|
»
»
problems with clustalw
|
View:
New views
8 Messages
—
Rating Filter:
Alert me
|
 |
problems with clustalw
by nisa_dar
::
Rate this Message:
Hi,
I need to do multiple sequence alignments of DNA sequences by using Bioperl. I am using the following module Bio::Tools::Run::Alignment::Clustalw; and I am getting the following error message Can't locate Bio/Tools/Run/Alignment/Clustalw.pm in @INC (@INC contains: /share/iNquiry/perl/lib/5.8.5/x86_64-linux-thread-multi /share/iNquiry/perl/lib/5.8.5 /share/iNquiry/perl/lib/x86_64-linux-thread-multi /share/iNquiry/perl/lib/5.8.4 /share/iNquiry/perl/lib/5.8.3 /share/iNquiry/perl/lib/5.8.2 /share/iNquiry/perl/lib/5.8.1 /share/iNquiry/perl/lib/5.8.0 /share/iNquiry/perl/lib /usr/lib64/perl5/5.8.5/x86_64-linux-thread-multi /usr/lib/perl5/5.8.5 /usr/lib64/perl5/site_perl/5.8.5/x86_64-linux-thread-multi /usr/lib64/perl5/site_perl/5.8.4/x86_64-linux-thread-multi /usr/lib64/perl5/site_perl/5.8.3/x86_64-linux-thread-multi /usr/lib64/perl5/site_perl/5.8.2/x86_64-linux-thread-multi /usr/lib64/perl5/site_perl/5.8.1/x86_64-linux-thread-multi /usr/lib64/perl5/site_perl/5.8.0/x86_64-linux-thread-multi /usr/lib/perl5/site_perl/5.8.5 /usr/lib/perl5/site_perl/5.8.4 /usr/lib/perl5/site_perl/5.8.3 /usr/lib/perl5/site_perl/5.8.2 /usr/lib/perl5/site_perl/5.8.1 /usr/lib/perl5/site_perl/5.8.0 /usr/lib/perl5/site_perl /usr/lib64/perl5/vendor_perl/5.8.5/x86_64-linux-thread-multi /usr/lib64/perl5/vendor_perl/5.8.4/x86_64-linux-thread-multi /usr/lib64/perl5/vendor_perl/5.8.3/x86_64-linux-thread-multi /usr/lib64/perl5/vendor_perl/5.8.2/x86_64-linux-thread-multi /usr/lib64/perl5/vendor_perl/5.8.1/x86_64-linux-thread-multi /usr/lib64/perl5/vendor_perl/5.8.0/x86_64-linux-thread-multi /usr/lib/perl5/vendor_perl/5.8.5 /usr/lib/perl5/vendor_perl/5.8.4 /usr/lib/perl5/vendor_perl/5.8.3 /usr/lib/perl5/vendor_perl/5.8.2 /usr/lib/perl5/vendor_perl/5.8.1 /usr/lib/perl5/vendor_perl/5.8.0 /usr/lib/perl5/vendor_perl .) at mult_align.pl line 9. BEGIN failed--compilation aborted at mult_align.pl line 9. Here is the piece of code that gives this message #!/usr/bin/perl -w use Bio::SeqIO; use Bio::Align::AlignI; use Bio::AlignIO; use Bio::AlignIO::msf; use Bio::SimpleAlign; use Bio::PrimarySeq; use Bio::Tools::Run::Alignment::Clustalw; use Bio::Root::IO; use Bio::Seq; my $query_string = "tatgtggctggcgagacacgacacttcatatggttttacctctacgtttgagtaattaagtacaatgagctatcact"; my $hit_string = "tatgtggctggcgagacacgacacttcatatggttttacctctacgtttgagtaattaagtacaatgagctatcact"; my $hit_string_two = "tatgtggctggcgagacacgacacttcatatggttttacctctacgtttgagtaattaagtacaatgagctatcact"; my @params = ('ktuple' => 2, 'matrix' => 'BLOSUM'); my $factory = Bio::Tools::Run::Alignment::Clustalw->new(@params); my $ktuple = 2; $factory->ktuple($ktuple); my $seq_obj_on = Bio::Seq->new(-id =>"thal", -seq =>"$query_string"); my $seq_obj_too = Bio::Seq->new(-id =>"lyrata", -seq =>"$hit_string"); my $seq_obj_thre = Bio::Seq->new(-id =>"boechera", -seq =>"$hit_string_two"); my @seq_array = qw/$seq_obj_on $seq_obj_too $seq_obj_thre/; my $seq_array_ref = \@seq_array; my $aln = $factory->align($seq_array_ref); I would appreciate if anyone could help. I don't know how to supply the environment variables at unix so if this is the solution please explain how can I do that. Thanks! |
|
|
Re: problems with clustalw
by Sendu Bala-2
::
Rate this Message:
nisa_dar wrote:
> I need to do multiple sequence alignments of DNA sequences by using Bioperl. > I am using the following module > Bio::Tools::Run::Alignment::Clustalw; > and I am getting the following error message > > Can't locate Bio/Tools/Run/Alignment/Clustalw.pm in @INC You need to install Bioperl-run, eg. cpan cpan>install S/SE/SENDU/bioperl-run-1.5.2_100.tar.gz (if you have core 1.5.2) _______________________________________________ Bioperl-l mailing list Bioperl-l@... http://lists.open-bio.org/mailman/listinfo/bioperl-l |
|
|
|
|
|
Re: problems with clustalw
by nisa_dar
::
Rate this Message:
Yes, seems like it worked, now I am having the following error message which is
not because of the errors in installation..right? $ perl mult_align.pl Can't call method "isa" without a package or object reference at /opt/rocks/lib/perl5/site_perl/5.8.8//Bio/Tools/Run/Alignment/Clustalw.pm line 617. Quoting Sendu Bala <bix@...>: > vdar@... wrote: > > Hi, > > > > Yes, I have clustalw installed and following is the result o which command > > > > $ which clustalw > > /opt/Bio/bin/clustalw > > > > Please see aa.txt as output of perl -V and mult_align.pl is my script > > I've CC'd back the bioperl mailing list so other people can learn. > Please keep it CC'd. > > Your script has two main errors: > > use Clustalw; > $ENV{CLUSTALDIR} = > '/opt/rocks/lib/perl5/site_perl/5.8.8/Bio/Tools/Run/Alignment/'; > > These should be: > use Bio::Tools::Run::Alignment::Clustalw; > $ENV{CLUSTALDIR} = '/opt/Bio/bin/clustalw'; > > There is also something very wrong with your installation, since you are > using perl 5.8.5 yet have bioperl-run installed into a directory for > 5.8.8. This is why Bio::Tools::Run::Alignment::Clustalw wasn't being > found in the normal way; the 5.8.8 directory was never checked. > > PERL5LIB="/opt/rocks/lib/perl5/site_perl/5.8.8" should let it be found. > If not, you might have to move the Bio folder from 5.8.8 to 5.8.5. > _______________________________________________ Bioperl-l mailing list Bioperl-l@... http://lists.open-bio.org/mailman/listinfo/bioperl-l |
|
|
Re: problems with clustalw
by Sendu Bala-2
::
Rate this Message:
vdar@... wrote:
> Yes, seems like it worked, now I am having the following error message which is > not because of the errors in installation..right? > > $ perl mult_align.pl > Can't call method "isa" without a package or object reference at > /opt/rocks/lib/perl5/site_perl/5.8.8//Bio/Tools/Run/Alignment/Clustalw.pm line > 617. You weren't passing sequence objects to align() due to another error in your script: Instead of: my @seq_array = qw/$seq_obj_on $seq_obj_too $seq_obj_thre/; my $seq_array_ref = \@seq_array; my $aln = $factory->align($seq_array_ref); You can have: my @seq_array = ($seq_obj_on, $seq_obj_too, $seq_obj_thre); my $seq_array_ref = \@seq_array; my $aln = $factory->align($seq_array_ref); Or just: my $aln = $factory->align([$seq_obj_on, $seq_obj_too, $seq_obj_thre]); _______________________________________________ Bioperl-l mailing list Bioperl-l@... http://lists.open-bio.org/mailman/listinfo/bioperl-l |
|
|
Re: problems with clustalw
by nisa_dar
::
Rate this Message:
Thanks a lot! You have solved the problem. I am getting the following output
now. Would it be possible for you to let me know how can I print the alignments? I need the alignments as we get after running web-based clustalw or multalin programs. CLUSTAL W (1.83) Multiple Sequence Alignments Sequence format is Pearson Sequence 1: thal 77 bp Sequence 2: lyrata 77 bp Sequence 3: boechera 77 bp Start of Pairwise alignments Aligning... Sequences (1:2) Aligned. Score: 100 Sequences (1:3) Aligned. Score: 100 Sequences (2:3) Aligned. Score: 100 Guide tree file created: [/tmp/EIZp1pI1gi/jKZ8gRG2dY.dnd] Start of Multiple Alignment There are 2 groups Aligning... Group 1: Sequences: 2 Score:1463 Group 2: Sequences: 3 Score:1463 Alignment Score 1551 GCG-Alignment file created [/tmp/EIZp1pI1gi/Wa9Du2UIum] Nisa Quoting Sendu Bala <bix@...>: > vdar@... wrote: > > Yes, seems like it worked, now I am having the following error message > which is > > not because of the errors in installation..right? > > > > $ perl mult_align.pl > > Can't call method "isa" without a package or object reference at > > /opt/rocks/lib/perl5/site_perl/5.8.8//Bio/Tools/Run/Alignment/Clustalw.pm > line > > 617. > > You weren't passing sequence objects to align() due to another error in > your script: > > Instead of: > my @seq_array = qw/$seq_obj_on $seq_obj_too $seq_obj_thre/; > my $seq_array_ref = \@seq_array; > my $aln = $factory->align($seq_array_ref); > > You can have: > my @seq_array = ($seq_obj_on, $seq_obj_too, $seq_obj_thre); > my $seq_array_ref = \@seq_array; > my $aln = $factory->align($seq_array_ref); > > Or just: > my $aln = $factory->align([$seq_obj_on, $seq_obj_too, $seq_obj_thre]); > _______________________________________________ Bioperl-l mailing list Bioperl-l@... http://lists.open-bio.org/mailman/listinfo/bioperl-l |
|
|
Re: problems with clustalw
by Sendu Bala-2
::
Rate this Message:
vdar@... wrote:
> Thanks a lot! You have solved the problem. I am getting the following output > now. Would it be possible for you to let me know how can I print the > alignments? I need the alignments as we get after running web-based clustalw or > multalin programs. >[...] >> Or just: >> my $aln = $factory->align([$seq_obj_on, $seq_obj_too, $seq_obj_thre]); $aln is a Bio::SimpleAlign object. Check the docs for how to use it: http://docs.bioperl.org/bioperl-live/Bio/SimpleAlign.html For printing, you'll want to use AlignIO: http://docs.bioperl.org/bioperl-live/Bio/AlignIO.html For an example, see: http://www.bioperl.org/wiki/HOWTO:SearchIO#Using_the_methods _______________________________________________ Bioperl-l mailing list Bioperl-l@... http://lists.open-bio.org/mailman/listinfo/bioperl-l |
|
|
Re: problems with clustalw
by nisa_dar
::
Rate this Message:
Thank you so much!
Nisa Quoting Sendu Bala <bix@...>: > vdar@... wrote: > > Thanks a lot! You have solved the problem. I am getting the following > output > > now. Would it be possible for you to let me know how can I print the > > alignments? I need the alignments as we get after running web-based > clustalw or > > multalin programs. > >[...] > >> Or just: > >> my $aln = $factory->align([$seq_obj_on, $seq_obj_too, $seq_obj_thre]); > > $aln is a Bio::SimpleAlign object. > Check the docs for how to use it: > http://docs.bioperl.org/bioperl-live/Bio/SimpleAlign.html > > For printing, you'll want to use AlignIO: > http://docs.bioperl.org/bioperl-live/Bio/AlignIO.html > For an example, see: > http://www.bioperl.org/wiki/HOWTO:SearchIO#Using_the_methods > > _______________________________________________ Bioperl-l mailing list Bioperl-l@... http://lists.open-bio.org/mailman/listinfo/bioperl-l |
| Free embeddable forum powered by Nabble | Forum Help |
