl5/site_perl/5.8.5/Bio/DB/SeqFeature/Store.pm:407
> STACK Bio::DB::SeqFeature::Store::DBI::mysql::init
> /usr/lib/perl5/site_perl/5.8.5/Bio/DB/SeqFeature/Store/DBI/mysql.pm:223
> <http://mysql.pm:223>
> STACK Bio::DB::SeqFeature::Store::new
> /usr/lib/perl5/site_perl/5.8.5/Bio/DB/SeqFeature/Store.pm:370
> STACK toplevel /usr/bin/bp_seqfeature_load.pl:85
> <http://bp_seqfeature_load.pl:85>
> -------------------------------------------
>
> I know that this may really be a bioperl question, but I wanted to
> post here to see if perhaps I should not be using bioperl-live with
> gbrowse.
> --
> Wes Barris <wes.barris@...>
>
> ------------------------------------------------------------------------------
> Come build with us! The BlackBerry® Developer Conference in SF, CA
> is the only developer event you need to attend this year. Jumpstart your
> developing skills, take BlackBerry mobile applications to market and
> stay
> ahead of the curve. Join us from November 9-12, 2009. Register
> now!
> http://p.sf.net/sfu/devconf
> _______________________________________________
> Gmod-gbrowse mailing list
> Gmod-gbrowse@...
> <mailto:Gmod-gbrowse@...>
> https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
>
>

--
Wes Barris <wes.barris@...>

------------------------------------------------------------------------------
Let Crystal Reports handle the reporting - Free Crystal Reports 2008 30-Day
trial. Simplify your report design, integration and deployment - and focus on
what you do best, core application coding. Discover what's new with
Crystal Reports now. http://p.sf.net/sfu/bobj-july
_______________________________________________
Gmod-gbrowse mailing list
Gmod-gbrowse@...
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse

Re: gff3 loading error

2009-11-22T08:39:31Z

Hi all,

Was your GFF3 file created from a GTF file using the gtf2gff3 script?

I discovered some errors in this (and the supplied config file) when using the resulting files as an in memory database.

One of the problems was that the config file causes the Name attribute tag to be written in all upper case which is incorrect. The other issue relates to the same attribute column. The final attribute of each record was being written with a trailing '; '. I think this may be your problem below.

You can check this by loading your gff3 file (or part of it) into this:

http://dev.wormbase.org/db/validate_gff3/validate_gff3_online

I've attached a corrected version of this and the config file.

I tried to report this to the author in the readme file but the email address is no longer valid.

Hope this helps.

Regards,

Keiran Raine

Senior Computer Biologist

The Cancer Genome Project

Ext: 2100

kr2@...

The Wellcome Trust Sanger Institute is operated by Genome Research
Limited, a charity registered in England with number 1021457 and a
company registered in England with number 2742969, whose registered
office is 215 Euston Road, London, NW1 2BE.

On 20 Nov 2009, at 22:51, Matthew Conte wrote:

Hi Wes,

Were you (or anyone else) able to track down this problem? I'm running into this error when running bp_seqfeature_load.pl after upgrading to bioperl 1.6 from 1.5. I can point to my 1.5 install to get bp_seqfeature_load.pl to run, but I figured I'd mention you're not the only one seeing this.

-Matt

On Sun, Oct 4, 2009 at 11:47 PM, Wes Barris <wes.barris@...> wrote:
Hi,

I just updated bioperl-live on our system. Now, I can no longer load
a .gff3 file using bp_seqfeature_load.pl. When I try, I get these
errors:

wes@biodata> bp_seqfeature_load.pl -d rachel -f -c junk.gff3 *-*.gff3
DBD::mysql::db do failed: BLOB/TEXT column 'tag' used in key specification without a key length at /usr/lib/perl5/site_perl/5.8.5/Bio/DB/SeqFeature/Store/DBI/mysql.pm line 450.

-------------------- EXCEPTION --------------------
MSG: BLOB/TEXT column 'tag' used in key specification without a key length
STACK Bio::DB::SeqFeature::Store::DBI::mysql::_create_table /usr/lib/perl5/site_perl/5.8.5/Bio/DB/SeqFeature/Store/DBI/mysql.pm:450
STACK Bio::DB::SeqFeature::Store::DBI::mysql::_init_database /usr/lib/perl5/site_perl/5.8.5/Bio/DB/SeqFeature/Store/DBI/mysql.pm:425
STACK Bio::DB::SeqFeature::Store::init_database /usr/lib/perl5/site_perl/5.8.5/Bio/DB/SeqFeature/Store.pm:407
STACK Bio::DB::SeqFeature::Store::DBI::mysql::init /usr/lib/perl5/site_perl/5.8.5/Bio/DB/SeqFeature/Store/DBI/mysql.pm:223
STACK Bio::DB::SeqFeature::Store::new /usr/lib/perl5/site_perl/5.8.5/Bio/DB/SeqFeature/Store.pm:370
STACK toplevel /usr/bin/bp_seqfeature_load.pl:85
-------------------------------------------

I know that this may really be a bioperl question, but I wanted to
post here to see if perhaps I should not be using bioperl-live with
gbrowse.
--
Wes Barris <wes.barris@...>

------------------------------------------------------------------------------
Come build with us! The BlackBerry® Developer Conference in SF, CA
is the only developer event you need to attend this year. Jumpstart your
developing skills, take BlackBerry mobile applications to market and stay
ahead of the curve. Join us from November 9-12, 2009. Register now!
http://p.sf.net/sfu/devconf
_______________________________________________
Gmod-gbrowse mailing list
Gmod-gbrowse@...
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse

------------------------------------------------------------------------------
Let Crystal Reports handle the reporting - Free Crystal Reports 2008 30-Day
trial. Simplify your report design, integration and deployment - and focus on
what you do best, core application coding. Discover what's new with
Crystal Reports now. http://p.sf.net/sfu/bobj-july_______________________________________________
Gmod-gbrowse mailing list
Gmod-gbrowse@...
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse

------------------------------------------------------------------------------
Let Crystal Reports handle the reporting - Free Crystal Reports 2008 30-Day
trial. Simplify your report design, integration and deployment - and focus on
what you do best, core application coding. Discover what's new with
Crystal Reports now. http://p.sf.net/sfu/bobj-july
_______________________________________________
Gmod-gbrowse mailing list
Gmod-gbrowse@...
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse

gtf2gff3 (47K) Download Attachment
gtf2gff3.cfg (3K) Download Attachment

Bioperl Mysql documentation

2009-11-20T17:44:05Z

Does anyone know where I could get documentation on bioperl integration with gbrowse and mysql? I found some information in the documentation files attached to installation about bp_seqfeature_load.pl but I couldn't find any information on other bioperl files available for database.

Re: gff3 loading error

2009-11-20T14:51:35Z

Hi Wes,

Were you (or anyone else) able to track down this problem? I'm running into this error when running bp_seqfeature_load.pl after upgrading to bioperl 1.6 from 1.5. I can point to my 1.5 install to get bp_seqfeature_load.pl to run, but I figured I'd mention you're not the only one seeing this.

-Matt

On Sun, Oct 4, 2009 at 11:47 PM, Wes Barris <wes.barris@...> wrote:

Hi,

I just updated bioperl-live on our system. Now, I can no longer load
a .gff3 file using bp_seqfeature_load.pl. When I try, I get these
errors:

wes@biodata> bp_seqfeature_load.pl -d rachel -f -c junk.gff3 *-*.gff3
DBD::mysql::db do failed: BLOB/TEXT column 'tag' used in key specification without a key length at /usr/lib/perl5/site_perl/5.8.5/Bio/DB/SeqFeature/Store/DBI/mysql.pm line 450.

-------------------- EXCEPTION --------------------
MSG: BLOB/TEXT column 'tag' used in key specification without a key length
STACK Bio::DB::SeqFeature::Store::DBI::mysql::_create_table /usr/lib/perl5/site_perl/5.8.5/Bio/DB/SeqFeature/Store/DBI/mysql.pm:450
STACK Bio::DB::SeqFeature::Store::DBI::mysql::_init_database /usr/lib/perl5/site_perl/5.8.5/Bio/DB/SeqFeature/Store/DBI/mysql.pm:425
STACK Bio::DB::SeqFeature::Store::init_database /usr/lib/perl5/site_perl/5.8.5/Bio/DB/SeqFeature/Store.pm:407
STACK Bio::DB::SeqFeature::Store::DBI::mysql::init /usr/lib/perl5/site_perl/5.8.5/Bio/DB/SeqFeature/Store/DBI/mysql.pm:223
STACK Bio::DB::SeqFeature::Store::new /usr/lib/perl5/site_perl/5.8.5/Bio/DB/SeqFeature/Store.pm:370
STACK toplevel /usr/bin/bp_seqfeature_load.pl:85
-------------------------------------------

I know that this may really be a bioperl question, but I wanted to
post here to see if perhaps I should not be using bioperl-live with
gbrowse.
--
Wes Barris <wes.barris@...>

------------------------------------------------------------------------------
Come build with us! The BlackBerry® Developer Conference in SF, CA
is the only developer event you need to attend this year. Jumpstart your
developing skills, take BlackBerry mobile applications to market and stay
ahead of the curve. Join us from November 9-12, 2009. Register now!
http://p.sf.net/sfu/devconf
_______________________________________________
Gmod-gbrowse mailing list
Gmod-gbrowse@...
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse

wiggle and negative values

2009-11-20T12:08:54Z

Does wiggle work with negative values?

=====================================

Jim Hu

Associate Professor

Dept. of Biochemistry and Biophysics

2128 TAMU

Texas A&M Univ.

College Station, TX 77843-2128

979-862-4054

Re: GBrowse2 as non-root

2009-11-20T10:19:20Z

Good morning,

I'm wondering if anyone might know the answer to the question below,
we're still stuck trying to install Gbrowse 2 as a non-root user.

Thanks!

Matthew Laird wrote:

> Good afternoon,
>
> Is there a way to install Gbrowse2 as non-root? I have Bioperl 1.5.x
> installed in the system perl installation which I don't want to upgrade
> due to the number of systems in our cluster that depend on it and could
> break.
>
> I've installed Bioperl 1.6.1 in a separate directory and I'd like to
> install all the Gbrowse2 perl libraries there as well. I know with
> Gbrowse 1 there was a way to do this, however I can't see anything in
> the documentation describing this for GBrowse2.
>
> Thanks!
>

--
Matthew Laird
Lead Software Developer, Bioinformatics
Brinkman Laboratory, MBB Dept.
Simon Fraser University

------------------------------------------------------------------------------
Let Crystal Reports handle the reporting - Free Crystal Reports 2008 30-Day
trial. Simplify your report design, integration and deployment - and focus on
what you do best, core application coding. Discover what's new with
Crystal Reports now. http://p.sf.net/sfu/bobj-july
_______________________________________________
Gmod-gbrowse mailing list
Gmod-gbrowse@...
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse

How to deal with Query inserts that don't map to the reference

2009-11-20T10:13:01Z

I am aligning EST data from species x to the genomic sequence from
species y in order to display this data on a GBrowse implementation
for species y where its genomic is the reference.

In some cases I am finding inserts in species x that are not present
in species y. I searched the mailing ;list but I can't seem to find a
post on how to represent this data. Intuitively you picture a loop in
the query so that all the query is displayed including that which does
not have coordinates on the reference genome.

Is there a glyph that allows me to visualize this insertion somehow?

Also, how should the insert be represented in the GFF? All I can think
of is to put details of the insertion in the note and keep the
coordinates as the two bases between which the insertion occurs. Does
anyone else have any ideas?

Thanks!
Lacey

------------------------------------------------------------------------------
Let Crystal Reports handle the reporting - Free Crystal Reports 2008 30-Day
trial. Simplify your report design, integration and deployment - and focus on
what you do best, core application coding. Discover what's new with
Crystal Reports now. http://p.sf.net/sfu/bobj-july
_______________________________________________
Gmod-gbrowse mailing list
Gmod-gbrowse@...
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse

Liisa Koski is out of the office.

2009-11-20T09:11:47Z

I will be out of the office starting 2009-11-19 and will not return until
2009-11-23.

In case of an urgent request please email support@...

Thank you,
Liisa

------------------------------------------------------------------------------
Let Crystal Reports handle the reporting - Free Crystal Reports 2008 30-Day
trial. Simplify your report design, integration and deployment - and focus on
what you do best, core application coding. Discover what's new with
Crystal Reports now. http://p.sf.net/sfu/bobj-july
_______________________________________________
Gmod-gbrowse mailing list
Gmod-gbrowse@...
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse

Re: sam/bam in gBrowse2

2009-11-20T08:09:25Z

Hi Lincoln,

Can you tell me how I can make the following changes (at 100bp level)?

1. change the base colour for mismatch bases (currently white on grey)

2. change the colour of the text for 'n's. (currently grey on green)

My config is as below (taken from gBrowse2 tutorial, with labels turned off).

Please let me know if the full range of options are documented somewhere and I'll leave you alone.

Kind Regards,

Keiran

[Pair]

feature = read_pair

glyph = segments

database = humansam

draw_target = 1

show_mismatch = 1

bgcolor = sub {

my $f = shift;

return $f->attributes('M_UNMAPPED') ? 'red' : 'green';

}

fgcolor = green

height = 3

label =

label density = 50

bump = fast

connector = dashed

balloon hover = sub {

my $f = shift;

return '' unless $f->type eq 'match';

return 'Read: '.$f->display_name.' : '.$f->flag_str;

}

key = Read Pairs

category = Reads

Keiran Raine

Senior Computer Biologist

The Cancer Genome Project

Ext: 2100

kr2@...

On 20 Nov 2009, at 14:32, Lincoln Stein wrote:

Hi Keiran,

It will run well without the fa and fai files. The only anomaly is that the ability to highlight mismatched bases when zoomed into the base level will be lost. The glyph architecture is set up in a way that makes it difficult for one track to get access to information stored in another track's database.

Lincoln

On Fri, Nov 20, 2009 at 6:26 AM, Keiran Raine <kr2@...> wrote:
Hi,

Does anyone know if the fa and fai of your genome is required when
defining a Bio::DB::Sam track?

I already have the fasta sequence stored in mysql for my annotations.

Thanks

Keiran Raine
Senior Computer Biologist
The Cancer Genome Project
Ext: 2100
kr2@...

The Wellcome Trust Sanger Institute is operated by Genome Research
Limited, a charity registered in England with number 1021457 and a
company registered in England with number 2742969, whose registered
office is 215 Euston Road, London, NW1 2BE.

--
The Wellcome Trust Sanger Institute is operated by Genome Research
Limited, a charity registered in England with number 1021457 and a
company registered in England with number 2742969, whose registered
office is 215 Euston Road, London, NW1 2BE.

------------------------------------------------------------------------------
Let Crystal Reports handle the reporting - Free Crystal Reports 2008 30-Day
trial. Simplify your report design, integration and deployment - and focus on
what you do best, core application coding. Discover what's new with
Crystal Reports now. http://p.sf.net/sfu/bobj-july
_______________________________________________
Gmod-gbrowse mailing list
Gmod-gbrowse@...
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse

--
Lincoln D. Stein
Director, Informatics and Biocomputing Platform
Ontario Institute for Cancer Research
101 College St., Suite 800
Toronto, ON, Canada M5G0A3
416 673-8514
Assistant: Renata Musa <Renata.Musa@...>

-- The Wellcome Trust Sanger Institute is operated by Genome Research Limited, a charity registered in England with number 1021457 and a compa ny registered in England with number 2742969, whose registered office is 2 15 Euston Road, London, NW1 2BE.

------------------------------------------------------------------------------
Let Crystal Reports handle the reporting - Free Crystal Reports 2008 30-Day
trial. Simplify your report design, integration and deployment - and focus on
what you do best, core application coding. Discover what's new with
Crystal Reports now. http://p.sf.net/sfu/bobj-july
_______________________________________________
Gmod-gbrowse mailing list
Gmod-gbrowse@...
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse

Re: sam/bam in gBrowse2

2009-11-20T06:32:17Z

Hi Keiran,

It will run well without the fa and fai files. The only anomaly is that the ability to highlight mismatched bases when zoomed into the base level will be lost. The glyph architecture is set up in a way that makes it difficult for one track to get access to information stored in another track's database.

Lincoln

On Fri, Nov 20, 2009 at 6:26 AM, Keiran Raine <kr2@...> wrote:

Hi,

Does anyone know if the fa and fai of your genome is required when
defining a Bio::DB::Sam track?

I already have the fasta sequence stored in mysql for my annotations.

Thanks

Keiran Raine
Senior Computer Biologist
The Cancer Genome Project
Ext: 2100
kr2@...

The Wellcome Trust Sanger Institute is operated by Genome Research
Limited, a charity registered in England with number 1021457 and a
company registered in England with number 2742969, whose registered
office is 215 Euston Road, London, NW1 2BE.

--
The Wellcome Trust Sanger Institute is operated by Genome Research
Limited, a charity registered in England with number 1021457 and a
company registered in England with number 2742969, whose registered
office is 215 Euston Road, London, NW1 2BE.

------------------------------------------------------------------------------
Let Crystal Reports handle the reporting - Free Crystal Reports 2008 30-Day
trial. Simplify your report design, integration and deployment - and focus on
what you do best, core application coding. Discover what's new with
Crystal Reports now. http://p.sf.net/sfu/bobj-july
_______________________________________________
Gmod-gbrowse mailing list
Gmod-gbrowse@...
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse

--
Lincoln D. Stein
Director, Informatics and Biocomputing Platform
Ontario Institute for Cancer Research
101 College St., Suite 800
Toronto, ON, Canada M5G0A3
416 673-8514
Assistant: Renata Musa <Renata.Musa@...>

------------------------------------------------------------------------------
Let Crystal Reports handle the reporting - Free Crystal Reports 2008 30-Day
trial. Simplify your report design, integration and deployment - and focus on
what you do best, core application coding. Discover what's new with
Crystal Reports now. http://p.sf.net/sfu/bobj-july
_______________________________________________
Gmod-gbrowse mailing list
Gmod-gbrowse@...
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse

sam/bam in gBrowse2

2009-11-20T03:26:54Z

Hi,

Does anyone know if the fa and fai of your genome is required when
defining a Bio::DB::Sam track?

I already have the fasta sequence stored in mysql for my annotations.

Thanks

Keiran Raine
Senior Computer Biologist
The Cancer Genome Project
Ext: 2100
kr2@...

The Wellcome Trust Sanger Institute is operated by Genome Research
Limited, a charity registered in England with number 1021457 and a
company registered in England with number 2742969, whose registered
office is 215 Euston Road, London, NW1 2BE.

--
The Wellcome Trust Sanger Institute is operated by Genome Research
Limited, a charity registered in England with number 1021457 and a
company registered in England with number 2742969, whose registered
office is 215 Euston Road, London, NW1 2BE.

------------------------------------------------------------------------------
Let Crystal Reports handle the reporting - Free Crystal Reports 2008 30-Day
trial. Simplify your report design, integration and deployment - and focus on
what you do best, core application coding. Discover what's new with
Crystal Reports now. http://p.sf.net/sfu/bobj-july
_______________________________________________
Gmod-gbrowse mailing list
Gmod-gbrowse@...
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse

Re: help - diagnose

2009-11-19T20:55:18Z

Scott - Your points 2 and 3 (both) did the tricks. Wonderful!

I will try your point 1 out.

Thanks you!
Zhiliang

On Thu, 19 Nov 2009, Scott Cain wrote:

> Date: Thu, 19 Nov 2009 15:58:49 -0500
> From: Scott Cain <scott@...>
> To: Zhiliang <hu@...>
> Cc: gmod-gbrowse@...
> Subject: Re: [Gmod-gbrowse] help - diagnose
>
> Hi Zhiliang,
>
> I have a few suggestions:
>
> 1. GFF3 and Bio::DB::GFF databases (what you are using when you use
> bp_bulk_load_gff.pl) don't play particularly well together, so unless
> you have a compelling reason to do so, I would suggest using a
> Bio::DB::SeqFeature::Store database (using bp_seqfeature_load.pl to
> load it).
>
> 2. Be sure the GFF file is marked as GFF3 at the top with the directive:
>
> ##gff-version 3
>
> If that isn't present, it may explain the strange entry in your fgroup table.
>
> 3. The identifier used in the fasta file must be exactly the same as
> what is used in the GFF file. It looks like the identifier in your
> fasta file is 10, whereas the identifier in your GFF is Chr.10. It
> wouldn't hurt to add "ID=Chr.10" to column 9 of the chromosome line
> either.
>
>
> Scott
>
>
>
> On Wed, Nov 18, 2009 at 5:56 PM, Zhiliang <hu@...> wrote:
>> I am loading a fasta whole chromosome into gbrowse (new db):
>>
>> > bp_bulk_load_gff.pl -create -d gb_ssc chr10.fa chr10.gff3
>>
>> where
>> "chr10.fa":
>>> 10 dna_rm:chromosome chromosome:Sscrofa9:10:1:66741929:1
>> TAATTCCCGCCCTGAGGAGGGGGCGGGGGGCGAGATTGCTGGTTCCTTCGTGAGATTTT
>> ....
>>
>> "chr10.gff3":
>> Chr.10 Ensembl Chr_sequence 1 66741929 . + . Name=Chr.10
>> [just one line; all spaces are tabs;]
>>
>> but I cannot see it on gbrowse by seaching "Chr.10". Wonder what should I
>> look into?
>>
>> I browsed the mysql tables and 'fgroup' table has:
>> gid gclass gname
>> ---- ------------ ---------
>> 1 Name=Chr.10
>>
>> isn't this appear odd? Could you see if I did anything wrong?
>>
>> Zhiliang
>>
>>
> -----------------------------------------------------------------------------
> -
>> Let Crystal Reports handle the reporting - Free Crystal Reports 2008 30-Day
>> trial. Simplify your report design, integration and deployment - and focus
> on
>> what you do best, core application coding. Discover what's new with
>> Crystal Reports now. http://p.sf.net/sfu/bobj-july
>> _______________________________________________
>> Gmod-gbrowse mailing list
>> Gmod-gbrowse@...
>> https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
>>
>
>
>
> --
> ------------------------------------------------------------------------
> Scott Cain, Ph. D. scott at scottcain dot
> net
> GMOD Coordinator (http://gmod.org/) 216-392-3087
> Ontario Institute for Cancer Research
>

Re: help - diagnose

2009-11-19T12:58:49Z

Hi Zhiliang,

I have a few suggestions:

1. GFF3 and Bio::DB::GFF databases (what you are using when you use
bp_bulk_load_gff.pl) don't play particularly well together, so unless
you have a compelling reason to do so, I would suggest using a
Bio::DB::SeqFeature::Store database (using bp_seqfeature_load.pl to
load it).

2. Be sure the GFF file is marked as GFF3 at the top with the directive:

##gff-version 3

If that isn't present, it may explain the strange entry in your fgroup table.

3. The identifier used in the fasta file must be exactly the same as
what is used in the GFF file. It looks like the identifier in your
fasta file is 10, whereas the identifier in your GFF is Chr.10. It
wouldn't hurt to add "ID=Chr.10" to column 9 of the chromosome line
either.

Scott

On Wed, Nov 18, 2009 at 5:56 PM, Zhiliang <hu@...> wrote:

> I am loading a fasta whole chromosome into gbrowse (new db):
>
> > bp_bulk_load_gff.pl -create -d gb_ssc chr10.fa chr10.gff3
>
> where
> "chr10.fa":
>>10 dna_rm:chromosome chromosome:Sscrofa9:10:1:66741929:1
> TAATTCCCGCCCTGAGGAGGGGGCGGGGGGCGAGATTGCTGGTTCCTTCGTGAGATTTT
> ....
>
> "chr10.gff3":
> Chr.10 Ensembl Chr_sequence 1 66741929 . + . Name=Chr.10
> [just one line; all spaces are tabs;]
>
> but I cannot see it on gbrowse by seaching "Chr.10". Wonder what should I
> look into?
>
> I browsed the mysql tables and 'fgroup' table has:
> gid gclass gname
> ---- ------------ ---------
> 1 Name=Chr.10
>
> isn't this appear odd? Could you see if I did anything wrong?
>
> Zhiliang
>
> ------------------------------------------------------------------------------
> Let Crystal Reports handle the reporting - Free Crystal Reports 2008 30-Day
> trial. Simplify your report design, integration and deployment - and focus on
> what you do best, core application coding. Discover what's new with
> Crystal Reports now. http://p.sf.net/sfu/bobj-july
> _______________________________________________
> Gmod-gbrowse mailing list
> Gmod-gbrowse@...
> https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
>

--
------------------------------------------------------------------------
Scott Cain, Ph. D. scott at scottcain dot net
GMOD Coordinator (http://gmod.org/) 216-392-3087
Ontario Institute for Cancer Research

------------------------------------------------------------------------------
Let Crystal Reports handle the reporting - Free Crystal Reports 2008 30-Day
trial. Simplify your report design, integration and deployment - and focus on
what you do best, core application coding. Discover what's new with
Crystal Reports now. http://p.sf.net/sfu/bobj-july
_______________________________________________
Gmod-gbrowse mailing list
Gmod-gbrowse@...
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse

Re: gbrowse_syn for GBrowse2

2009-11-19T12:58:14Z

Santa's elves are working on it. ;-)

Lincoln

On Fri, Nov 13, 2009 at 9:13 AM, Rudi van Bavel <rudivanbavel@...> wrote:

Hi,

I'm currently using GBrowse 2 and I am very happy with the project. My
compliments. I'm also very interested in the GBrowse_syn viewer. The
only thing is, that currently gbrowse_syn is part of the GBrowse 1.x
branch. I've read that GBrowse_Syn for GBrowse 2 is currently under
development. I could not find any trace of gbrowse_syn in the svn
repository of GBrowse 2. My question is, do you expect this to be
released shortly (within a couple of months for the
testing-/development version) or will it take significant longer.
I know i can put gbrowse 1.7 next to gbrowse 2 on the same machine,
and having the synteny browser available for our gbrowse 2 this way,
but this is not the ideal solution. Can I otherwise use the
configuration files for gbrowse 2 with gbrowse_syn from the 1.7
release? This could be a workaround until gbrowse_syn is released for
gbrowse2.

I'm looking forward for any news surrounding gbrowse_syn.

Rudi.

------------------------------------------------------------------------------
Let Crystal Reports handle the reporting - Free Crystal Reports 2008 30-Day
trial. Simplify your report design, integration and deployment - and focus on
what you do best, core application coding. Discover what's new with
Crystal Reports now. http://p.sf.net/sfu/bobj-july
_______________________________________________
Gmod-gbrowse mailing list
Gmod-gbrowse@...
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse

Re: XyPLots using Chado

2009-11-19T10:40:51Z

Hi Shane,

You can definitely use wiggle files with Chado: in the conversion of
the wig file to its binary format, a one line GFF3 file is created.
Load that GFF into Chado and the wig file is available to you.

For GBrowse2: yes it is under active development, but the core
functionality (what you typically think of as GBrowse) is fairly
stable.

Scott

On Thu, Nov 19, 2009 at 1:28 PM, Shane Brubaker
<SBrubaker@...> wrote:

> Thanks very much Scott!
>
> When you say use wig files instead, do you mean that I could mix using files and chado in the same Gbrowse?
>
> I had originally decided to use Gbrowse because I thought Gbrowse2 was still very much under development. Do you think I should plan on switching to Gbrowse2 soon?
>
>
>
> -----Original Message-----
> From: Scott Cain [mailto:scott@...]
> Sent: Wednesday, November 18, 2009 8:24 PM
> To: Shane Brubaker
> Cc: GMOD GBrowse List
> Subject: Re: [Gmod-gbrowse] XyPLots using Chado
>
> Hi Shane,
>
> It is possible to put data that you can use for xy plots in Chado, but
> it is probably going to be less than optimal from most cases. To do
> so, you just need to create a feature that spans the region, and then
> have the individual points/subregions are features that have the big
> region as a parent, like this:
>
> Chr1 . region 1 200000 . . . ID=plot_Chr1
> Chr1 . oligo 1 100 123 . . Parent=plot_Chr1
> Chr1 . oligo 101 200 3 . . Parent=plot_Chr1
>
> However, for any reasonably large dataset, this will probably end up
> being very slow. Your alternatives include:
>
> 1. Using wig files instead.
>
> 2. Using GBrowse2, and putting the xy data in a seqfeature::Store
> database while your annotations remain in a Chado database.
>
> Scott
>
>
> On Wed, Nov 18, 2009 at 5:03 PM, Shane Brubaker
> <SBrubaker@...> wrote:
>> Hi, can anyone give me a brief tutorial on adding an XYPlot to Gbrowse using Chado?
>>
>> I noticed in the conf file it says not to use Aggregators with Chado, but the main example I have for an XYPLot comes from the Gbrowse tutorial, and this uses aggregators.
>>
>>
>> Thanks,
>> Shane
>>
>> This email and any attachments thereto may contain private, confidential, and privileged material for the sole use of the intended recipient. Any review, copying, or distribution of this email (or any attachments thereto) by others is strictly prohibited. If you are not the intended recipient, please contact the sender immediately and permanently delete the original and any copies of this email and any attachments thereto.
>>
>> ------------------------------------------------------------------------------
>> Let Crystal Reports handle the reporting - Free Crystal Reports 2008 30-Day
>> trial. Simplify your report design, integration and deployment - and focus on
>> what you do best, core application coding. Discover what's new with
>> Crystal Reports now. http://p.sf.net/sfu/bobj-july
>> _______________________________________________
>> Gmod-gbrowse mailing list
>> Gmod-gbrowse@...
>> https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
>>
>
>
>
> --
> ------------------------------------------------------------------------
> Scott Cain, Ph. D. scott at scottcain dot net
> GMOD Coordinator (http://gmod.org/) 216-392-3087
> Ontario Institute for Cancer Research
>

Re: XyPLots using Chado

2009-11-19T10:28:05Z

Thanks very much Scott!

When you say use wig files instead, do you mean that I could mix using files and chado in the same Gbrowse?

I had originally decided to use Gbrowse because I thought Gbrowse2 was still very much under development. Do you think I should plan on switching to Gbrowse2 soon?

-----Original Message-----
From: Scott Cain [mailto:scott@...]
Sent: Wednesday, November 18, 2009 8:24 PM
To: Shane Brubaker
Cc: GMOD GBrowse List
Subject: Re: [Gmod-gbrowse] XyPLots using Chado

Hi Shane,

It is possible to put data that you can use for xy plots in Chado, but
it is probably going to be less than optimal from most cases. To do
so, you just need to create a feature that spans the region, and then
have the individual points/subregions are features that have the big
region as a parent, like this:

Chr1 . region 1 200000 . . . ID=plot_Chr1
Chr1 . oligo 1 100 123 . . Parent=plot_Chr1
Chr1 . oligo 101 200 3 . . Parent=plot_Chr1

However, for any reasonably large dataset, this will probably end up
being very slow. Your alternatives include:

1. Using wig files instead.

2. Using GBrowse2, and putting the xy data in a seqfeature::Store
database while your annotations remain in a Chado database.

Scott

On Wed, Nov 18, 2009 at 5:03 PM, Shane Brubaker
<SBrubaker@...> wrote:

> Hi, can anyone give me a brief tutorial on adding an XYPlot to Gbrowse using Chado?
>
> I noticed in the conf file it says not to use Aggregators with Chado, but the main example I have for an XYPLot comes from the Gbrowse tutorial, and this uses aggregators.
>
>
> Thanks,
> Shane
>
> This email and any attachments thereto may contain private, confidential, and privileged material for the sole use of the intended recipient. Any review, copying, or distribution of this email (or any attachments thereto) by others is strictly prohibited. If you are not the intended recipient, please contact the sender immediately and permanently delete the original and any copies of this email and any attachments thereto.
>
> ------------------------------------------------------------------------------
> Let Crystal Reports handle the reporting - Free Crystal Reports 2008 30-Day
> trial. Simplify your report design, integration and deployment - and focus on
> what you do best, core application coding. Discover what's new with
> Crystal Reports now. http://p.sf.net/sfu/bobj-july
> _______________________________________________
> Gmod-gbrowse mailing list
> Gmod-gbrowse@...
> https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
>

Re: GBrowse 2 on Mac

2009-11-19T05:11:10Z

Hi Keiran,

I'm attaching my gbrowse.conf apache file; chances are, it will work
for you too if you put it in the same place (/etc/apache2/conf.d/).
Restart apache after placing it.

Scott

On Thu, Nov 19, 2009 at 8:03 AM, Keiran Raine <kr2@...> wrote:

> Hi,
>
> I don't think the changes for the apache config were created.
>
> Looking at the README (in the 1.9971 tar) The following fails:
>
> ./Build apache_config
> No action 'apache_config' defined, try running the 'help' action.
>
> Thanks,
>
>
> Keiran Raine
> Senior Computer Biologist
> The Cancer Genome Project
> Ext: 2100
> kr2@...
>
> The Wellcome Trust Sanger Institute is operated by Genome Research
> Limited, a charity registered in England with number 1021457 and a
> company registered in England with number 2742969, whose registered
> office is 215 Euston Road, London, NW1 2BE.
>
>
>
> On 19 Nov 2009, at 12:59, Scott Cain wrote:
>
>> /etc/apache2/conf.d/gbrowse2.conf
>
>
>
> --
> The Wellcome Trust Sanger Institute is operated by Genome Research Limited,
> a charity registered in England with number 1021457 and a company registered
> in England with number 2742969, whose registered office is 215 Euston Road,
> London, NW1 2BE.
>

gbrowse2.conf (1K) Download Attachment

Re: GBrowse 2 on Mac

2009-11-19T04:59:11Z

Hi Keiran,

The url looks correct to me, though I don't have mod_perl on this
system. Did you restart apache after installing GBrowse? You should
also check that the GBrowse apache conf got installed where it should
have (probably /etc/apache2/conf.d/gbrowse2.conf).

Scott

On Thu, Nov 19, 2009 at 7:54 AM, Keiran Raine <kr2@...> wrote:

> Yes, you are correct, I just discovered this, is the one for the mod perl
> correct? I've activated it but I'm getting the same type of error.
>
> Thanks
>
>
> Keiran Raine
> Senior Computer Biologist
> The Cancer Genome Project
> Ext: 2100
> kr2@...
>
> The Wellcome Trust Sanger Institute is operated by Genome Research
> Limited, a charity registered in England with number 1021457 and a
> company registered in England with number 2742969, whose registered
> office is 215 Euston Road, London, NW1 2BE.
>
>
>
> On 19 Nov 2009, at 12:52, Scott Cain wrote:
>
>> Hi Keiran,
>>
>> GBrowse 2 is probably working fine on your Mac, just the url in the
>> GBrowse2 homepage at http://localhost/gbrowse2 is broken. Try this
>> url instead:
>>
>> http://localhost/cgi-bin/gb2/gbrowse/yeast/
>>
>> Scott
>>
>>
>> On Thu, Nov 19, 2009 at 4:15 AM, Keiran Raine <kr2@...> wrote:
>>>
>>> Hi,
>>> I recently installed the 1.7 version of GBrowse on my Mac and it all went
>>> well using Fink. I managed to get out inhouse data working and was very
>>> happy with the simple configuration. I have now attempted to install
>>> GBrowse2 following the directions in the NGS tutorial but although all
>>> sees
>>> to install fine when I select the example yeast database I get the
>>> following:
>>> The requested URL /Library/Webserver/CGI-Executables/gb2/gbrowse/yeast
>>> was
>>> not found on this server.
>>> Does anyone know what the problem is likely to be? This location exists:
>>> ls -l /Library/Webserver/CGI-Executables/gb2
>>> -r-xr-xr-x 1 root admin 1.2K 18 Nov 16:32 gbgff*
>>> -r-xr-xr-x 1 root admin 855B 18 Nov 16:32 gbrowse*
>>> -r-xr-xr-x 1 root admin 18K 18 Nov 16:32 gbrowse_details*
>>> -r-xr-xr-x 1 root admin 21K 18 Nov 16:32 gbrowse_gmap*
>>> -r-xr-xr-x 1 root admin 21K 18 Nov 16:32 gbrowse_img*
>>> and I assume that the '/yeast' is used as parameter to the gbrowse
>>> script.
>>> Any help very welcome.
>>> Kind regards,
>>>
>>> Keiran Raine
>>> Senior Computer Biologist
>>> The Cancer Genome Project
>>> Ext: 2100
>>> kr2@...
>>> The Wellcome Trust Sanger Institute is operated by Genome Research
>>> Limited, a charity registered in England with number 1021457 and a
>>> company registered in England with number 2742969, whose registered
>>> office is 215 Euston Road, London, NW1 2BE.
>>>
>>>
>>>
>>> -- The Wellcome Trust Sanger Institute is operated by Genome Research
>>> Limited, a charity registered in England with number 1021457 and a compa
>>> ny
>>> registered in England with number 2742969, whose registered office is 2
>>> 15
>>> Euston Road, London, NW1 2BE.
>>>
>>>
>>> ------------------------------------------------------------------------------
>>> Let Crystal Reports handle the reporting - Free Crystal Reports 2008
>>> 30-Day
>>> trial. Simplify your report design, integration and deployment - and
>>> focus
>>> on
>>> what you do best, core application coding. Discover what's new with
>>> Crystal Reports now. http://p.sf.net/sfu/bobj-july
>>> _______________________________________________
>>> Gmod-gbrowse mailing list
>>> Gmod-gbrowse@...
>>> https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
>>>
>>>
>>
>>
>>
>> --
>> ------------------------------------------------------------------------
>> Scott Cain, Ph. D. scott at scottcain
>> dot net
>> GMOD Coordinator (http://gmod.org/) 216-392-3087
>> Ontario Institute for Cancer Research
>
>
>
> --
> The Wellcome Trust Sanger Institute is operated by Genome ResearchLimited, a
> charity registered in England with number 1021457 and acompany registered in
> England with number 2742969, whose registeredoffice is 215 Euston Road,
> London, NW1 2BE.
>

Re: GBrowse 2 on Mac

2009-11-19T04:54:52Z

Yes, you are correct, I just discovered this, is the one for the mod
perl correct? I've activated it but I'm getting the same type of error.

Thanks

Keiran Raine
Senior Computer Biologist
The Cancer Genome Project
Ext: 2100
kr2@...

The Wellcome Trust Sanger Institute is operated by Genome Research
Limited, a charity registered in England with number 1021457 and a
company registered in England with number 2742969, whose registered
office is 215 Euston Road, London, NW1 2BE.

On 19 Nov 2009, at 12:52, Scott Cain wrote:

> Hi Keiran,
>
> GBrowse 2 is probably working fine on your Mac, just the url in the
> GBrowse2 homepage at http://localhost/gbrowse2 is broken. Try this
> url instead:
>
> http://localhost/cgi-bin/gb2/gbrowse/yeast/
>
> Scott
>
>
> On Thu, Nov 19, 2009 at 4:15 AM, Keiran Raine <kr2@...>
> wrote:
>> Hi,
>> I recently installed the 1.7 version of GBrowse on my Mac and it
>> all went
>> well using Fink. I managed to get out inhouse data working and was
>> very
>> happy with the simple configuration. I have now attempted to install
>> GBrowse2 following the directions in the NGS tutorial but although
>> all sees
>> to install fine when I select the example yeast database I get the
>> following:
>> The requested URL /Library/Webserver/CGI-Executables/gb2/gbrowse/
>> yeast was
>> not found on this server.
>> Does anyone know what the problem is likely to be? This location
>> exists:
>> ls -l /Library/Webserver/CGI-Executables/gb2
>> -r-xr-xr-x 1 root admin 1.2K 18 Nov 16:32 gbgff*
>> -r-xr-xr-x 1 root admin 855B 18 Nov 16:32 gbrowse*
>> -r-xr-xr-x 1 root admin 18K 18 Nov 16:32 gbrowse_details*
>> -r-xr-xr-x 1 root admin 21K 18 Nov 16:32 gbrowse_gmap*
>> -r-xr-xr-x 1 root admin 21K 18 Nov 16:32 gbrowse_img*
>> and I assume that the '/yeast' is used as parameter to the gbrowse
>> script.
>> Any help very welcome.
>> Kind regards,
>>
>> Keiran Raine
>> Senior Computer Biologist
>> The Cancer Genome Project
>> Ext: 2100
>> kr2@...
>> The Wellcome Trust Sanger Institute is operated by Genome Research
>> Limited, a charity registered in England with number 1021457 and a
>> company registered in England with number 2742969, whose registered
>> office is 215 Euston Road, London, NW1 2BE.
>>
>>
>>
>> -- The Wellcome Trust Sanger Institute is operated by Genome Research
>> Limited, a charity registered in England with number 1021457 and a
>> compa ny
>> registered in England with number 2742969, whose registered office
>> is 2 15
>> Euston Road, London, NW1 2BE.
>>
>> ------------------------------------------------------------------------------
>> Let Crystal Reports handle the reporting - Free Crystal Reports
>> 2008 30-Day
>> trial. Simplify your report design, integration and deployment -
>> and focus
>> on
>> what you do best, core application coding. Discover what's new with
>> Crystal Reports now. http://p.sf.net/sfu/bobj-july
>> _______________________________________________
>> Gmod-gbrowse mailing list
>> Gmod-gbrowse@...
>> https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
>>
>>
>
>
>
> --
> ------------------------------------------------------------------------
> Scott Cain, Ph. D. scott at
> scottcain dot net
> GMOD Coordinator (http://gmod.org/) 216-392-3087
> Ontario Institute for Cancer Research

--
The Wellcome Trust Sanger Institute is operated by Genome Research
Limited, a charity registered in England with number 1021457 and a
company registered in England with number 2742969, whose registered
office is 215 Euston Road, London, NW1 2BE.

------------------------------------------------------------------------------
Let Crystal Reports handle the reporting - Free Crystal Reports 2008 30-Day
trial. Simplify your report design, integration and deployment - and focus on
what you do best, core application coding. Discover what's new with
Crystal Reports now. http://p.sf.net/sfu/bobj-july
_______________________________________________
Gmod-gbrowse mailing list
Gmod-gbrowse@...
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse

Re: GBrowse 2 on Mac

2009-11-19T04:52:09Z

Hi Keiran,

GBrowse 2 is probably working fine on your Mac, just the url in the
GBrowse2 homepage at http://localhost/gbrowse2 is broken. Try this
url instead:

http://localhost/cgi-bin/gb2/gbrowse/yeast/

Scott

On Thu, Nov 19, 2009 at 4:15 AM, Keiran Raine <kr2@...> wrote:

> Hi,
> I recently installed the 1.7 version of GBrowse on my Mac and it all went
> well using Fink. I managed to get out inhouse data working and was very
> happy with the simple configuration. I have now attempted to install
> GBrowse2 following the directions in the NGS tutorial but although all sees
> to install fine when I select the example yeast database I get the
> following:
> The requested URL /Library/Webserver/CGI-Executables/gb2/gbrowse/yeast was
> not found on this server.
> Does anyone know what the problem is likely to be? This location exists:
> ls -l /Library/Webserver/CGI-Executables/gb2
> -r-xr-xr-x 1 root admin 1.2K 18 Nov 16:32 gbgff*
> -r-xr-xr-x 1 root admin 855B 18 Nov 16:32 gbrowse*
> -r-xr-xr-x 1 root admin 18K 18 Nov 16:32 gbrowse_details*
> -r-xr-xr-x 1 root admin 21K 18 Nov 16:32 gbrowse_gmap*
> -r-xr-xr-x 1 root admin 21K 18 Nov 16:32 gbrowse_img*
> and I assume that the '/yeast' is used as parameter to the gbrowse script.
> Any help very welcome.
> Kind regards,
>
> Keiran Raine
> Senior Computer Biologist
> The Cancer Genome Project
> Ext: 2100
> kr2@...
> The Wellcome Trust Sanger Institute is operated by Genome Research
> Limited, a charity registered in England with number 1021457 and a
> company registered in England with number 2742969, whose registered
> office is 215 Euston Road, London, NW1 2BE.
>
>
>
> -- The Wellcome Trust Sanger Institute is operated by Genome Research
> Limited, a charity registered in England with number 1021457 and a compa ny
> registered in England with number 2742969, whose registered office is 2 15
> Euston Road, London, NW1 2BE.
>
> ------------------------------------------------------------------------------
> Let Crystal Reports handle the reporting - Free Crystal Reports 2008 30-Day
> trial. Simplify your report design, integration and deployment - and focus
> on
> what you do best, core application coding. Discover what's new with
> Crystal Reports now. http://p.sf.net/sfu/bobj-july
> _______________________________________________
> Gmod-gbrowse mailing list
> Gmod-gbrowse@...
> https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
>
>

GBrowse 2 on Mac

2009-11-19T01:15:48Z

Hi,

I recently installed the 1.7 version of GBrowse on my Mac and it all went well using Fink. I managed to get out inhouse data working and was very happy with the simple configuration. I have now attempted to install GBrowse2 following the directions in the NGS tutorial but although all sees to install fine when I select the example yeast database I get the following:

The requested URL /Library/Webserver/CGI-Executables/gb2/gbrowse/yeast was not found on this server.

Does anyone know what the problem is likely to be? This location exists:

ls -l /Library/Webserver/CGI-Executables/gb2

-r-xr-xr-x 1 root admin 1.2K 18 Nov 16:32 gbgff*

-r-xr-xr-x 1 root admin 855B 18 Nov 16:32 gbrowse*

-r-xr-xr-x 1 root admin 18K 18 Nov 16:32 gbrowse_details*

-r-xr-xr-x 1 root admin 21K 18 Nov 16:32 gbrowse_gmap*

-r-xr-xr-x 1 root admin 21K 18 Nov 16:32 gbrowse_img*

and I assume that the '/yeast' is used as parameter to the gbrowse script.

Any help very welcome.

Kind regards,

Keiran Raine

Senior Computer Biologist

The Cancer Genome Project

Ext: 2100

kr2@...

Re: Manually adding descriptions to gens in Chado

2009-11-18T20:29:25Z

Hi Shane,

Perhaps the easiest thing to do (well, next easiest thing to do,
beyond putting the description in the Note tag in the GFF before you
load it), would be to create entries for the features in the
featureprop table, with the feature_id of the feature, and the type_id
of the Note term from the cvterm table.

Scott

On Wed, Nov 18, 2009 at 5:45 PM, Shane Brubaker
<SBrubaker@...> wrote:

> Hi, is there a way to manually add information for genes into Chado that will appear in the "Description" field in Gbrowse for that gene?
>
> I was wondering if I could write a script that would transfer my annotations directly into chado by inserting or updating fields from my gene, and then be able to see that information on Gbrowse, but I couldn't tell which table in Chado I should use for that.
>
>
> Thanks,
> Shane
>
> This email and any attachments thereto may contain private, confidential, and privileged material for the sole use of the intended recipient. Any review, copying, or distribution of this email (or any attachments thereto) by others is strictly prohibited. If you are not the intended recipient, please contact the sender immediately and permanently delete the original and any copies of this email and any attachments thereto.
>
> ------------------------------------------------------------------------------
> Let Crystal Reports handle the reporting - Free Crystal Reports 2008 30-Day
> trial. Simplify your report design, integration and deployment - and focus on
> what you do best, core application coding. Discover what's new with
> Crystal Reports now. http://p.sf.net/sfu/bobj-july
> _______________________________________________
> Gmod-gbrowse mailing list
> Gmod-gbrowse@...
> https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
>

Re: XyPLots using Chado

2009-11-18T20:23:48Z

Hi Shane,

It is possible to put data that you can use for xy plots in Chado, but
it is probably going to be less than optimal from most cases. To do
so, you just need to create a feature that spans the region, and then
have the individual points/subregions are features that have the big
region as a parent, like this:

Chr1 . region 1 200000 . . . ID=plot_Chr1
Chr1 . oligo 1 100 123 . . Parent=plot_Chr1
Chr1 . oligo 101 200 3 . . Parent=plot_Chr1

However, for any reasonably large dataset, this will probably end up
being very slow. Your alternatives include:

1. Using wig files instead.

2. Using GBrowse2, and putting the xy data in a seqfeature::Store
database while your annotations remain in a Chado database.

Scott

On Wed, Nov 18, 2009 at 5:03 PM, Shane Brubaker
<SBrubaker@...> wrote:

help - diagnose

2009-11-18T14:56:12Z

I am loading a fasta whole chromosome into gbrowse (new db):

> bp_bulk_load_gff.pl -create -d gb_ssc chr10.fa chr10.gff3

where
"chr10.fa":
>10 dna_rm:chromosome chromosome:Sscrofa9:10:1:66741929:1
TAATTCCCGCCCTGAGGAGGGGGCGGGGGGCGAGATTGCTGGTTCCTTCGTGAGATTTT
....

"chr10.gff3":
Chr.10 Ensembl Chr_sequence 1 66741929 . + . Name=Chr.10
[just one line; all spaces are tabs;]

but I cannot see it on gbrowse by seaching "Chr.10". Wonder what should I
look into?

I browsed the mysql tables and 'fgroup' table has:
gid gclass gname
---- ------------ ---------
1 Name=Chr.10

isn't this appear odd? Could you see if I did anything wrong?

Zhiliang

------------------------------------------------------------------------------
Let Crystal Reports handle the reporting - Free Crystal Reports 2008 30-Day
trial. Simplify your report design, integration and deployment - and focus on
what you do best, core application coding. Discover what's new with
Crystal Reports now. http://p.sf.net/sfu/bobj-july
_______________________________________________
Gmod-gbrowse mailing list
Gmod-gbrowse@...
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse

Manually adding descriptions to gens in Chado

2009-11-18T14:45:14Z

Hi, is there a way to manually add information for genes into Chado that will appear in the "Description" field in Gbrowse for that gene?

I was wondering if I could write a script that would transfer my annotations directly into chado by inserting or updating fields from my gene, and then be able to see that information on Gbrowse, but I couldn't tell which table in Chado I should use for that.

Thanks,
Shane

This email and any attachments thereto may contain private, confidential, and privileged material for the sole use of the intended recipient. Any review, copying, or distribution of this email (or any attachments thereto) by others is strictly prohibited. If you are not the intended recipient, please contact the sender immediately and permanently delete the original and any copies of this email and any attachments thereto.

------------------------------------------------------------------------------
Let Crystal Reports handle the reporting - Free Crystal Reports 2008 30-Day
trial. Simplify your report design, integration and deployment - and focus on
what you do best, core application coding. Discover what's new with
Crystal Reports now. http://p.sf.net/sfu/bobj-july
_______________________________________________
Gmod-gbrowse mailing list
Gmod-gbrowse@...
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse

XyPLots using Chado

2009-11-18T14:03:33Z

Hi, can anyone give me a brief tutorial on adding an XYPlot to Gbrowse using Chado?

I noticed in the conf file it says not to use Aggregators with Chado, but the main example I have for an XYPLot comes from the Gbrowse tutorial, and this uses aggregators.

Thanks,
Shane

This email and any attachments thereto may contain private, confidential, and privileged material for the sole use of the intended recipient. Any review, copying, or distribution of this email (or any attachments thereto) by others is strictly prohibited. If you are not the intended recipient, please contact the sender immediately and permanently delete the original and any copies of this email and any attachments thereto.

------------------------------------------------------------------------------
Let Crystal Reports handle the reporting - Free Crystal Reports 2008 30-Day
trial. Simplify your report design, integration and deployment - and focus on
what you do best, core application coding. Discover what's new with
Crystal Reports now. http://p.sf.net/sfu/bobj-july
_______________________________________________
Gmod-gbrowse mailing list
Gmod-gbrowse@...
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse

Re: gbrowse track error

2009-11-18T13:26:56Z

Hello Scott.
I'm uploading our tilling array files (nimblegen). they are big. I have 21 time courses to upload, but I just uploaded 5 time courses.
Some tracks I can see the graphics, but some I got that error. (I'm using glyph boxes for all time courses)
I attached an example file for some files that I have. I have 21 files, for each file I split into 1260 files.gff3 (1260 scaffolds)
I can send some full files if you need.
Thanks again for your help.
Raul

On Wed, Nov 18, 2009 at 2:30 PM, Scott Cain <scott@...> wrote:

Hi Raul,

I take it you don't want the day 1 track to look like that? To help
us better help you, could you send some sample data as well as the
configuration for the track and describe what you expect to see?

thanks,
Scott

On Wed, Nov 18, 2009 at 3:10 PM, raul petrin <rjpetrin@...> wrote:
> Hello
> I'm uploading my files into mysql db. After I finish loading my files, when
> I will check my tracks, I got this screen (attached). some tracks work, but
> some don't work.
> How can I fix this?
> Thanks a lot
> Raul
>
>
>
>

> ------------------------------------------------------------------------------
> Let Crystal Reports handle the reporting - Free Crystal Reports 2008 30-Day
> trial. Simplify your report design, integration and deployment - and focus
> on
> what you do best, core application coding. Discover what's new with
> Crystal Reports now. http://p.sf.net/sfu/bobj-july
> _______________________________________________
> Gmod-gbrowse mailing list
> Gmod-gbrowse@...
> https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
>
>

--
------------------------------------------------------------------------
Scott Cain, Ph. D. scott at scottcain dot net
GMOD Coordinator (http://gmod.org/) 216-392-3087
Ontario Institute for Cancer Research

file:scaffolds.gff3
##gff-version 3
scaffold_1 Sequence scaffold 1 3167015 . . . ID=scaffold_1;Name=scaffold_1
scaffold_10 Sequence scaffold 1 1154401 . . . ID=scaffold_10;Name=scaffold_10
scaffold_100 Sequence scaffold 1 115756 . . . ID=scaffold_100;Name=scaffold_100
scaffold_1000 Sequence scaffold 1 3586 . . . ID=scaffold_1000;Name=scaffold_1000
scaffold_1001 Sequence scaffold 1 3586 . . . ID=scaffold_1001;Name=scaffold_1001
scaffold_1002 Sequence scaffold 1 3579 . . . ID=scaffold_1002;Name=scaffold_1002
scaffold_1003 Sequence scaffold 1 3578 . . . ID=scaffold_1003;Name=scaffold_1003
scaffold_1004 Sequence scaffold 1 3543 . . . ID=scaffold_1004;Name=scaffold_1004

file:annotations.gff3
##gff-version 3
scaffold_1 Gaze gene 588 3589 2089.2116 + . ID=GSOIDG00000001001;Name=GSOIDG00000001001;Note=Complete 1
scaffold_1 Gaze mRNA 588 3589 2089.2116 + . ID=GSOIDT00000001001;Name=GSOIDT00000001001;Parent=GSOIDG00000001001;Note=Gene GSOIDG00000001001
scaffold_1 Gaze CDS 588 738 105.4800 + 0 Parent=GSOIDT00000001001;Name=GSOIDT00000001001;Parent=GSOIDG00000001001;Note=Gene GSOIDG00000001001
scaffold_1 Gaze CDS 811 922 74.4000 + 1 Parent=GSOIDT00000001001;Name=GSOIDT00000001001;Parent=GSOIDG00000001001;Note=Gene GSOIDG00000001001
scaffold_1 Gaze CDS 1019 1086 80.3300 + 2 Parent=GSOIDT00000001001;Name=GSOIDT00000001001;Parent=GSOIDG00000001001;Note=Gene GSOIDG00000001001
scaffold_1 Gaze CDS 1178 1337 73.3300 + 1 Parent=GSOIDT00000001001;Name=GSOIDT00000001001;Parent=GSOIDG00000001001;Note=Gene GSOIDG00000001001
scaffold_1 Gaze CDS 1622 1662 38.0000 + 2 Parent=GSOIDT00000001001;Name=GSOIDT00000001001;Parent=GSOIDG00000001001;Note=Gene GSOIDG00000001001
scaffold_1 Gaze CDS 1887 2089 141.9200 + 1 Parent=GSOIDT00000001001;Name=GSOIDT00000001001;Parent=GSOIDG00000001001;Note=Gene GSOIDG00000001001
scaffold_1 Gaze CDS 2135 2217 151.0650 + 0 Parent=GSOIDT00000001001;Name=GSOIDT00000001001;Parent=GSOIDG00000001001;Note=Gene GSOIDG00000001001
scaffold_1 Gaze CDS 2264 2623 124.3150 + 2 Parent=GSOIDT00000001001;Name=GSOIDT00000001001;Parent=GSOIDG00000001001;Note=Gene GSOIDG00000001001
scaffold_1 Gaze CDS 2754 2981 80.8200 + 2 Parent=GSOIDT00000001001;Name=GSOIDT00000001001;Parent=GSOIDG00000001001;Note=Gene GSOIDG00000001001
scaffold_1 Gaze CDS 3532 3589 1.0000 + 2 Parent=GSOIDT00000001001;Name=GSOIDT00000001001;Parent=GSOIDG00000001001;Note=Gene GSOIDG00000001001
scaffold_1 Gaze gene 4545 6458 13.2893 - . ID=GSOIDG00000002001;Name=GSOIDG00000002001;Note=Complete 1
scaffold_1 Gaze mRNA 4545 6458 13.2893 - . ID=GSOIDT00000002001;Name=GSOIDT00000002001;Parent=GSOIDG00000002001;Note=Gene GSOIDG00000002001
scaffold_1 Gaze CDS 4545 4851 5.0000 - 2 Parent=GSOIDT00000002001;Name=GSOIDT00000002001;Parent=GSOIDG00000002001;Note=Gene GSOIDG00000002001
scaffold_1 Gaze CDS 4914 5032 5.0000 - 0 Parent=GSOIDT00000002001;Name=GSOIDT00000002001;Parent=GSOIDG00000002001;Note=Gene GSOIDG00000002001
scaffold_1 Gaze CDS 6086 6130 3.0000 - 0 Parent=GSOIDT00000002001;Name=GSOIDT00000002001;Parent=GSOIDG00000002001;Note=Gene GSOIDG00000002001
scaffold_1 Gaze CDS 6173 6313 3.0000 - 0 Parent=GSOIDT00000002001;Name=GSOIDT00000002001;Parent=GSOIDG00000002001;Note=Gene GSOIDG00000002001
scaffold_1 Gaze CDS 6429 6458 3.0000 - 0 Parent=GSOIDT00000002001;Name=GSOIDT00000002001;Parent=GSOIDG00000002001;Note=Gene GSOIDG00000002001
scaffold_2 Gaze gene 1411761 1413273 40.2817 - . ID=GSOIDG00006047001;Name=GSOIDG00006047001;Note=Complete 1
scaffold_2 Gaze mRNA 1411761 1413273 40.2817 - . ID=GSOIDT00006047001;Name=GSOIDT00006047001;Parent=GSOIDG00006047001;Note=Gene GSOIDG00006047001
scaffold_2 Gaze CDS 1411761 1411870 7.0000 - 1 Parent=GSOIDT00006047001;Name=GSOIDT00006047001;Parent=GSOIDG00006047001;Note=Gene GSOIDG00006047001
scaffold_2 Gaze CDS 1411913 1412003 7.0000 - 0 Parent=GSOIDT00006047001;Name=GSOIDT00006047001;Parent=GSOIDG00006047001;Note=Gene GSOIDG00006047001
scaffold_2 Gaze CDS 1412333 1412415 9.0000 - 1 Parent=GSOIDT00006047001;Name=GSOIDT00006047001;Parent=GSOIDG00006047001;Note=Gene GSOIDG00006047001
scaffold_2 Gaze CDS 1412754 1412902 5.0000 - 2 Parent=GSOIDT00006047001;Name=GSOIDT00006047001;Parent=GSOIDG00006047001;Note=Gene GSOIDG00006047001
scaffold_2 Gaze CDS 1413176 1413273 -1.0000 - 0 Parent=GSOIDT00006047001;Name=GSOIDT00006047001;Parent=GSOIDG00006047001;Note=Gene GSOIDG00006047001
scaffold_2 Gaze gene 1413330 1413957 100.2675 + . ID=GSOIDG00006048001;Name=GSOIDG00006048001;Note=Complete 1
scaffold_2 Gaze mRNA 1413330 1413957 100.2675 + . ID=GSOIDT00006048001;Name=GSOIDT00006048001;Parent=GSOIDG00006048001;Note=Gene GSOIDG00006048001
scaffold_2 Gaze CDS 1413330 1413402 8.6154 + 0 Parent=GSOIDT00006048001;Name=GSOIDT00006048001;Parent=GSOIDG00006048001;Note=Gene GSOIDG00006048001
scaffold_2 Gaze CDS 1413442 1413586 15.0000 + 1 Parent=GSOIDT00006048001;Name=GSOIDT00006048001;Parent=GSOIDG00006048001;Note=Gene GSOIDG00006048001
scaffold_2 Gaze CDS 1413676 1413790 15.0000 + 2 Parent=GSOIDT00006048001;Name=GSOIDT00006048001;Parent=GSOIDG00006048001;Note=Gene GSOIDG00006048001
scaffold_2 Gaze CDS 1413837 1413935 8.0339 + 0 Parent=GSOIDT00006048001;Name=GSOIDT00006048001;Parent=GSOIDG00006048001;Note=Gene GSOIDG00006048001
scaffold_2 Gaze UTR 1413936 1413957 -1.2568 + . Parent=GSOIDT00006048001;Name=GSOIDT00006048001;Parent=GSOIDG00006048001;Note=Gene GSOIDG00006048001
scaffold_2 Gaze gene 1414245 1415372 7.9917 - . ID=GSOIDG00006049001;Name=GSOIDG00006049001;Note=Complete 1
scaffold_2 Gaze mRNA 1414245 1415372 7.9917 - . ID=GSOIDT00006049001;Name=GSOIDT00006049001;Parent=GSOIDG00006049001;Note=Gene GSOIDG00006049001
scaffold_2 Gaze CDS 1414245 1414340 1.0000 - 0 Parent=GSOIDT00006049001;Name=GSOIDT00006049001;Parent=GSOIDG00006049001;Note=Gene GSOIDG00006049001
scaffold_2 Gaze CDS 1414387 1414574 3.0000 - 1 Parent=GSOIDT00006049001;Name=GSOIDT00006049001;Parent=GSOIDG00006049001;Note=Gene GSOIDG00006049001
scaffold_2 Gaze CDS 1414615 1414708 3.0000 - 0 Parent=GSOIDT00006049001;Name=GSOIDT00006049001;Parent=GSOIDG00006049001;Note=Gene GSOIDG00006049001
scaffold_2 Gaze CDS 1414853 1415005 3.7500 - 0 Parent=GSOIDT00006049001;Name=GSOIDT00006049001;Parent=GSOIDG00006049001;Note=Gene GSOIDG00006049001
scaffold_2 Gaze CDS 1415046 1415372 8.2500 - 0 Parent=GSOIDT00006049001;Name=GSOIDT00006049001;Parent=GSOIDG00006049001;Note=Gene GSOIDG00006049001
scaffold_3 Gaze gene 5172 5653 15.8167 + . ID=GSOIDG00008761001;Name=GSOIDG00008761001;Note=Complete 1
scaffold_3 Gaze mRNA 5172 5653 15.8167 + . ID=GSOIDT00008761001;Name=GSOIDT00008761001;Parent=GSOIDG00008761001;Note=Gene GSOIDG00008761001
scaffold_3 Gaze CDS 5172 5227 -1.0000 + 0 Parent=GSOIDT00008761001;Name=GSOIDT00008761001;Parent=GSOIDG00008761001;Note=Gene GSOIDG00008761001
scaffold_3 Gaze CDS 5332 5412 7.0000 + 2 Parent=GSOIDT00008761001;Name=GSOIDT00008761001;Parent=GSOIDG00008761001;Note=Gene GSOIDG00008761001
scaffold_3 Gaze CDS 5572 5653 7.0000 + 2 Parent=GSOIDT00008761001;Name=GSOIDT00008761001;Parent=GSOIDG00008761001;Note=Gene GSOIDG00008761001
scaffold_3 Gaze gene 5710 8060 6483.7308 + . ID=GSOIDG00008762001;Name=GSOIDG00008762001;Note=Complete 1
scaffold_3 Gaze mRNA 5710 8060 6483.7308 + . ID=GSOIDT00008762001;Name=GSOIDT00008762001;Parent=GSOIDG00008762001;Note=Gene GSOIDG00008762001
scaffold_3 Gaze CDS 5710 5922 15.3500 + 0 Parent=GSOIDT00008762001;Name=GSOIDT00008762001;Parent=GSOIDG00008762001;Note=Gene GSOIDG00008762001
scaffold_3 Gaze CDS 6445 6526 214.2450 + 0 Parent=GSOIDT00008762001;Name=GSOIDT00008762001;Parent=GSOIDG00008762001;Note=Gene GSOIDG00008762001
scaffold_3 Gaze CDS 6568 6675 355.8420 + 1 Parent=GSOIDT00008762001;Name=GSOIDT00008762001;Parent=GSOIDG00008762001;Note=Gene GSOIDG00008762001
scaffold_3 Gaze CDS 6735 6805 408.6170 + 1 Parent=GSOIDT00008762001;Name=GSOIDT00008762001;Parent=GSOIDG00008762001;Note=Gene GSOIDG00008762001
scaffold_3 Gaze CDS 6872 6970 404.0070 + 0 Parent=GSOIDT00008762001;Name=GSOIDT00008762001;Parent=GSOIDG00008762001;Note=Gene GSOIDG00008762001
scaffold_3 Gaze CDS 7108 7362 383.2699 + 0 Parent=GSOIDT00008762001;Name=GSOIDT00008762001;Parent=GSOIDG00008762001;Note=Gene GSOIDG00008762001
scaffold_3 Gaze CDS 7402 7607 351.7350 + 0 Parent=GSOIDT00008762001;Name=GSOIDT00008762001;Parent=GSOIDG00008762001;Note=Gene GSOIDG00008762001
scaffold_3 Gaze CDS 7661 7880 134.0200 + 2 Parent=GSOIDT00008762001;Name=GSOIDT00008762001;Parent=GSOIDG00008762001;Note=Gene GSOIDG00008762001
scaffold_3 Gaze CDS 7945 7995 4.4609 + 0 Parent=GSOIDT00008762001;Name=GSOIDT00008762001;Parent=GSOIDG00008762001;Note=Gene GSOIDG00008762001
scaffold_3 Gaze UTR 7996 8060 2.4828 + . Parent=GSOIDT00008762001;Name=GSOIDT00008762001;Parent=GSOIDG00008762001;Note=Gene GSOIDG00008762001
scaffold_3 Gaze gene 8249 8742 124.5965 - . ID=GSOIDG00008763001;Name=GSOIDG00008763001;Note=Complete 1
scaffold_3 Gaze mRNA 8249 8742 124.5965 - . ID=GSOIDT00008763001;Name=GSOIDT00008763001;Parent=GSOIDG00008763001;Note=Gene GSOIDG00008763001
scaffold_3 Gaze UTR 8249 8311 0.0741 - . Parent=GSOIDT00008763001;Name=GSOIDT00008763001;Parent=GSOIDG00008763001;Note=Gene GSOIDG00008763001
scaffold_3 Gaze CDS 8312 8491 11.8889 - 0 Parent=GSOIDT00008763001;Name=GSOIDT00008763001;Parent=GSOIDG00008763001;Note=Gene GSOIDG00008763001
scaffold_3 Gaze CDS 8536 8599 27.0000 - 2 Parent=GSOIDT00008763001;Name=GSOIDT00008763001;Parent=GSOIDG00008763001;Note=Gene GSOIDG00008763001
scaffold_3 Gaze CDS 8640 8740 20.6505 - 0 Parent=GSOIDT00008763001;Name=GSOIDT00008763001;Parent=GSOIDG00008763001;Note=Gene GSOIDG00008763001
scaffold_3 Gaze UTR 8741 8742 -1.7670 - . Parent=GSOIDT00008763001;Name=GSOIDT00008763001;Parent=GSOIDG00008763001;Note=Gene GSOIDG00008763001
scaffold_1260 Gaze gene 69 1667 9.1155 - . ID=GSOIDG00001652001;Name=GSOIDG00001652001;Note=Complete 0
scaffold_1260 Gaze mRNA 69 1667 9.1155 - . ID=GSOIDT00001652001;Name=GSOIDT00001652001;Parent=GSOIDG00001652001;Note=Gene GSOIDG00001652001
scaffold_1260 Gaze CDS 69 1249 8.4738 - 1 Parent=GSOIDT00001652001;Name=GSOIDT00001652001;Parent=GSOIDG00001652001;Note=Gene GSOIDG00001652001
scaffold_1260 Gaze CDS 1397 1478 2.7477 - 0 Parent=GSOIDT00001652001;Name=GSOIDT00001652001;Parent=GSOIDG00001652001;Note=Gene GSOIDG00001652001
scaffold_1260 Gaze CDS 1581 1667 4.0373 - 0 Parent=GSOIDT00001652001;Name=GSOIDT00001652001;Parent=GSOIDG00001652001;Note=Gene GSOIDG00001652001

***Array
file: time-course1-scaffold_1.gff3
##gff-version 3
#sequence-region scaffold_1 1 3167015
scaffold_1 1HPF_Jan_2009_Pop_532 microarray_oligo 1 3167015 . . . ID=1HPF_Jan_2009_Pop_532;Name=1HPF_Jan_2009_Pop_532
scaffold_1 1HPF_Jan_2009_Pop_532 region 8 57 466.11 . . Parent=1HPF_Jan_2009_Pop_532;Note=scaffold_1
scaffold_1 1HPF_Jan_2009_Pop_532 region 36 85 466.33 . . Parent=1HPF_Jan_2009_Pop_532;Note=scaffold_1
scaffold_1 1HPF_Jan_2009_Pop_532 region 60 109 534.22 . . Parent=1HPF_Jan_2009_Pop_532;Note=scaffold_1
scaffold_1 1HPF_Jan_2009_Pop_532 region 85 134 552.44 . . Parent=1HPF_Jan_2009_Pop_532;Note=scaffold_1
scaffold_1 1HPF_Jan_2009_Pop_532 region 122 171 598.44 . . Parent=1HPF_Jan_2009_Pop_532;Note=scaffold_1
scaffold_1 1HPF_Jan_2009_Pop_532 region 145 194 644.78 . . Parent=1HPF_Jan_2009_Pop_532;Note=scaffold_1
scaffold_1 1HPF_Jan_2009_Pop_532 region 169 220 496.56 . . Parent=1HPF_Jan_2009_Pop_532;Note=scaffold_1

file:time-course1-scaffold_2.gff3
##gff-version 3
#sequence-region scaffold_2 1 2850711
scaffold_2 1HPF_Jan_2009_Pop_532 microarray_oligo 1 2850711 . . . ID=1HPF_Jan_2009_Pop_532;Name=1HPF_Jan_2009_Pop_532
scaffold_2 1HPF_Jan_2009_Pop_532 region 6 66 558.44 . . Parent=1HPF_Jan_2009_Pop_532;Note=scaffold_2
scaffold_2 1HPF_Jan_2009_Pop_532 region 116 165 568.22 . . Parent=1HPF_Jan_2009_Pop_532;Note=scaffold_2
scaffold_2 1HPF_Jan_2009_Pop_532 region 177 233 655.11 . . Parent=1HPF_Jan_2009_Pop_532;Note=scaffold_2
scaffold_2 1HPF_Jan_2009_Pop_532 region 203 265 574.33 . . Parent=1HPF_Jan_2009_Pop_532;Note=scaffold_2
scaffold_2 1HPF_Jan_2009_Pop_532 region 235 284 500.44 . . Parent=1HPF_Jan_2009_Pop_532;Note=scaffold_2
scaffold_2 1HPF_Jan_2009_Pop_532 region 257 306 635.78 . . Parent=1HPF_Jan_2009_Pop_532;Note=scaffold_2

file:time-course1-scaffold_3.gff3
##gff-version 3
#sequence-region scaffold_3 1 2515153
scaffold_3 1HPF_Jan_2009_Pop_532 microarray_oligo 1 2515153 . . . ID=1HPF_Jan_2009_Pop_532;Name=1HPF_Jan_2009_Pop_532
scaffold_3 1HPF_Jan_2009_Pop_532 region 10 68 589.89 . . Parent=1HPF_Jan_2009_Pop_532;Note=scaffold_3
scaffold_3 1HPF_Jan_2009_Pop_532 region 29 90 531.22 . . Parent=1HPF_Jan_2009_Pop_532;Note=scaffold_3
scaffold_3 1HPF_Jan_2009_Pop_532 region 64 122 566.33 . . Parent=1HPF_Jan_2009_Pop_532;Note=scaffold_3
scaffold_3 1HPF_Jan_2009_Pop_532 region 5135 5189 627.78 . . Parent=1HPF_Jan_2009_Pop_532;Note=scaffold_3
scaffold_3 1HPF_Jan_2009_Pop_532 region 5163 5220 624.00 . . Parent=1HPF_Jan_2009_Pop_532;Note=scaffold_3
scaffold_3 1HPF_Jan_2009_Pop_532 region 5187 5241 499.33 . . Parent=1HPF_Jan_2009_Pop_532;Note=scaffold_3
scaffold_3 1HPF_Jan_2009_Pop_532 region 5219 5277 773.44 . . Parent=1HPF_Jan_2009_Pop_532;Note=scaffold_3

.........

file:time-course1-scaffold_1260.gff3
##gff-version 3
#sequence-region scaffold_1260 1 2002
scaffold_1260 1HPF_Jan_2009_Pop_532 microarray_oligo 1 2002 . . . ID=1HPF_Jan_2009_Pop_532;Name=1HPF_Jan_2009_Pop_532
scaffold_1260 1HPF_Jan_2009_Pop_532 region 67 117 1345.44 . . Parent=1HPF_Jan_2009_Pop_532;Note=scaffold_1260
scaffold_1260 1HPF_Jan_2009_Pop_532 region 85 139 481.11 . . Parent=1HPF_Jan_2009_Pop_532;Note=scaffold_1260
scaffold_1260 1HPF_Jan_2009_Pop_532 region 117 174 554.00 . . Parent=1HPF_Jan_2009_Pop_532;Note=scaffold_1260
scaffold_1260 1HPF_Jan_2009_Pop_532 region 144 202 659.67 . . Parent=1HPF_Jan_2009_Pop_532;Note=scaffold_1260
scaffold_1260 1HPF_Jan_2009_Pop_532 region 174 230 578.22 . . Parent=1HPF_Jan_2009_Pop_532;Note=scaffold_1260
scaffold_1260 1HPF_Jan_2009_Pop_532 region 202 251 610.89 . . Parent=1HPF_Jan_2009_Pop_532;Note=scaffold_1260
scaffold_1260 1HPF_Jan_2009_Pop_532 region 235 284 661.44 . . Parent=1HPF_Jan_2009_Pop_532;Note=scaffold_1260

file:time-course2-scaffold_1.gff3
##gff-version 3
#sequence-region scaffold_1 1 3167015
scaffold_1 2-8Cell_532 microarray_oligo 1 3167015 . . . ID=2-8Cell_532;Name=2-8Cell_532
scaffold_1 2-8Cell_532 region 8 57 1646.56 . . Parent=2-8Cell_532;Note=scaffold_1
scaffold_1 2-8Cell_532 region 36 85 1095.44 . . Parent=2-8Cell_532;Note=scaffold_1
scaffold_1 2-8Cell_532 region 60 109 1816.78 . . Parent=2-8Cell_532;Note=scaffold_1
scaffold_1 2-8Cell_532 region 85 134 1377.22 . . Parent=2-8Cell_532;Note=scaffold_1
scaffold_1 2-8Cell_532 region 122 171 1518.00 . . Parent=2-8Cell_532;Note=scaffold_1
scaffold_1 2-8Cell_532 region 145 194 1090.22 . . Parent=2-8Cell_532;Note=scaffold_1
scaffold_1 2-8Cell_532 region 169 220 915.44 . . Parent=2-8Cell_532;Note=scaffold_1

file:time-course2-scaffold_2.gff3
##gff-version 3
#sequence-region scaffold_2 1 2850711
scaffold_2 2-8Cell_532 microarray_oligo 1 2850711 . . . ID=2-8Cell_532;Name=2-8Cell_532
scaffold_2 2-8Cell_532 region 6 66 813.56 . . Parent=2-8Cell_532;Note=scaffold_2
scaffold_2 2-8Cell_532 region 116 165 683.22 . . Parent=2-8Cell_532;Note=scaffold_2
scaffold_2 2-8Cell_532 region 177 233 1273.00 . . Parent=2-8Cell_532;Note=scaffold_2
scaffold_2 2-8Cell_532 region 203 265 1179.00 . . Parent=2-8Cell_532;Note=scaffold_2
scaffold_2 2-8Cell_532 region 235 284 1346.89 . . Parent=2-8Cell_532;Note=scaffold_2
scaffold_2 2-8Cell_532 region 257 306 1347.67 . . Parent=2-8Cell_532;Note=scaffold_2

file:time-course2-scaffold_2.gff3
##gff-version 3
#sequence-region scaffold_3 1 2515153
scaffold_3 2-8Cell_532 microarray_oligo 1 2515153 . . . ID=2-8Cell_532;Name=2-8Cell_532
scaffold_3 2-8Cell_532 region 10 68 1328.00 . . Parent=2-8Cell_532;Note=scaffold_3
scaffold_3 2-8Cell_532 region 29 90 1248.89 . . Parent=2-8Cell_532;Note=scaffold_3
scaffold_3 2-8Cell_532 region 64 122 1295.78 . . Parent=2-8Cell_532;Note=scaffold_3
scaffold_3 2-8Cell_532 region 5135 5189 1102.89 . . Parent=2-8Cell_532;Note=scaffold_3
scaffold_3 2-8Cell_532 region 5163 5220 850.89 . . Parent=2-8Cell_532;Note=scaffold_3
scaffold_3 2-8Cell_532 region 5187 5241 1025.67 . . Parent=2-8Cell_532;Note=scaffold_3

.........

file:time-course2-scaffold_1260.gff3
##gff-version 3
#sequence-region scaffold_1260 1 2002
scaffold_1260 2-8Cell_532 microarray_oligo 1 2002 . . . ID=2-8Cell_532;Name=2-8Cell_532
scaffold_1260 2-8Cell_532 region 67 117 867.67 . . Parent=2-8Cell_532;Note=scaffold_1260
scaffold_1260 2-8Cell_532 region 85 139 846.11 . . Parent=2-8Cell_532;Note=scaffold_1260
scaffold_1260 2-8Cell_532 region 117 174 766.44 . . Parent=2-8Cell_532;Note=scaffold_1260
scaffold_1260 2-8Cell_532 region 144 202 860.56 . . Parent=2-8Cell_532;Note=scaffold_1260
scaffold_1260 2-8Cell_532 region 174 230 820.89 . . Parent=2-8Cell_532;Note=scaffold_1260
scaffold_1260 2-8Cell_532 region 202 251 798.00 . . Parent=2-8Cell_532;Note=scaffold_1260

file:time-course3-scaffold_1.gff3
##gff-version 3
#sequence-region scaffold_1 1 3167015
scaffold_1 Day1_532 microarray_oligo 1 3167015 . . . ID=Day1_532;Name=Day1_532
scaffold_1 Day1_532 region 8 57 654.00 . . Parent=Day1_532;Note=scaffold_1
scaffold_1 Day1_532 region 36 85 615.56 . . Parent=Day1_532;Note=scaffold_1
scaffold_1 Day1_532 region 60 109 738.33 . . Parent=Day1_532;Note=scaffold_1
scaffold_1 Day1_532 region 85 134 689.33 . . Parent=Day1_532;Note=scaffold_1
scaffold_1 Day1_532 region 122 171 638.89 . . Parent=Day1_532;Note=scaffold_1
scaffold_1 Day1_532 region 145 194 784.78 . . Parent=Day1_532;Note=scaffold_1

file:time-course3-scaffold_2.gff3
##gff-version 3
#sequence-region scaffold_2 1 2850711
scaffold_2 Day1_532 microarray_oligo 1 2850711 . . . ID=Day1_532;Name=Day1_532
scaffold_2 Day1_532 region 6 66 737.67 . . Parent=Day1_532;Note=scaffold_2
scaffold_2 Day1_532 region 116 165 634.44 . . Parent=Day1_532;Note=scaffold_2
scaffold_2 Day1_532 region 177 233 693.44 . . Parent=Day1_532;Note=scaffold_2
scaffold_2 Day1_532 region 203 265 909.00 . . Parent=Day1_532;Note=scaffold_2
scaffold_2 Day1_532 region 235 284 755.00 . . Parent=Day1_532;Note=scaffold_2
scaffold_2 Day1_532 region 257 306 729.33 . . Parent=Day1_532;Note=scaffold_2

file:time-course3-scaffold_3.gff3
##gff-version 3
#sequence-region scaffold_3 1 2515153
scaffold_3 Day1_532 microarray_oligo 1 2515153 . . . ID=Day1_532;Name=Day1_532
scaffold_3 Day1_532 region 10 68 807.89 . . Parent=Day1_532;Note=scaffold_3
scaffold_3 Day1_532 region 29 90 700.44 . . Parent=Day1_532;Note=scaffold_3
scaffold_3 Day1_532 region 64 122 803.78 . . Parent=Day1_532;Note=scaffold_3
scaffold_3 Day1_532 region 5135 5189 655.00 . . Parent=Day1_532;Note=scaffold_3
scaffold_3 Day1_532 region 5163 5220 651.78 . . Parent=Day1_532;Note=scaffold_3
scaffold_3 Day1_532 region 5187 5241 716.11 . . Parent=Day1_532;Note=scaffold_3

.........

file:time-course3-scaffold_1260.gff3
##gff-version 3
#sequence-region scaffold_1260 1 2002
scaffold_1260 Day1_532 microarray_oligo 1 2002 . . . ID=Day1_532;Name=Day1_532
scaffold_1260 Day1_532 region 67 117 969.89 . . Parent=Day1_532;Note=scaffold_1260
scaffold_1260 Day1_532 region 85 139 1212.89 . . Parent=Day1_532;Note=scaffold_1260
scaffold_1260 Day1_532 region 117 174 2027.56 . . Parent=Day1_532;Note=scaffold_1260
scaffold_1260 Day1_532 region 144 202 2563.11 . . Parent=Day1_532;Note=scaffold_1260
scaffold_1260 Day1_532 region 174 230 1967.44 . . Parent=Day1_532;Note=scaffold_1260
scaffold_1260 Day1_532 region 202 251 1476.44 . . Parent=Day1_532;Note=scaffold_1260

------------------------------------------------------------------------------
Let Crystal Reports handle the reporting - Free Crystal Reports 2008 30-Day
trial. Simplify your report design, integration and deployment - and focus on
what you do best, core application coding. Discover what's new with
Crystal Reports now. http://p.sf.net/sfu/bobj-july
_______________________________________________
Gmod-gbrowse mailing list
Gmod-gbrowse@...
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse

organism.conf (6K) Download Attachment
error.jpg (167K) Download Attachment

Re: gbrowse track error

2009-11-18T12:30:09Z

Hi Raul,

I take it you don't want the day 1 track to look like that? To help
us better help you, could you send some sample data as well as the
configuration for the track and describe what you expect to see?

thanks,
Scott

On Wed, Nov 18, 2009 at 3:10 PM, raul petrin <rjpetrin@...> wrote:

> Hello
> I'm uploading my files into mysql db. After I finish loading my files, when
> I will check my tracks, I got this screen (attached). some tracks work, but
> some don't work.
> How can I fix this?
> Thanks a lot
> Raul
>
>
>
>
> ------------------------------------------------------------------------------
> Let Crystal Reports handle the reporting - Free Crystal Reports 2008 30-Day
> trial. Simplify your report design, integration and deployment - and focus
> on
> what you do best, core application coding. Discover what's new with
> Crystal Reports now. http://p.sf.net/sfu/bobj-july
> _______________________________________________
> Gmod-gbrowse mailing list
> Gmod-gbrowse@...
> https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
>
>

Re: Help with GBrowse installation

2009-11-18T12:15:30Z

Hi Scott,

Thanks for all your help. You actually put me on the path to figuring it out.

It did a few searches on google and found out that these two lines need to be uncommented in the httpd.conf file

AddHandler cgi-script .cgi .pl

LoadModule cgi_module modules/mod_cgi.so

It's working now.

Thank you so much.

Abhishek

Abhishek Goel
Staff Research Associate
Geschwind Laboratory, UCLA Neurology
Gonda Neuroscience and Genetics Research Center #2309
University of California Los Angeles
695 Charles E. Young Dr. South
Los Angeles, CA 90095
Tel: (310) 794-7537
Fax: (310) 267-2401

On Wed, Nov 18, 2009 at 12:03 PM, Scott Cain <scott@...> wrote:

Hi Abhishek,

To answer your last question: No, that is not the problem. The
Makefile version check apparently isn't working correctly, but as long
as you can issue a command like this:

perl -MBio::Root::Version -e 'print $Bio::Root::Version::VERSION'

and get an answer, you're fine.

When you modified the apache config file, did you restart apache?
Also, if you are still getting the same behavior as before, did you
empty your cache? Browsers can be pretty aggressive about caching
that sort of thing, so even if the web server is behaving correctly,
you may not know it unless you empty the cache or use a different
browser.

If you aren't getting the same behavior as before, what is happening?

Scott

On Wed, Nov 18, 2009 at 2:25 PM, Abhishek Goel <abhishekspeare@...> wrote:
> Hello Scott,
>
> Thank you for your very quick response. I added the "Options +ExecCGI
> -MultiViews +SymLinksIfOwnerMatch" to my server's httpd.conf file. It was
> set to Options None.
>
> However, it hasn't resolved the problem.
>
> I am running Fedora C7 i386 with Apache/2.2.8 (Unix) and I have BioPerl
> version 1.0069 installed.
>
> I should mention one thing that I thought I should ask you. I thought this
> might be an issue. when I installed gbrowse using the basic installation
> method, I get the following:
>
> Should I use your previous settings to set the file paths and options (y/n)
> [y]? n
> Apache root directory (enter '' for none)? [/usr/local/apache] /data/web
> Apache conf directory? [/etc/httpd/conf]
> Apache htdocs directory? [/var/www/html]
> Apache cgibin directory? [/var/www/cgi-bin]
> GBrowse root for static files? [gbrowse]
> ----------------------------------------------
>                 File Paths
>
>          CONF /etc/httpd/conf
>        HTDOCS /var/www/html
>        CGIBIN /var/www/cgi-bin
> GBROWSE_ROOT gbrowse
> INSTALL_BASE
>           LIB
>           BIN
>           YES
>        PREFIX
> PACKAGE_DIR
>         DO_XS 1
>       NONROOT
>       SELINUX
>
> (Run perl Makefile.PL -h for help on changing)
> ----------------------------------------------
> Warning: prerequisite Bio::Perl 1.006 not found. We have unknown version.
> Writing Makefile for Bio::Graphics::Browser::CAlign
> Writing Makefile for Generic-Genome-Browser
>
> It gives a warning that the prerequisite Bio::Perl 1.006 was not found.
>
> Could this be the issue why it's not executing the perl script?
>
> Abhishek
>
>
> Abhishek Goel
> Staff Research Associate
> Geschwind Laboratory, UCLA Neurology
> Gonda Neuroscience and Genetics Research Center #2309
> University of California Los Angeles
> 695 Charles E. Young Dr. South
> Los Angeles, CA 90095
> Tel: (310) 794-7537
> Fax: (310) 267-2401
>
>
>
>
>
> On Wed, Nov 18, 2009 at 5:33 AM, Scott Cain <scott@...> wrote:
>>
>> Hi Abhishek,
>>
>> Your apache isn't configured correctly. There should be a section for
>> defining your cgi-bin directory, that looks something like this
>> (exactly what it looks like will depend on your platform):
>>
>> ScriptAliasMatch ^/cgi-bin/((?!(?i:webobjects)).*$)
>> "/Library/WebServer/CGI-Executables/$1"
>>
>> or
>>
>> ScriptAlias /cgi-bin/ /usr/lib/cgi-bin/
>> <Directory "/usr/lib/cgi-bin">
>> AllowOverride None
>> Options +ExecCGI -MultiViews +SymLinksIfOwnerMatch
>> Order allow,deny
>> Allow from all
>> </Directory>
>>
>> Usually, this is present by default in most apache configurations.
>> Without it, apache thinks that the gbrowse CGIs are plain text files
>> and serves them up as such.
>>
>> Scott
>>
>>
>> On Wed, Nov 18, 2009 at 12:37 AM, Abhishek Goel
>> <abhishekspeare@...> wrote:
>> >
>> > Hello,
>> >
>> > I am trying to install gbrowse on one of our webservers and I'm having
>> > some
>> > difficulty. I would be really grateful if someone could give me some
>> > pointers on what might be wrong.
>> >
>> > I followed the instructions and updated apache, installed bioperl and
>> > other
>> > perl modules and then installed gbrowse. The installation went through
>> > smoothly without any errors.
>> >
>> > When I got to the browser at http://www.geschwind.med.ucla.edu/gbrowse/
>> > i can see the gbrowser installation. However, when I click on the
>> > http://localhost/cgi-bin/gbrowse/yeast link I just see the following:
>> >
>> > #!/usr/bin/perl -w
>> >
>> > ###################################################################
>> > # Non-modperl users should change this variable if needed to point
>> > # to the directory in which the configuration files are stored.
>> >
>> >
>> > #
>> > $CONF_DIR = '/etc/httpd/conf/gbrowse.conf';
>> > #
>> > ###################################################################
>> > $VERSION = " 1.70";
>> > $BIOGRAPHICS_VERSION = 1.8;
>> >
>> >
>> > # $Id: gbrowse.PLS,v 1.119.4.57.2.59.2.130 2009/06/25 21:20:15 scottcain
>> > Exp
>> > $
>> >
>> >
>> >
>> > use strict;
>> > use Bio::Graphics;
>> > use Bio::Graphics::Browser;
>> > use Bio::Graphics::Browser::Util;
>> > use Bio::Graphics::Browser::PluginSet;
>> > use Bio::Graphics::Browser::UploadSet;
>> > use Bio::Graphics::Browser::RemoteSet;
>> >
>> >
>> > use Bio::Graphics::Browser::PageSettings;
>> > use Digest::MD5 'md5_hex';
>> > use File::Path 'mkpath';
>> > use Text::Tabs;
>> > use File::Basename 'basename','dirname';
>> > use File::Spec;
>> > use Carp qw(:DEFAULT croak);
>> >
>> >
>> > use CGI qw(:standard unescape escape escapeHTML center *table *dl *TR
>> > *td
>> > script);
>> > use CGI::Toggle;
>> > use CGI::Cookie;
>> >
>> > use vars qw($CONFIG $MAX_SEGMENT $DEFAULT_SEGMENT
>> > $HEADER $HTML $UA $VERSION $BIOGRAPHICS_VERSION $CONF_DIR
>> >
>> >
>> > %PLUGINS $PLUGINS $UPLOADED_SOURCES $REMOTE_SOURCES
>> > $PRESETS $HAVE_SVG $HAVE_PDF
>> > %OBJECT_CLASSES %PLUGIN_NAME2LABEL );
>> >
>> >
>> > # if you change the zoom/nav icons, you must change this as well.
>> >
>> > use constant MAG_ICON_HEIGHT => 20;
>> >
>> > use constant MAG_ICON_WIDTH => 8;
>> >
>> > # had-coded values for segment sizes
>> > # many of these can be overridden by configuration file entries
>> > use constant MAX_SEGMENT => 1_000_000;
>> > use constant MIN_SEG_SIZE => 20;
>> >
>> >
>> > use constant TINY_SEG_SIZE => 2;
>> > use constant EXPAND_SEG_SIZE => 5000;
>> > use constant TOO_MANY_SEGMENTS => 5_000;
>> > use constant TOO_MANY_FEATURES => 100;
>> > use constant TOO_MANY_REFS => TOO_MANY_FEATURES;
>> >
>> >
>> > use constant DEFAULT_SEGMENT => 100_000;
>> > use constant DEFAULT_REGION_SIZE => 100_000_000;
>> > use constant OVERVIEW_RATIO => 0.9;
>> > use constant ANNOTATION_EDIT_ROWS => 25;
>> > use constant ANNOTATION_EDIT_COLS => 100;
>> >
>> >
>> >
>> > Abhishek Goel
>> > Staff Research Associate
>> > Geschwind Laboratory, UCLA Neurology
>> > Gonda Neuroscience and Genetics Research Center #2309
>> > University of California Los Angeles
>> > 695 Charles E. Young Dr. South
>> > Los Angeles, CA 90095
>> > Tel: (310) 794-7537
>> > Fax: (310) 267-2401
>> >
>> >
>> >
>> >
>> >
>> >
>> > ------------------------------------------------------------------------------
>> > Let Crystal Reports handle the reporting - Free Crystal Reports 2008
>> > 30-Day
>> > trial. Simplify your report design, integration and deployment - and
>> > focus
>> > on
>> > what you do best, core application coding. Discover what's new with
>> > Crystal Reports now. http://p.sf.net/sfu/bobj-july
>> > _______________________________________________
>> > Gmod-gbrowse mailing list
>> > Gmod-gbrowse@...
>> > https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
>> >
>> >
>>
>>
>>
>> --
>> ------------------------------------------------------------------------
>> Scott Cain, Ph. D. scott at scottcain
>> dot net
>> GMOD Coordinator (http://gmod.org/) 216-392-3087
>> Ontario Institute for Cancer Research
>
>

--

------------------------------------------------------------------------
Scott Cain, Ph. D. scott at scottcain dot net
GMOD Coordinator (http://gmod.org/) 216-392-3087
Ontario Institute for Cancer Research

gbrowse track error

2009-11-18T12:10:20Z

Hello
I'm uploading my files into mysql db. After I finish loading my files, when I will check my tracks, I got this screen (attached). some tracks work, but some don't work.
How can I fix this?
Thanks a lot
Raul

------------------------------------------------------------------------------
Let Crystal Reports handle the reporting - Free Crystal Reports 2008 30-Day
trial. Simplify your report design, integration and deployment - and focus on
what you do best, core application coding. Discover what's new with
Crystal Reports now. http://p.sf.net/sfu/bobj-july
_______________________________________________
Gmod-gbrowse mailing list
Gmod-gbrowse@...
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse

gbrowse-error.jpg (118K) Download Attachment

Re: Help with GBrowse installation

2009-11-18T12:03:32Z

Hi Abhishek,

To answer your last question: No, that is not the problem. The
Makefile version check apparently isn't working correctly, but as long
as you can issue a command like this:

perl -MBio::Root::Version -e 'print $Bio::Root::Version::VERSION'

and get an answer, you're fine.

When you modified the apache config file, did you restart apache?
Also, if you are still getting the same behavior as before, did you
empty your cache? Browsers can be pretty aggressive about caching
that sort of thing, so even if the web server is behaving correctly,
you may not know it unless you empty the cache or use a different
browser.

If you aren't getting the same behavior as before, what is happening?

Scott

On Wed, Nov 18, 2009 at 2:25 PM, Abhishek Goel <abhishekspeare@...> wrote:

> Hello Scott,
>
> Thank you for your very quick response. I added the "Options +ExecCGI
> -MultiViews +SymLinksIfOwnerMatch" to my server's httpd.conf file. It was
> set to Options None.
>
> However, it hasn't resolved the problem.
>
> I am running Fedora C7 i386 with Apache/2.2.8 (Unix) and I have BioPerl
> version 1.0069 installed.
>
> I should mention one thing that I thought I should ask you. I thought this
> might be an issue. when I installed gbrowse using the basic installation
> method, I get the following:
>
> Should I use your previous settings to set the file paths and options (y/n)
> [y]? n
> Apache root directory (enter '' for none)? [/usr/local/apache] /data/web
> Apache conf directory? [/etc/httpd/conf]
> Apache htdocs directory? [/var/www/html]
> Apache cgibin directory? [/var/www/cgi-bin]
> GBrowse root for static files? [gbrowse]
> ----------------------------------------------
>                 File Paths
>
>          CONF /etc/httpd/conf
>        HTDOCS /var/www/html
>        CGIBIN /var/www/cgi-bin
> GBROWSE_ROOT gbrowse
> INSTALL_BASE
>           LIB
>           BIN
>           YES
>        PREFIX
> PACKAGE_DIR
>         DO_XS 1
>       NONROOT
>       SELINUX
>
> (Run perl Makefile.PL -h for help on changing)
> ----------------------------------------------
> Warning: prerequisite Bio::Perl 1.006 not found. We have unknown version.
> Writing Makefile for Bio::Graphics::Browser::CAlign
> Writing Makefile for Generic-Genome-Browser
>
> It gives a warning that the prerequisite Bio::Perl 1.006 was not found.
>
> Could this be the issue why it's not executing the perl script?
>
> Abhishek
>
>
> Abhishek Goel
> Staff Research Associate
> Geschwind Laboratory, UCLA Neurology
> Gonda Neuroscience and Genetics Research Center #2309
> University of California Los Angeles
> 695 Charles E. Young Dr. South
> Los Angeles, CA 90095
> Tel: (310) 794-7537
> Fax: (310) 267-2401
>
>
>
>
>
> On Wed, Nov 18, 2009 at 5:33 AM, Scott Cain <scott@...> wrote:
>>
>> Hi Abhishek,
>>
>> Your apache isn't configured correctly. There should be a section for
>> defining your cgi-bin directory, that looks something like this
>> (exactly what it looks like will depend on your platform):
>>
>> ScriptAliasMatch ^/cgi-bin/((?!(?i:webobjects)).*$)
>> "/Library/WebServer/CGI-Executables/$1"
>>
>> or
>>
>> ScriptAlias /cgi-bin/ /usr/lib/cgi-bin/
>> <Directory "/usr/lib/cgi-bin">
>> AllowOverride None
>> Options +ExecCGI -MultiViews +SymLinksIfOwnerMatch
>> Order allow,deny
>> Allow from all
>> </Directory>
>>
>> Usually, this is present by default in most apache configurations.
>> Without it, apache thinks that the gbrowse CGIs are plain text files
>> and serves them up as such.
>>
>> Scott
>>
>>
>> On Wed, Nov 18, 2009 at 12:37 AM, Abhishek Goel
>> <abhishekspeare@...> wrote:
>> >
>> > Hello,
>> >
>> > I am trying to install gbrowse on one of our webservers and I'm having
>> > some
>> > difficulty. I would be really grateful if someone could give me some
>> > pointers on what might be wrong.
>> >
>> > I followed the instructions and updated apache, installed bioperl and
>> > other
>> > perl modules and then installed gbrowse. The installation went through
>> > smoothly without any errors.
>> >
>> > When I got to the browser at http://www.geschwind.med.ucla.edu/gbrowse/
>> > i can see the gbrowser installation. However, when I click on the
>> > http://localhost/cgi-bin/gbrowse/yeast link I just see the following:
>> >
>> > #!/usr/bin/perl -w
>> >
>> > ###################################################################
>> > # Non-modperl users should change this variable if needed to point
>> > # to the directory in which the configuration files are stored.
>> >
>> >
>> > #
>> > $CONF_DIR = '/etc/httpd/conf/gbrowse.conf';
>> > #
>> > ###################################################################
>> > $VERSION = " 1.70";
>> > $BIOGRAPHICS_VERSION = 1.8;
>> >
>> >
>> > # $Id: gbrowse.PLS,v 1.119.4.57.2.59.2.130 2009/06/25 21:20:15 scottcain
>> > Exp
>> > $
>> >
>> >
>> >
>> > use strict;
>> > use Bio::Graphics;
>> > use Bio::Graphics::Browser;
>> > use Bio::Graphics::Browser::Util;
>> > use Bio::Graphics::Browser::PluginSet;
>> > use Bio::Graphics::Browser::UploadSet;
>> > use Bio::Graphics::Browser::RemoteSet;
>> >
>> >
>> > use Bio::Graphics::Browser::PageSettings;
>> > use Digest::MD5 'md5_hex';
>> > use File::Path 'mkpath';
>> > use Text::Tabs;
>> > use File::Basename 'basename','dirname';
>> > use File::Spec;
>> > use Carp qw(:DEFAULT croak);
>> >
>> >
>> > use CGI qw(:standard unescape escape escapeHTML center *table *dl *TR
>> > *td
>> > script);
>> > use CGI::Toggle;
>> > use CGI::Cookie;
>> >
>> > use vars qw($CONFIG $MAX_SEGMENT $DEFAULT_SEGMENT
>> > $HEADER $HTML $UA $VERSION $BIOGRAPHICS_VERSION $CONF_DIR
>> >
>> >
>> > %PLUGINS $PLUGINS $UPLOADED_SOURCES $REMOTE_SOURCES
>> > $PRESETS $HAVE_SVG $HAVE_PDF
>> > %OBJECT_CLASSES %PLUGIN_NAME2LABEL );
>> >
>> >
>> > # if you change the zoom/nav icons, you must change this as well.
>> >
>> > use constant MAG_ICON_HEIGHT => 20;
>> >
>> > use constant MAG_ICON_WIDTH => 8;
>> >
>> > # had-coded values for segment sizes
>> > # many of these can be overridden by configuration file entries
>> > use constant MAX_SEGMENT => 1_000_000;
>> > use constant MIN_SEG_SIZE => 20;
>> >
>> >
>> > use constant TINY_SEG_SIZE => 2;
>> > use constant EXPAND_SEG_SIZE => 5000;
>> > use constant TOO_MANY_SEGMENTS => 5_000;
>> > use constant TOO_MANY_FEATURES => 100;
>> > use constant TOO_MANY_REFS => TOO_MANY_FEATURES;
>> >
>> >
>> > use constant DEFAULT_SEGMENT => 100_000;
>> > use constant DEFAULT_REGION_SIZE => 100_000_000;
>> > use constant OVERVIEW_RATIO => 0.9;
>> > use constant ANNOTATION_EDIT_ROWS => 25;
>> > use constant ANNOTATION_EDIT_COLS => 100;
>> >
>> >
>> >
>> > Abhishek Goel
>> > Staff Research Associate
>> > Geschwind Laboratory, UCLA Neurology
>> > Gonda Neuroscience and Genetics Research Center #2309
>> > University of California Los Angeles
>> > 695 Charles E. Young Dr. South
>> > Los Angeles, CA 90095
>> > Tel: (310) 794-7537
>> > Fax: (310) 267-2401
>> >
>> >
>> >
>> >
>> >
>> >
>> > ------------------------------------------------------------------------------
>> > Let Crystal Reports handle the reporting - Free Crystal Reports 2008
>> > 30-Day
>> > trial. Simplify your report design, integration and deployment - and
>> > focus
>> > on
>> > what you do best, core application coding. Discover what's new with
>> > Crystal Reports now. http://p.sf.net/sfu/bobj-july
>> > _______________________________________________
>> > Gmod-gbrowse mailing list
>> > Gmod-gbrowse@...
>> > https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
>> >
>> >
>>
>>
>>
>> --
>> ------------------------------------------------------------------------
>> Scott Cain, Ph. D. scott at scottcain
>> dot net
>> GMOD Coordinator (http://gmod.org/) 216-392-3087
>> Ontario Institute for Cancer Research
>
>

Re: Help with GBrowse installation

2009-11-18T11:25:46Z

Hello Scott,

Thank you for your very quick response. I added the "Options +ExecCGI -MultiViews +SymLinksIfOwnerMatch" to my server's httpd.conf file. It was set to Options None.

However, it hasn't resolved the problem.

I am running Fedora C7 i386 with Apache/2.2.8 (Unix) and I have BioPerl version 1.0069 installed.

I should mention one thing that I thought I should ask you. I thought this might be an issue. when I installed gbrowse using the basic installation method, I get the following:

Should I use your previous settings to set the file paths and options (y/n) [y]? n
Apache root directory (enter '' for none)? [/usr/local/apache] /data/web
Apache conf directory? [/etc/httpd/conf]
Apache htdocs directory? [/var/www/html]
Apache cgibin directory? [/var/www/cgi-bin]
GBrowse root for static files? [gbrowse]
----------------------------------------------
                File Paths

         CONF /etc/httpd/conf
       HTDOCS /var/www/html
       CGIBIN /var/www/cgi-bin
GBROWSE_ROOT gbrowse
INSTALL_BASE
          LIB
          BIN
          YES
       PREFIX
PACKAGE_DIR
        DO_XS 1
      NONROOT
      SELINUX

(Run perl Makefile.PL -h for help on changing)
----------------------------------------------
Warning: prerequisite Bio::Perl 1.006 not found. We have unknown version.
Writing Makefile for Bio::Graphics::Browser::CAlign
Writing Makefile for Generic-Genome-Browser

It gives a warning that the prerequisite Bio::Perl 1.006 was not found.

Could this be the issue why it's not executing the perl script?

Abhishek

Abhishek Goel
Staff Research Associate
Geschwind Laboratory, UCLA Neurology
Gonda Neuroscience and Genetics Research Center #2309
University of California Los Angeles
695 Charles E. Young Dr. South
Los Angeles, CA 90095
Tel: (310) 794-7537
Fax: (310) 267-2401

On Wed, Nov 18, 2009 at 5:33 AM, Scott Cain <scott@...> wrote:

Hi Abhishek,

Your apache isn't configured correctly. There should be a section for
defining your cgi-bin directory, that looks something like this
(exactly what it looks like will depend on your platform):

ScriptAliasMatch ^/cgi-bin/((?!(?i:webobjects)).*$)
"/Library/WebServer/CGI-Executables/$1"

or

ScriptAlias /cgi-bin/ /usr/lib/cgi-bin/
<Directory "/usr/lib/cgi-bin">
AllowOverride None
Options +ExecCGI -MultiViews +SymLinksIfOwnerMatch
Order allow,deny
Allow from all
</Directory>

Usually, this is present by default in most apache configurations.
Without it, apache thinks that the gbrowse CGIs are plain text files
and serves them up as such.

Scott

On Wed, Nov 18, 2009 at 12:37 AM, Abhishek Goel
<abhishekspeare@...> wrote:
>
> Hello,
>
> I am trying to install gbrowse on one of our webservers and I'm having some
> difficulty. I would be really grateful if someone could give me some
> pointers on what might be wrong.
>
> I followed the instructions and updated apache, installed bioperl and other
> perl modules and then installed gbrowse. The installation went through
> smoothly without any errors.
>
> When I got to the browser at http://www.geschwind.med.ucla.edu/gbrowse/
> i can see the gbrowser installation. However, when I click on the
> http://localhost/cgi-bin/gbrowse/yeast link I just see the following:
>
> #!/usr/bin/perl -w
>
> ###################################################################
> # Non-modperl users should change this variable if needed to point
> # to the directory in which the configuration files are stored.
>
>
> #
> $CONF_DIR = '/etc/httpd/conf/gbrowse.conf';
> #
> ###################################################################
> $VERSION = " 1.70";
> $BIOGRAPHICS_VERSION = 1.8;
>
>
> # $Id: gbrowse.PLS,v 1.119.4.57.2.59.2.130 2009/06/25 21:20:15 scottcain Exp
> $
>
>
>
> use strict;
> use Bio::Graphics;
> use Bio::Graphics::Browser;
> use Bio::Graphics::Browser::Util;
> use Bio::Graphics::Browser::PluginSet;
> use Bio::Graphics::Browser::UploadSet;
> use Bio::Graphics::Browser::RemoteSet;
>
>
> use Bio::Graphics::Browser::PageSettings;
> use Digest::MD5 'md5_hex';
> use File::Path 'mkpath';
> use Text::Tabs;
> use File::Basename 'basename','dirname';
> use File::Spec;
> use Carp qw(:DEFAULT croak);
>
>
> use CGI qw(:standard unescape escape escapeHTML center *table *dl *TR *td
> script);
> use CGI::Toggle;
> use CGI::Cookie;
>
> use vars qw($CONFIG $MAX_SEGMENT $DEFAULT_SEGMENT
> $HEADER $HTML $UA $VERSION $BIOGRAPHICS_VERSION $CONF_DIR
>
>
> %PLUGINS $PLUGINS $UPLOADED_SOURCES $REMOTE_SOURCES
> $PRESETS $HAVE_SVG $HAVE_PDF
> %OBJECT_CLASSES %PLUGIN_NAME2LABEL );
>
>
> # if you change the zoom/nav icons, you must change this as well.
>
> use constant MAG_ICON_HEIGHT => 20;
>
> use constant MAG_ICON_WIDTH => 8;
>
> # had-coded values for segment sizes
> # many of these can be overridden by configuration file entries
> use constant MAX_SEGMENT => 1_000_000;
> use constant MIN_SEG_SIZE => 20;
>
>
> use constant TINY_SEG_SIZE => 2;
> use constant EXPAND_SEG_SIZE => 5000;
> use constant TOO_MANY_SEGMENTS => 5_000;
> use constant TOO_MANY_FEATURES => 100;
> use constant TOO_MANY_REFS => TOO_MANY_FEATURES;
>
>
> use constant DEFAULT_SEGMENT => 100_000;
> use constant DEFAULT_REGION_SIZE => 100_000_000;
> use constant OVERVIEW_RATIO => 0.9;
> use constant ANNOTATION_EDIT_ROWS => 25;
> use constant ANNOTATION_EDIT_COLS => 100;
>
>
>
> Abhishek Goel
> Staff Research Associate
> Geschwind Laboratory, UCLA Neurology
> Gonda Neuroscience and Genetics Research Center #2309
> University of California Los Angeles
> 695 Charles E. Young Dr. South
> Los Angeles, CA 90095
> Tel: (310) 794-7537
> Fax: (310) 267-2401
>
>
>
>
>

> ------------------------------------------------------------------------------
> Let Crystal Reports handle the reporting - Free Crystal Reports 2008 30-Day
> trial. Simplify your report design, integration and deployment - and focus
> on
> what you do best, core application coding. Discover what's new with
> Crystal Reports now. http://p.sf.net/sfu/bobj-july
> _______________________________________________
> Gmod-gbrowse mailing list
> Gmod-gbrowse@...
> https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
>
>

--
------------------------------------------------------------------------
Scott Cain, Ph. D. scott at scottcain dot net
GMOD Coordinator (http://gmod.org/) 216-392-3087
Ontario Institute for Cancer Research

Re: Help with GBrowse installation

2009-11-18T05:33:04Z

Hi Abhishek,

Your apache isn't configured correctly. There should be a section for
defining your cgi-bin directory, that looks something like this
(exactly what it looks like will depend on your platform):

ScriptAliasMatch ^/cgi-bin/((?!(?i:webobjects)).*$)
"/Library/WebServer/CGI-Executables/$1"

or

ScriptAlias /cgi-bin/ /usr/lib/cgi-bin/
<Directory "/usr/lib/cgi-bin">
AllowOverride None
Options +ExecCGI -MultiViews +SymLinksIfOwnerMatch
Order allow,deny
Allow from all
</Directory>

Usually, this is present by default in most apache configurations.
Without it, apache thinks that the gbrowse CGIs are plain text files
and serves them up as such.

Scott

On Wed, Nov 18, 2009 at 12:37 AM, Abhishek Goel
<abhishekspeare@...> wrote:

>
> Hello,
>
> I am trying to install gbrowse on one of our webservers and I'm having some
> difficulty. I would be really grateful if someone could give me some
> pointers on what might be wrong.
>
> I followed the instructions and updated apache, installed bioperl and other
> perl modules and then installed gbrowse. The installation went through
> smoothly without any errors.
>
> When I got to the browser at http://www.geschwind.med.ucla.edu/gbrowse/
> i can see the gbrowser installation. However, when I click on the
> http://localhost/cgi-bin/gbrowse/yeast link I just see the following:
>
> #!/usr/bin/perl -w
>
> ###################################################################
> # Non-modperl users should change this variable if needed to point
> # to the directory in which the configuration files are stored.
>
>
> #
> $CONF_DIR = '/etc/httpd/conf/gbrowse.conf';
> #
> ###################################################################
> $VERSION = " 1.70";
> $BIOGRAPHICS_VERSION = 1.8;
>
>
> # $Id: gbrowse.PLS,v 1.119.4.57.2.59.2.130 2009/06/25 21:20:15 scottcain Exp
> $
>
>
>
> use strict;
> use Bio::Graphics;
> use Bio::Graphics::Browser;
> use Bio::Graphics::Browser::Util;
> use Bio::Graphics::Browser::PluginSet;
> use Bio::Graphics::Browser::UploadSet;
> use Bio::Graphics::Browser::RemoteSet;
>
>
> use Bio::Graphics::Browser::PageSettings;
> use Digest::MD5 'md5_hex';
> use File::Path 'mkpath';
> use Text::Tabs;
> use File::Basename 'basename','dirname';
> use File::Spec;
> use Carp qw(:DEFAULT croak);
>
>
> use CGI qw(:standard unescape escape escapeHTML center *table *dl *TR *td
> script);
> use CGI::Toggle;
> use CGI::Cookie;
>
> use vars qw($CONFIG $MAX_SEGMENT $DEFAULT_SEGMENT
> $HEADER $HTML $UA $VERSION $BIOGRAPHICS_VERSION $CONF_DIR
>
>
> %PLUGINS $PLUGINS $UPLOADED_SOURCES $REMOTE_SOURCES
> $PRESETS $HAVE_SVG $HAVE_PDF
> %OBJECT_CLASSES %PLUGIN_NAME2LABEL );
>
>
> # if you change the zoom/nav icons, you must change this as well.
>
> use constant MAG_ICON_HEIGHT => 20;
>
> use constant MAG_ICON_WIDTH => 8;
>
> # had-coded values for segment sizes
> # many of these can be overridden by configuration file entries
> use constant MAX_SEGMENT => 1_000_000;
> use constant MIN_SEG_SIZE => 20;
>
>
> use constant TINY_SEG_SIZE => 2;
> use constant EXPAND_SEG_SIZE => 5000;
> use constant TOO_MANY_SEGMENTS => 5_000;
> use constant TOO_MANY_FEATURES => 100;
> use constant TOO_MANY_REFS => TOO_MANY_FEATURES;
>
>
> use constant DEFAULT_SEGMENT => 100_000;
> use constant DEFAULT_REGION_SIZE => 100_000_000;
> use constant OVERVIEW_RATIO => 0.9;
> use constant ANNOTATION_EDIT_ROWS => 25;
> use constant ANNOTATION_EDIT_COLS => 100;
>
>
>
> Abhishek Goel
> Staff Research Associate
> Geschwind Laboratory, UCLA Neurology
> Gonda Neuroscience and Genetics Research Center #2309
> University of California Los Angeles
> 695 Charles E. Young Dr. South
> Los Angeles, CA 90095
> Tel: (310) 794-7537
> Fax: (310) 267-2401
>
>
>
>
>
> ------------------------------------------------------------------------------
> Let Crystal Reports handle the reporting - Free Crystal Reports 2008 30-Day
> trial. Simplify your report design, integration and deployment - and focus
> on
> what you do best, core application coding. Discover what's new with
> Crystal Reports now. http://p.sf.net/sfu/bobj-july
> _______________________________________________
> Gmod-gbrowse mailing list
> Gmod-gbrowse@...
> https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
>
>

Re: database update

2009-11-18T01:24:59Z

Hi Raul,

Another way to do this is to use the bioperl script,
bp_seqfeature_delete.pl to delete the offending track's data, before
reloading the corrected data.

Regards, Simon

>
> On Tue, Nov 17, 2009 at 11:14 AM, raul petrin <rjpetrin@...> wrote:
>> Hello All
>> I'd like to know if I can update my database data,
>> I'm using mysql and I have some files loaded into it, but now I need to
>> update some data. Do I have some scripts to do it or I need to upload
>> everything again?
>> Thanks

------------------------------------------------------------------------------
Let Crystal Reports handle the reporting - Free Crystal Reports 2008 30-Day
trial. Simplify your report design, integration and deployment - and focus on
what you do best, core application coding. Discover what's new with
Crystal Reports now. http://p.sf.net/sfu/bobj-july
_______________________________________________
Gmod-gbrowse mailing list
Gmod-gbrowse@...
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse

Help with GBrowse installation

2009-11-17T21:37:25Z

Hello,

I am trying to install gbrowse on one of our webservers and I'm having some difficulty. I would be really grateful if someone could give me some pointers on what might be wrong.

I followed the instructions and updated apache, installed bioperl and other perl modules and then installed gbrowse. The installation went through smoothly without any errors.

When I got to the browser at http://www.geschwind.med.ucla.edu/gbrowse/
i can see the gbrowser installation. However, when I click on the http://localhost/cgi-bin/gbrowse/yeast link I just see the following:

#!/usr/bin/perl -w

###################################################################
# Non-modperl users should change this variable if needed to point
# to the directory in which the configuration files are stored.


#
$CONF_DIR  = '/etc/httpd/conf/gbrowse.conf';
#
###################################################################
$VERSION   = " 1.70";
$BIOGRAPHICS_VERSION   = 1.8;


# $Id: gbrowse.PLS,v 1.119.4.57.2.59.2.130 2009/06/25 21:20:15 scottcain Exp $



use strict;
use Bio::Graphics;
use Bio::Graphics::Browser;
use Bio::Graphics::Browser::Util;
use Bio::Graphics::Browser::PluginSet;
use Bio::Graphics::Browser::UploadSet;
use Bio::Graphics::Browser::RemoteSet;


use Bio::Graphics::Browser::PageSettings;
use Digest::MD5 'md5_hex';
use File::Path 'mkpath';
use Text::Tabs;
use File::Basename 'basename','dirname';
use File::Spec;
use Carp qw(:DEFAULT croak);


use CGI qw(:standard unescape escape escapeHTML center *table *dl *TR *td script);
use CGI::Toggle;
use CGI::Cookie;

use vars qw($CONFIG $MAX_SEGMENT $DEFAULT_SEGMENT
	    $HEADER $HTML $UA $VERSION $BIOGRAPHICS_VERSION $CONF_DIR


	    %PLUGINS $PLUGINS $UPLOADED_SOURCES $REMOTE_SOURCES
	    $PRESETS $HAVE_SVG $HAVE_PDF
	    %OBJECT_CLASSES %PLUGIN_NAME2LABEL );


# if you change the zoom/nav icons, you must change this as well.

use constant MAG_ICON_HEIGHT => 20;

use constant MAG_ICON_WIDTH  => 8;

# had-coded values for segment sizes
# many of these can be overridden by configuration file entries
use constant MAX_SEGMENT     => 1_000_000;
use constant MIN_SEG_SIZE         => 20;


use constant TINY_SEG_SIZE        => 2;
use constant EXPAND_SEG_SIZE      => 5000;
use constant TOO_MANY_SEGMENTS => 5_000;
use constant TOO_MANY_FEATURES => 100;
use constant TOO_MANY_REFS     => TOO_MANY_FEATURES;


use constant DEFAULT_SEGMENT => 100_000;
use constant DEFAULT_REGION_SIZE => 100_000_000;
use constant OVERVIEW_RATIO  => 0.9;
use constant ANNOTATION_EDIT_ROWS => 25;
use constant ANNOTATION_EDIT_COLS => 100;

Abhishek Goel
Staff Research Associate
Geschwind Laboratory, UCLA Neurology
Gonda Neuroscience and Genetics Research Center #2309
University of California Los Angeles
695 Charles E. Young Dr. South
Los Angeles, CA 90095
Tel: (310) 794-7537
Fax: (310) 267-2401